Use of reagent for targeted delivery of circamy2b in preparation of anti-esophageal cancer drugs

CN122208553BActive Publication Date: 2026-08-21KUNMING MEDICAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610679148.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-18
Publication Date
2026-08-21
Estimated Expiration
2046-05-18

AI Technical Summary

Technical Problem

本发明旨在解决circAMY2B难以有效递送、食管癌治疗药物靶向性差和毒副作用明显的问题,提供一种高效、靶向、低毒的抗食管癌药物制备方案,实现 circAMY2B 在食管癌细胞中的高效表达,进而有效抑制食管癌的发生和发展

Benefits of technology

本发明首次将靶向递送 circAMY2B 的脂质纳米颗粒应用于抗食管癌药物的制备,开拓了circAMY2B 的临床应用新领域,为食管癌的治疗提供新的药物选择,具有以下显著优点:

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122208553B_ABST
    Figure CN122208553B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to application of a reagent for targeted delivery of circAMY2B in preparation of an anti-esophageal cancer drug. In the application of the reagent for targeted delivery of circAMY2B in preparation of the anti-esophageal cancer drug, the reagent is a lipid nanoparticle for targeted delivery of circAMY2B. The application has the following technical effects: the application first applies the lipid nanoparticle for targeted delivery of circAMY2B in preparation of the anti-esophageal cancer drug, opens up a new field of clinical application of circAMY2B, provides a new drug selection for treatment of esophageal cancer, and has the following remarkable advantages: 1. strong targeting and remarkable curative effect; 2. high stability and good bioavailability; 3. good biological safety and low toxic and side effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of reagents for targeted delivery of circAMY2B in the preparation of anti-esophageal cancer drugs. Background Technology

[0002] Esophageal cancer is one of the most common malignant tumors worldwide, with consistently high incidence and mortality rates. Currently, commonly used clinical treatments include surgical resection, radiotherapy, and chemotherapy. However, due to difficulties in early diagnosis, high recurrence and metastasis rates, treatment outcomes remain unsatisfactory. Therefore, identifying new therapeutic targets and effective treatment strategies is of great importance.

[0003] Circular RNAs (circRNAs) are a novel class of non-coding RNAs characterized by structural stability and tissue-specific expression. In recent years, they have been found to play a wide role in the development and progression of tumors. circAMY2B (circBase ID: hsa_circ_0000099) is a recently discovered circRNA. Its inventors previously found that its expression was significantly downregulated in esophageal cancer tissues, and in vitro experiments confirmed that its overexpression could inhibit the proliferation and migration of esophageal cancer cells. The biological function of this circRNA has not yet been reported in the literature.

[0004] Currently, delivery methods for circRNA mainly include viral vectors and non-viral vectors. While viral vectors possess highly efficient transduction capabilities, they pose risks of immunogenicity and carcinogenicity. Non-viral vectors, such as lipid nanoparticles (LNPs), are gradually becoming a research hotspot for RNA drug delivery due to their good biocompatibility and modifiability. Although there are existing studies on the use of lipid nanoparticles for nucleic acid delivery, there are no reports of applying lipid nanoparticles loaded with circAMY2B to the treatment of esophageal cancer.

[0005] The lack of efficient, safe, and highly targeted delivery systems for circAMY2B in current technologies limits its clinical translational potential. Furthermore, existing RNA delivery systems still have shortcomings in terms of in vivo stability, targeting, and safety, making it difficult to achieve precise delivery and efficient treatment of tumor tissues. While existing lipid nanoparticle delivery systems can be used for nucleic acid delivery, there are currently no customized lipid nanoparticle preparation schemes specifically for circAMY2B, nor have they been applied to the development of anti-esophageal cancer drugs, thus failing to meet the clinical need for targeted delivery of circAMY2B and its anti-esophageal cancer effects. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide the application of reagents for targeted delivery of circAMY2B in the preparation of anti-esophageal cancer drugs, specifically the application of lipid nanoparticles for targeted delivery of circAMY2B in the preparation of anti-esophageal cancer drugs. This invention aims to solve the problems of ineffective delivery of circAMY2B, poor targeting of esophageal cancer treatment drugs, and significant toxic side effects, providing a highly efficient, targeted, and low-toxicity anti-esophageal cancer drug preparation scheme to achieve efficient expression of circAMY2B in esophageal cancer cells, thereby effectively inhibiting the occurrence and development of esophageal cancer.

