Use of an article targeting aldh1a1 in the manufacture of a medicament for treating impaired glucose tolerance nephropathy

Abstract

The application provides application of an ALDH1A1 targeting preparation in preparation of a drug for treating impaired glucose tolerance nephropathy, and relates to the technical field of biological medicine. ALDH1A1 is used as a target point, and a related preparation is used to improve the activity of ALDH1A1 protein or improve the expression of the ALDH1A1 gene, so that the level of retinoic acid in cells is improved, mitochondrial damage is improved, the level of inflammation and apoptosis is reduced, and then the reabsorption function of renal tubules is improved, so that the treatment of impaired glucose tolerance nephropathy is realized.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of products targeting ALDH1A1 in the preparation of drugs for treating impaired glucose tolerance nephropathy. Background Technology

[0002] Studies have found that kidney damage already exists in the impaired glucose tolerance (IGT) stage before a diagnosis of diabetes. A previous screening of kidney damage in a population at a hospital's health check-up center revealed that 12.1% of IGT patients had microalbuminuria, 25.3% had renal tubular epithelial cell damage, and 54% had impaired renal tubular reabsorption function. Natural course observation of spontaneously diagnosed type 2 diabetic OLETF rats showed elevated levels of urinary renal tubular damage markers such as N-acetyl-β-D-glucosidase, neutrophil gelatinase-associated apolipoprotein, and retinol-binding protein in the IGT stage, along with pathological manifestations such as brush border shedding and structural disorder of renal tubular epithelial cells, indicating kidney damage already present in the IGT stage. The concept of "IGT nephropathy (impaired glucose tolerance nephropathy)" provides a new approach for earlier prevention and treatment of DKD, but the specific pathogenesis and therapeutic targets still require further exploration.

[0003] Retinol is a fat-soluble vitamin that plays a vital role in maintaining normal growth and development. Retinoic acid (RA) is the bioactive metabolite of retinol, regulating gene transcription by binding to RA nuclear receptors. RA production involves a two-step oxidation process: ADHs first convert retinol to retinal, a reversible process; subsequently, ALDHs oxidize retinal to RA, an irreversible process. Therefore, the ALDH-mediated oxidation process is the rate-limiting step in retinol metabolism. Aldehyde dehydrogenase 1 (ALDH1A1), a member of the ALDH1 family, is expressed in multiple tissues and organs; abnormal expression or activity can affect RA production, thereby impacting physiological function. However, the mechanism and role of ALDH1A1 in impaired glucose tolerance nephropathy remain unclear.

[0004] Therefore, this invention is proposed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides the application of ALDH1A1-targeting products in the preparation of drugs for treating impaired glucose tolerance nephropathy. Specifically, ALDH1A1 is used as a target, and related formulations are employed to increase the activity of ALDH1A1 protein or enhance the expression of the ALDH1A1 gene, thereby increasing intracellular retinoic acid levels, improving mitochondrial damage, reducing inflammation and apoptosis levels, and ultimately improving renal tubular reabsorption function, thus achieving the treatment of impaired glucose tolerance nephropathy.

[0006] In order to achieve the objective of this invention, the following technical solution is adopted: This invention provides the use of ALDH1A1-targeting products in the preparation of drugs for treating impaired glucose tolerance in nephropathy.

[0007] Furthermore, the ALDH1A1-targeting product is used to increase the expression level of ALDH1A1 or enhance the activity of ALDH1A1.

[0008] Furthermore, the product targeting ALDH1A1 is an expression vector containing a nucleotide sequence encoding the ALDH1A1 protein.

[0009] Furthermore, the expression vector is a recombinant plasmid or a recombinant viral vector.

[0010] Furthermore, the expression vector is a recombinant plasmid, which contains the nucleotide sequence shown in SEQ ID NO.1.

[0011] SEQ ID NO.1 Furthermore, the specific indications for impaired glucose tolerance nephropathy include any one of the following: decreased retinoic acid levels, mitochondrial damage, increased renal inflammation levels, or increased cell apoptosis.

[0012] The present invention also provides a pharmaceutical composition for treating impaired glucose tolerance nephropathy, the pharmaceutical composition comprising an article that increases the expression level of ALDH1A1 or enhances the activity of ALDH1A1, and a pharmaceutically acceptable carrier or excipient.

[0013] Furthermore, the pharmaceutically acceptable carrier is selected from cationic liposomes, cationic polymers, adeno-associated viruses, or lentiviruses.