[0007] The technical solution of this invention to solve the technical problem is as follows: In a first aspect, the present invention provides the use of a reagent for targeted delivery of circAMY2B in the preparation of an anti-esophageal cancer drug, wherein the reagent is a lipid nanoparticle for targeted delivery of circAMY2B.

[0008] Furthermore, the lipid nanoparticles for targeted delivery of circAMY2B include a lipid component and circAMY2B circular RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1; the lipid component comprises Lipid AX4, distearate phosphatidylcholine (DSPC), cholesterol, DMG-PEG2000, and DSPE-PEG2000-iRGD.

[0009] Furthermore, the molar ratio of Lipid AX4, distearate phosphatidylcholine DSPC, cholesterol, DMG-PEG2000 and DSPE-PEG2000-iRGD is 45:10:38:2:2.

[0010] Furthermore, the method for preparing the lipid nanoparticles for targeted delivery of circAMY2B includes the following steps: 1) Lipid AX4, distearate phosphatidylcholine (DSPC), cholesterol, DMG-PEG2000 and DSPE-PEG2000-iRGD were mixed in a molar ratio of 45:10:38:2:2 and dissolved in anhydrous ethanol to form an oil phase; 2) Dissolve circAMY2B in PBS buffer to form an aqueous phase; 3) Inject the oil phase and water phase simultaneously into the microfluidic apparatus, adjust the flow rate ratio to 1:3 and the nitrogen-phosphorus ratio to 6-8, and complete the assembly in the microfluidic chip to form a lipid nanoparticle suspension loaded with circAMY2B; after centrifugation and purification, lipid nanoparticles loaded with circAMY2B, namely LNPs-circAMY2B, are obtained with an encapsulation efficiency of about 90%.

[0011] Furthermore, the drug has any one or more of the following functions: 1) Delivering circAMY2B into esophageal cancer cells; 2) Upregulates the expression of circAMY2B in esophageal cancer cells; 3) Inhibits the proliferation and migration of esophageal cancer cells; 4) Inhibits the development of esophageal cancer both in vitro and in vivo.

[0012] In a second aspect of the invention, a lipid nanoparticle for targeted delivery of circAMY2B is provided, the lipid nanoparticle comprising a lipid component and circAMY2B circular RNA, the nucleotide sequence of the circular RNA being shown in SEQ ID NO: 1; the lipid component comprising Lipid AX4, distearate phosphatidylcholine (DSPC), cholesterol, DMG-PEG2000, and DSPE-PEG2000-iRGD.

[0013] Furthermore, the molar ratio of Lipid AX4, distearate phosphatidylcholine DSPC, cholesterol, DMG-PEG2000 and DSPE-PEG2000-iRGD is 45:10:38:2:2.

[0014] Furthermore, the method for preparing the lipid nanoparticles for targeted delivery of circAMY2B includes the following steps: 1) Lipid AX4, distearate phosphatidylcholine (DSPC), cholesterol, DMG-PEG2000 and DSPE-PEG2000-iRGD were mixed in a molar ratio of 45:10:38:2:2 and dissolved in anhydrous ethanol to form an oil phase; 2) Dissolve circAMY2B in PBS buffer to form an aqueous phase; 3) Inject the oil phase and water phase simultaneously into the microfluidic apparatus, adjust the flow rate ratio to 1:3 and the nitrogen-phosphorus ratio to 6-8, and complete the assembly in the microfluidic chip to form a lipid nanoparticle suspension loaded with circAMY2B; after centrifugation and purification, lipid nanoparticles loaded with circAMY2B, namely LNPs-circAMY2B, are obtained with an encapsulation efficiency of about 90%.

[0015]

[0016] In this invention, the inventors used circAMY2B as the active ingredient and employed microfluidic technology to prepare lipid nanoparticles (LNPs-circAMY2B) loaded with circAMY2B as the core reagent for targeted delivery of circAMY2B. These LNPs serve as the effective component of an anti-esophageal cancer drug and can be used alone or in combination with other anti-esophageal cancer drugs. They can be prepared into various clinically usable dosage forms according to conventional pharmaceutical formulation processes for the treatment of esophageal cancer. Details are as follows: 1.1 Preparation and purification of lipid nanoparticles Lipid AX4, DSPC, cholesterol, DMG-PEG2000, and DSPE-PEG2000-iRGD (molar ratio 45:10:38:2:2) were used as lipid raw materials and assembled with circAMY2B (synthesized by Gisele Biotech) using microfluidic technology to form circAMY2B-loaded lipid nanoparticles. The assembled lipid nanoparticles were purified by centrifugation and replacement of the external solution with PBS buffer to obtain high-purity LNPs-circAMY2B reagent with an encapsulation efficiency of approximately 90%.

[0017] 1.2 Characterization of lipid nanoparticles The lipid nanoparticles have a diameter of approximately 110 nm, exhibiting uniform particle size and good stability.

[0018] 1.3 Validation of the delivery effect of lipid nanoparticles The delivery effect of LNPs-circAMY2B on esophageal cancer cells was verified by RT-qPCR. The results showed that after treatment with LNPs-circAMY2B, the expression level of circAMY2B in esophageal cancer cells showed a significant upregulation trend, proving that the lipid nanoparticles can effectively deliver circAMY2B into esophageal cancer cells and achieve its high-efficiency expression.

[0019] 1.4 Mechanism of action and experimental verification of LNPs-circAMY2B against esophageal cancer This invention demonstrates the anti-esophageal cancer effect of LNPs-circAMY2B through in vitro cell experiments and in vivo animal experiments. Its core mechanism of action is as follows: circAMY2B is efficiently delivered to esophageal cancer cells through targeted lipid nanoparticles, upregulating the expression level of circAMY2B in cancer cells, thereby directly inhibiting the proliferation and migration ability of esophageal cancer cells. At the same time, this delivery system can target and enrich esophageal cancer tissue, reduce the effect on normal tissues, and reduce toxic side effects.

[0020] In vitro cell experiments: The effects of LNPs-circAMY2B on the proliferation of esophageal cancer cells were detected by CCK8 assay and plate colony formation assay, and its effect on the migration ability of esophageal cancer cells was detected by trans-well assay. The results showed that compared with the blank control and empty vector control, LNPs-circAMY2B could significantly inhibit the proliferation activity and colony formation ability of esophageal cancer cells, and effectively reduce the migration ability of esophageal cancer cells.

[0021] In vivo animal experiments: A nude mouse esophageal cancer xenograft model was constructed. LNPs-circAMY2B was injected into tumor-bearing mice via the tail vein, with PBS and empty lipid nanoparticles (LNPs-Ctrl) as controls. The dosing cycle was once every 3 days, for a total of 6 administrations. The results showed that the tumor volume, growth rate and tumor weight in the LNPs-circAMY2B treatment group were significantly lower than those in the control group, proving that it can effectively exert anti-tumor effects in vivo.

[0022] 1.5 Biosafety Validation of Lipid Nanoparticles The biosafety of LNPs-circAMY2B was evaluated through in vivo animal experiments. Weight changes in tumor-bearing mice were measured, and histopathological examination of the major organs (heart, liver, spleen, lungs, and kidneys) was performed using HE staining. Results showed that the weight fluctuations in the LNPs-circAMY2B-treated mice were within a physiologically stable range, and no significant histopathological damage was observed in any of the major organs, demonstrating that the lipid nanodelivery system has no significant systemic toxicity and good biosafety.

[0023] This invention is the first to apply lipid nanoparticles that target and deliver circAMY2B to the preparation of an anti-esophageal cancer drug. The technological innovation lies in: 1. It was confirmed that circAMY2B can serve as an effective target for the treatment of esophageal cancer, and that upregulating the expression of circAMY2B in esophageal cancer cells can significantly inhibit the proliferation and migration of cancer cells; 2. Using microfluidic technology, lipid nanoparticles loaded with circAMY2B with a particle size of approximately 110 nm and good stability (LNPs-circAMY2B) were successfully prepared using DSPC, Lipid AX4, DMG-PEG2000, cholesterol, and DSPE-PEG2000-iRGD as raw materials. 3. It was confirmed that LNPs-circAMY2B can effectively deliver circAMY2B into esophageal cancer cells and significantly upregulate the expression level of circAMY2B in cancer cells; 4. It was confirmed that LNPs-circAMY2B can significantly inhibit the development of esophageal cancer both in vitro and in vivo, with no obvious systemic toxicity and good biosafety. 5. It was confirmed that lipid nanoparticles that target and deliver circAMY2B can be used as an active ingredient in the preparation of anti-esophageal cancer drugs.