[0014] Furthermore, the product for increasing the expression level of ALDH1A1 or enhancing the activity of ALDH1A1 is an expression vector containing a nucleotide sequence encoding the ALDH1A1 protein.

[0015] Furthermore, the nucleotide sequence of the expression vector is shown in SEQ ID NO.1.

[0016] Furthermore, the delivery method of the pharmaceutical composition is selected from: intravenous injection, intraperitoneal injection, or in situ renal injection.

[0017] The present invention has the following technical effects: Using ALDH1A1 as a target, the use of related preparations to enhance the activity of ALDH1A1 protein or increase the expression of ALDH1A1 gene can improve the decline in retinoic acid levels, mitochondrial damage, inflammation and apoptosis in impaired glucose tolerance nephropathy, thereby improving renal tubular reabsorption function and further exerting a protective effect on the kidneys. This provides theoretical guidance for drug target design and drug selection for the early treatment of kidney injury and has important clinical significance and social value. Attached Figure Description

[0018] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0019] Figure 1 Example 1: Verification of glucose intolerance nephropathy model in rats. Figure 1 The oral glucose tolerance test (OGTT) curves of the two groups of rats. Figure 1 B represents the insulin tolerance test (ITT) curves of the two groups of rats. Figure 1 C represents the fasting insulin levels in the two groups of rats. Figure 1 D represents the results of the insulin resistance homeostasis model index in the two groups of rats. Figure 1 E represents the area under the OGTT curve for the two groups of rats. Figure 1 F represents the area under the ITT curve for the two groups of rats; Figure 2 In Example 1, the kidney structure and function of the impaired nephropathy rats were damaged. Figure 2 A shows H&E staining, PAS staining, and electron micrographs of the kidneys of two groups of rats. Figure 2 B represents the urinary microalbumin levels in the two groups of rats. Figure 2 C represents the urinary kidney injury molecule-1 level in the two groups of rats. Figure 2 D represents the urinary retinol-binding protein levels in the two groups of rats. Figure 2 E represents the urinary transferrin level in the two groups of rats. Figure 2 F represents the urinary N-acetyl-β-D-glucosidase level in the two groups of rats. Figure 2 G represents the urinary immunoglobulin G level in the two groups of rats; Figure 3 In Example 1, the kidneys of rats with impaired glucose tolerance showed increased inflammation, increased apoptosis, and mitochondrial dysfunction. Figure 3 A represents the electrophoretic bands of mitochondrial function-related proteins (p-DRP1(Ser616), MFN1, and PGC1α). Figure 3 D is the corresponding statistical analysis chart of relative protein expression levels; Figure 3 B represents the electrophoretic band of cellular inflammation-related proteins (IL-6, TGF-β1, TNF-α, and NF-κB). Figure 3 E is the statistical analysis graph of the corresponding protein relative expression levels; Figure 3 C represents the electrophoretic band of apoptosis-related proteins (Cleaved Caspase-3, Bcl-2, and Bax). Figure 3 F is the statistical analysis graph of the corresponding protein relative expression levels; Figure 4 In Example 2, the expression level of ALDH1A1 in the kidneys of glucose-impaired nephropathy rats was reduced. Figure 4 A represents the protein electrophoresis band. Figure 4 B is a statistical analysis chart of relative protein expression levels. Figure 4 C is an immunohistochemical image. Figure 4 D represents the result of renal retinoic acid content; Figure 5 Example 2 illustrates the effect of palmitic acid (PA) intervention on ALDH1A1 expression in human proximal renal tubular epithelial cells (HK-2 cells). Figure 5 A represents the cell viability results of HK-2 cells treated with different concentrations of palmitic acid. Figure 5 B represents the protein electrophoresis band. Figure 5 C is a statistical analysis chart of the relative expression levels of ALDH1A1. Figure 5 D represents the intracellular retinoic acid content; Figure 6 Example 3 uses plasmid overexpression of ALDH1A1 in HK-2 cells to verify efficiency. Figure 6 A represents the protein electrophoresis band. Figure 6 B is a statistical analysis chart of the relative expression levels of ALDH1A1. Figure 6 C represents the intracellular retinoic acid content; Figure 7 Example 3 illustrates the effects of ALDH1A1 overexpression on the expression levels of mitochondrial function (p-DRP1(Ser616), MFN1, and PGC1α), inflammation (TGF-β1 and TNF-α), and apoptosis (Cleaved Caspase-3, Bcl-2, and Bax) related indicators in HK-2 cells. Figure 7 A and 7B are protein electrophoresis bands. Figure 7 C is a statistical analysis chart of relative protein expression levels; Figure 8 Example 3 illustrates the effect of ALDH1A1 overexpression on mitochondrial membrane potential and endocytic capacity in HK-2 cells. Figure 8 A is a CMXRos-stained image. Figure 8 B is the statistical analysis graph of the relative fluorescence intensity of CMXRos. Figure 8 C is a FITC-BSA stained image. Figure 8 D is a statistical analysis graph of the relative fluorescence intensity of FITC. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0021] The following is a detailed explanation using specific embodiments: Example 1: Construction and validation of an animal model of impaired glucose tolerance nephropathy 1.1 Experimental Procedure 1.1.1 Animal Modeling (1) Establishment of a rat model of impaired glucose tolerance nephropathy: The male SD rats used in this invention were housed in an SPF-grade animal facility. After one week of acclimatization, 12 SD rats were randomly divided into two groups: a control group (n=6) and a glucose tolerance nephropathy group (n=6). The control group was fed a normal diet, while the glucose tolerance nephropathy group was fed a 60% high-fat diet. The body weight of each group was monitored weekly, and the food intake, water intake, urine output, and fecal output of each group were monitored every 4 weeks. 24-hour urine samples were also collected. The intervention period was 16 weeks.