[0024] The present invention has the following technical effects: This invention is the first to apply lipid nanoparticles that target and deliver circAMY2B to the preparation of an anti-esophageal cancer drug, opening up a new field of clinical application for circAMY2B and providing a new drug option for the treatment of esophageal cancer. It has the following significant advantages: 1) Strong targeting and significant efficacy: The LNPs-circAMY2B prepared in this invention can efficiently and specifically deliver circAMY2B to esophageal cancer cells, significantly upregulate the expression of circAMY2B in cancer cells, and directly inhibit the proliferation and migration of esophageal cancer cells. Both in vitro and in vivo experiments have confirmed that it can effectively reduce the volume of esophageal cancer tumors and inhibit tumor growth, and its anti-esophageal cancer efficacy is definite. 2) High stability and good bioavailability: The lipid nanoparticles prepared by microfluidic technology have uniform particle size (about 110 nm) and stable structure, which can effectively protect circAMY2B from degradation by nucleases in vivo, greatly improve its bioavailability, and solve the technical problem of difficult effective delivery of naked circAMY2B. 3) Good biocompatibility and low toxicity: The weight of tumor-bearing mice treated with LNPs-circAMY2B did not fluctuate abnormally, and no histopathological damage was observed in the major organs. There was no obvious systemic toxicity. Compared with traditional chemotherapy drugs, it significantly reduced damage to normal tissues and significantly improved safety.

[0025] The lipid nanoparticles for targeted delivery of circAMY2B of the present invention combine nucleic acid targets with a novel delivery system, achieving precise and efficient treatment of esophageal cancer, making up for the shortcomings of existing esophageal cancer treatments, and have important clinical application value and market prospects. Attached Figure Description

[0026] Figure 1 The image shows the particle size distribution of LNPs-circAMY2B. In the image, A is a transmission electron microscopy (TEM) image of LNPs-circAMY2B, showing that the LNPs encapsulating circAMY2B are spherically distributed. B represents the average particle size of LNPs-circAMY2B, which is approximately 106.5 ± 10.2 nm.

[0027] Figure 2The results show the effect of LNPs-circAMY2B on the expression level of circAMY2B in esophageal cancer cells. In A, the results of RT-qPCR detection of the relative expression level of circAMY2B in KYSE150 cells are presented. Compared with the PBS group and the LNPs-Ctrl group, the expression level of circAMY2B in the LNPs-circAMY2B group was significantly upregulated, with a statistically significant difference (P<0.01). In B, the results of RT-qPCR detection of the relative expression level of circAMY2B in TE-1 cells after different treatments are presented. Compared with the PBS group and the LNPs-Ctrl group, the expression level of circAMY2B in the LNPs-circAMY2B group was also significantly increased, with a statistically significant difference (P<0.01).

[0028] Figure 3 The study investigated the inhibitory effect of LNPs-circAMY2B on the in vitro proliferation of esophageal cancer cells. Figure A shows the proliferation curve of KYSE150 cells. The results indicated that with prolonged culture time, the cell proliferation rate of the LNPs-circAMY2B group significantly decreased, and was significantly lower than that of the PBS group and the LNPs-Ctrl group at all time points (P<0.01). Figure B shows the cell viability results of TE-1 cells after different treatments, as detected by the CCK-8 assay. Compared with the PBS group and the LNPs-Ctrl group, the cell viability of the LNPs-circAMY2B group was significantly reduced (P<0.01).

[0029] Figure 4 The study investigated the inhibitory effect of LNPs-circAMY2B on colony formation in esophageal cancer cells on in vitro agar plate formation. In the figures, A represents colony formation in KYSE150 and TE-1 cells after 14 days of LNP treatment; B represents the corresponding statistical analysis results. The results showed that, compared with the control group, LNPs-circAMY2B treatment significantly reduced the colony-forming ability of cells.

[0030] Figure 5 The image shows the inhibitory effect of LNPs-circAMY2B on the in vitro migration of esophageal cancer cells. In the image, A is a crystal violet staining image of cell migration; B is a bar chart showing the number of migrating cells in the Trans-well assay. Figure 5 In Figure B, the horizontal axis represents the experimental groups (PBS group, LNPs-Ctrl group, LNPs-circAMY2B group), and the vertical axis represents the number of migrating cells. The results showed that the number of migrating cells in the LNPs-circAMY2B group was significantly reduced compared with the PBS group and the LNPs-Ctrl group (P<0.01).

[0031] Figure 6This study aimed to demonstrate the inhibitory effect of LNPs-circAMY2B on the growth of esophageal cancer xenografts in vivo. Figure A shows images of tumor tissue after the experiment; the tumor volume in the LNPs-circAMY2B group was significantly smaller than that in the control group. Figure B shows the tumor volume growth curves in nude mice, with the x-axis representing the number of days of drug administration and the y-axis representing tumor volume (mm³). The tumor volume growth in the LNPs-circAMY2B group was significantly slower than that in the PBS and LNPs-Ctrl groups. Figure C shows a bar chart of tumor weight; the tumor weight in the LNPs-circAMY2B group was significantly lower than that in the PBS and LNPs-Ctrl groups (P<0.01).

[0032] Figure 7 The biosafety of LNPs-circAMY2B in nude mice was assessed. Figure A shows the weight change curves of nude mice in each group, with the x-axis representing the number of days of administration and the y-axis representing body weight (g). No significant abnormal fluctuations in body weight were observed in the three groups. Figure B shows HE-stained images of the major organs (heart, liver, spleen, lung, and kidney) of the nude mice in each group. All organs showed normal morphology and no pathological damage. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.

[0034] The sources of raw materials involved in the embodiments of the present invention are explained as follows: Esophageal cancer cell lines KYSE150 and TE-1 were provided by the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. RPMI 1640, DMEM, and 0.05% Trypsin were purchased from Gibco; fetal bovine serum was purchased from Royalcel; CCK8 reagent was purchased from Meilunbio; Trizol reagent was purchased from Takara; and crystal violet was purchased from Beyotime Biotechnology. Trans-well bilayer plates and Matrigel were purchased from Corning; crystal violet was purchased from Beyotime Biotechnology; centrifuge tubes were purchased from BioFIL; and cell culture plates and dishes were purchased from Nest. SPF-grade nude mice (4-6 weeks old, male) were purchased from Hunan Slack Jingda Experimental Animal Co., Ltd.

[0035] The sources of pharmaceutical-grade lipid raw materials are as follows: .

[0036] Example 1: Preparation and purification of lipid nanoparticles loaded with circAMY2B (LNPs-circAMY2B) 1. Experimental materials: Lipid AX4, DSPC, DMG-PEG2000, cholesterol, DSPE-PEG2000-iRGD (all pharmaceutical grade lipid raw materials); circAMY2B (synthesized by Gisele Biotechnology Co., Ltd.); PBS buffer (0.01 mol / L, pH=7.4); microfluidic control system.

[0037] 2. Experimental Methods: Lipid AX4, DSPC, cholesterol, DMG-PEG2000, and DSPE-PEG2000-iRGD were mixed in a ratio of 45:10:38:2:2 and dissolved in anhydrous ethanol to form an oil phase. circAMY2B was dissolved in PBS buffer to form an aqueous phase. The oil and aqueous phases were simultaneously injected into a microfluidic apparatus, with a flow rate ratio of 1:3 and a nitrogen-to-phosphorus ratio of 6. Assembly was completed in the microfluidic chip to form a lipid nanoparticle suspension loaded with circAMY2B. The suspension was centrifuged at 12000 r / min for 30 min in a high-speed centrifuge. The supernatant was discarded, and the external liquid was replaced with PBS buffer. The centrifugation purification was repeated twice to obtain the purified LNPs-circAMY2B reagent, which was stored at 4℃ for later use.

[0038] 3. Experimental results: such as Figure 1 As shown, lipid nanoparticles loaded with circAMY2B were successfully prepared. Figure 1 Image A is a transmission electron microscope image of LNP-circAMY2B, showing that the LNPs encapsulating circAMY2B are spherically distributed. Figure 1 The average particle size of LNP-circAMY2B in the middle is approximately 106.5 ± 10.2 nm.

[0039] Example 2: Effect of LNPs-circAMY2B on the expression level of circAMY2B in esophageal cancer cells 1. Experimental materials: Esophageal cancer cell lines KYSE150 and TE-1; LNPs-circAMY2B reagent (prepared in Example 1); empty lipid nanoparticles (LNPs-Ctrl, without circAMY2B); PBS buffer; RT-qPCR kit; real-time PCR instrument. circAMY2B primers (circAMY2B-F: CAAAATGGAAACTTGGTTGAATCT (SEQ ID NO: 2), circAMY2B-R: GTCCTTTCCAGAAACTATTTATAT (SEQ ID NO: 3)).

[0040] 2. Experimental Methods: KYSE150 and TE-1 cells were seeded into 6-well plates, with 5 × 10^6 cells per well. 5 Cells were cultured at 37°C in a 5% CO2 incubator until 70% confluence was achieved. Cells were then divided into three groups: a PBS group (with an equal volume of PBS), an LNPs-Ctrl group, and an LNPs-circAMY2B group, with a drug concentration of 500 ng / mL. Each group had three replicates. After culturing for another 24 h, cells from each group were collected, total RNA was extracted, and reverse transcription and quantitative real-time PCR were performed according to the RT-qPCR kit instructions to detect the relative expression level of circAMY2B.

[0041] 3. Experimental results: such as Figure 2 As shown, Figure 2 The results showed that in KYSE150 cells, the expression level of circAMY2B was extremely low after treatment with PBS and LNPs-Ctrl, and there was no significant difference between the two groups; after treatment with LNPs-circAMY2B, the relative expression level of circAMY2B was upregulated by about 15,000 times compared with the PBS group and the LNPs-Ctrl group, and the difference was statistically significant (p<0.01). Figure 2 The results showed that in TE-1 cells, the relative expression level of circAMY2B after LNPs-circAMY2B treatment was significantly upregulated by approximately 15,000-fold compared to the PBS group and the LNPs-Ctrl group, with a statistically significant difference (p<0.01). These results indicate that LNPs-circAMY2B can effectively deliver circAMY2B to esophageal cancer cells and significantly increase its expression level.

[0042] Example 3: Inhibitory effect of LNPs-circAMY2B on the in vitro proliferation of esophageal cancer cells (CCK8 assay) 1. Experimental materials: esophageal cancer cell lines KYSE150 and TE-1; LNPs-circAMY2B reagent; LNPs-Ctrl; PBS buffer; CCK8 kit; 96-well plate; microplate reader.

[0043] 2. Experimental Methods: KYSE150 cells and TE-1 cells were seeded into 96-well plates at a density of 1×10^4 cells per well and cultured until cell adhesion was achieved. The cells were then divided into three groups: PBS group, LNPs-Ctrl group, and LNPs-circAMY2B group, with a drug concentration of 500 ng / mL. Each group had 5 replicates. After 1, 2, 3, and 4 days of culture, 10 μL of CCK8 reagent was added to each well, and the cells were cultured for another 2 h. The absorbance (OD value) at 450 nm was measured using a microplate reader, and the cell proliferation rate was calculated.

[0044] 3. Experimental results: such as Figure 3 As shown, Figure 3 The results showed that, compared with the PBS group and the LNPs-Ctrl group, the proliferation capacity of KYSE150 cells in the LNPs-circAMY2B group was significantly reduced, and the difference was statistically significant (p<0.01). Figure 3 The results from the study showed that LNPs-circAMY2B treatment also significantly inhibited cell proliferation in TE-1 cells. These results indicate that LNPs-circAMY2B can significantly inhibit the proliferation of esophageal cancer cells in vitro.

[0045] Example 4: Inhibitory effect of LNPs-circAMY2B on in vitro plate colonies of esophageal cancer cells (plate colony experiment) 1. Experimental materials: esophageal cancer cell lines KYSE150 and TE-1; LNPs-circAMY2B reagent; LNPs-Ctrl; PBS buffer; 6-well cell culture plates; fetal bovine serum; methanol; crystal violet staining solution; cell counter.

[0046] 2. Experimental Methods: KYSE150 and TE-1 cells in logarithmic growth phase were digested, resuspended, and counted. They were seeded at a density of 500 cells per well in 6-well plates and cultured at 37°C in a 5% CO2 incubator until cell adhesion occurred. The wells of each cell line were divided into three groups: PBS group, LNPs-Ctrl group, and LNPs-circAMY2B group, with three replicates per group. The drug concentration was 500 ng / mL. Cells were cultured for 10-14 days until visible colony formation was observed. The culture medium was discarded, and the cells were gently washed twice with PBS buffer. They were fixed with 4% paraformaldehyde for 15 minutes, and after discarding the methanol, stained with crystal violet for 20 minutes. Excess stain was slowly rinsed off with water, and the cells were air-dried. The colony counts were statistically analyzed.

[0047] 3. Experimental results: such as Figure 4 As shown, Figure 4 China A and Figure 4 The results showed that in KYSE150 cells, both the PBS and LNPs-Ctrl groups had high colony formation rates, with no statistically significant difference between the two groups. Compared with the PBS and LNP groups, the LNPs-circAMY2B group showed a significant reduction in colony formation number and colony formation rate (p<0.01). In TE-1 cells, LNPs-circAMY2B treatment significantly reduced the number of colonies formed in TE-1 cells. These results indicate that LNPs-circAMY2B can significantly inhibit the in vitro colony formation ability of esophageal cancer cells and has a significant in vitro anti-proliferative effect.

[0048] Example 5: Inhibitory effect of LNPs-circAMY2B on the in vitro migration of esophageal cancer cells (trans-well assay) 1. Experimental materials: esophageal cancer cell lines KYSE150 and TE-1; LNPs-circAMY2B reagent; LNPs-Ctrl; PBS buffer; trans-well chambers (8 μm pore size); 24-well plates; methanol; crystal violet staining solution; inverted microscope.

[0049] 2. Experimental Methods: KYSE150 and TE-1 cells were resuspended in serum-free medium and the cell concentration was adjusted to 1×10^5 cells / mL. Trans-well chambers were placed in 24-well plates. 200 μL of cell suspension was added to the upper chamber, along with the corresponding reagents (PBS, LNPs-Ctrl, LNPs-circAMY2B), to a final concentration of 500 ng / mL. Each group had 3 replicates. 600 μL of medium containing 10% fetal bovine serum was added to the lower chamber. The plates were incubated at 37℃ in a 5% CO2 incubator for 24 h. The trans-well chambers were removed, and the unmigrated cells in the upper chamber were gently wiped away with a cotton swab. The cells were fixed with methanol for 15 min, stained with crystal violet for 10 min, rinsed with water, and air-dried. The migrating cells on the lower chamber membrane were observed and counted under an inverted microscope. Five fields of view were randomly selected, and the number of migrating cells was counted.

[0050] 3. Experimental results: such as Figure 5 As shown, Figure 5 The results showed that, compared with the PBS control group and the LNPs-Ctrl control group, the LNP-circAMY2B group significantly inhibited the migration ability of KYSE150 cells. Figure 5The results showed that the number of migrating cells after LNP-circAMY2B treatment was significantly lower than that in the PBS and LNPs-Ctrl control groups. These results demonstrate that LNPs-circAMY2B can significantly inhibit the in vitro migration ability of esophageal cancer cells.

[0051] Example 6: Inhibitory effect of LNPs-circAMY2B on the growth of esophageal cancer xenografts 1. Experimental materials: nude mice (SPF grade, 4-6 weeks old, male, weight 18-22 g); esophageal cancer cell line KYSE150; LNPs-circAMY2B reagent; LNPs-Ctrl; PBS buffer; electronic balance; vernier calipers.

[0052] 2. Experimental Methods: KYSE150 cells were inoculated into the right back of nude mice to construct an esophageal cancer xenograft model. When the tumor volume grew to approximately 100 mm³, the nude mice were randomly divided into three groups: PBS group, LNP group, and LNPs-circAMY2B group, with 6 mice in each group. The drugs were administered via the tail vein, once every 3 days for a total of 6 times, at a dose of 0.1 mg / kg. Before each administration, the long diameter (L) and short diameter (W) of the tumor were measured with calipers, and the tumor volume was calculated as (L×W²) / 2. After the experiment, the nude mice were sacrificed, the tumor tissue was dissected, and the tumor weight was measured using an electronic balance.

[0053] 3. Experimental results: such as Figure 6 As shown. Figure 6 In Figure A, the tumor tissue images of each group after the experiment are shown. The tumor volume of the LNPs-circAMY2B group is significantly smaller than that of the control group. In Figure B, the tumor volume growth curves of nude mice in each group are shown. The tumor growth rate of the LNPs-circAMY2B group is significantly lower than that of the PBS group and the LNPs-Ctrl group. Figure 6 The middle bar chart (C) shows the tumor weight of each group. The tumor tissue weight in the LNPs-circAMY2B group was significantly lower than that in the PBS group and the LNPs-Ctrl group (p<0.01). These results demonstrate that LNPs-circAMY2B can significantly inhibit the growth of esophageal cancer xenografts in vivo.

[0054] Example 7: In vivo biosafety evaluation of LNPs-circAMY2B 1. Experimental materials: nude mice from each group in Example 6; electronic balance; tissue sectioner; HE staining kit; optical microscope.

[0055] 2. Experimental methods: During the drug administration period, nude mice were weighed weekly and their weight changes were recorded. After the experiment, the nude mice were sacrificed, and major organs such as the heart, liver, spleen, lungs, and kidneys were removed, fixed with 4% paraformaldehyde, dehydrated, embedded, sectioned, and stained with hematoxylin and eosin (HE). The histopathological changes of the organs were observed under an optical microscope.

[0056] 3. Experimental results: such as Figure 7 As shown. Figure 7 The results of the study showed that during the drug administration period, the body weight of the three groups of nude mice showed a slow upward trend, and the weight fluctuations were within the physiologically stable range, with no significant weight loss observed. Figure 7 The results in Figure B represent HE staining. The morphology of the major organs (heart, liver, spleen, lungs, kidneys, etc.) of the nude mice in each group were normal, with no pathological damage such as edema, necrosis, or inflammatory cell infiltration. These results demonstrate that LNPs-circAMY2B has no significant in vivo or systemic toxicity and good biosafety.

[0057] The above are merely embodiments of the present invention and do not limit the scope of the patent. Any equivalent modifications made based on the content of this specification, or direct or indirect applications in other related technical fields, are similarly included within the scope of patent protection of the present invention.

Claims

1. The application of a reagent for targeted delivery of circAMY2B in the preparation of anti-esophageal cancer drugs, characterized in that, The reagent is a lipid nanoparticle for targeted delivery of circAMY2B; The lipid nanoparticles for targeted delivery of circAMY2B include a lipid component and circAMY2B circular RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1; the lipid component comprises Lipid AX4, distearate phosphatidylcholine (DSPC), cholesterol, DMG-PEG2000, and DSPE-PEG2000-iRGD.

2. The application according to claim 1, characterized in that, The molar ratio of Lipid AX4, distearate phosphatidylcholine DSPC, cholesterol, DMG-PEG2000 and DSPE-PEG2000-iRGD is 45:10:38:2:

2.

3. The application according to claim 1 or 2, characterized in that, The method for preparing the lipid nanoparticles for targeted delivery of circAMY2B includes the following steps: 1) Lipid AX4, distearate phosphatidylcholine (DSPC), cholesterol, DMG-PEG2000 and DSPE-PEG2000-iRGD were mixed in a molar ratio of 45:10:38:2:2 and dissolved in anhydrous ethanol to form an oil phase; 2) Dissolve circAMY2B in PBS buffer to form an aqueous phase; 3) Inject the oil phase and water phase simultaneously into the microfluidic apparatus, adjust the flow rate ratio to 1:3 and the nitrogen-phosphorus ratio to 6-8, and complete the assembly in the microfluidic chip to form a lipid nanoparticle suspension loaded with circAMY2B; after centrifugation and purification, lipid nanoparticles loaded with circAMY2B, namely LNPs-circAMY2B, are obtained.

4. The application according to claim 1 or 2, characterized in that, The drug has any one or more of the following functions: 1) Delivering circAMY2B into esophageal cancer cells; 2) Upregulates the expression of circAMY2B in esophageal cancer cells; 3) Inhibits the proliferation and migration of esophageal cancer cells; 4) Inhibits the development of esophageal cancer both in vitro and in vivo.

Citation Information

Patent Citations

  • Application of reagent for targeted inhibition of circPDK1 in preparation of anti-esophageal cancer drugs

    CN121221631A