[0022] (2) Insulin tolerance test (ITT test) SD rats were placed in clean cages and fasted for 6 hours, during which time they drank water normally. Each rat was weighed while at rest. Approximately 0.5-1 mm of the rat's tail was cut off, and the tail was gently squeezed to collect a single drop of blood. Blood glucose was measured using a glucometer; this value was recorded as the 0-minute blood glucose level. Insulin solution was injected into the rats via intraperitoneal injection at a dose of 0.5 U / kg, and timing began immediately after injection. Blood glucose levels were measured in the tail vein at 15, 30, 45, 60, 90, and 120 minutes. Blood glucose curves were plotted, and the area under the curve was calculated.

[0023] (3) Oral glucose tolerance test (OGTT test) Rats were placed in clean cages and fasted for 16 hours, during which time they drank water normally. The weight of each rat was recorded while it was at rest. Following standard gavage procedures, the rats were administered glucose solution at a dose of 2 g / kg. Blood glucose levels were measured in the tail vein at 0, 30, 60, 90, 120, and 180 minutes after gavage. Blood glucose curves were plotted, and the area under the curve was calculated.

[0024] (4) Obtaining kidney tissue After euthanizing the SD rats, the abdominal cavity was opened, and the kidneys were removed. The kidneys were weighed using a precision balance and their dimensions measured. One kidney was fixed in 4% paraformaldehyde for paraffin embedding and sectioning. The other kidney was minced, aliquoted into cryovials, flash-frozen in liquid nitrogen, and stored at -80°C for subsequent experiments.

[0025] 1.1.2 Assessment of Kidney Morphology and Function (1) HE staining Baking: Place the slices in a 60℃ oven and bake for 1-2 hours.

[0026] Dewaxing: The paraffin slices were placed in the following solutions in sequence: xylene I for 10 min, xylene II for 10 min, anhydrous ethanol for 5 min, 90% ethanol solution for 5 min, 80% ethanol solution for 5 min, and 70% ethanol solution for 5 min, and finally placed in ddH2O.

[0027] Hematoxylin staining: Immerse the sections in hematoxylin for 3-8 minutes, then rinse with tap water to remove any remaining stain. Differentiate with 1% hydrochloric acid alcohol for a few seconds to decolorize the sections to a pale blue-red.

[0028] Eosin staining: Immerse the section in eosin staining solution for 1-3 minutes, wash away any residual staining solution with tap water, and observe under a microscope. If the staining is too dark, immerse the section in 80% alcohol for a few seconds to lighten the stain.

[0029] Dehydration and mounting: Tissue sections were placed in 70% ethanol solution, 80% ethanol solution, 90% ethanol solution, 100% ethanol solution and xylene solution for 30 seconds each, and then mounted with neutral resin.

[0030] (2) PAS staining The baking and dewaxing steps are the same as those for H&E staining.

[0031] Oxidation: Immerse the sections in a 0.5%–1% periodic acid solution and oxidize at room temperature in the dark for 5–10 minutes. Rinse the sections three times with distilled water for 1–2 minutes each time.

[0032] Staining: Immerse the sections in Schiff's reagent and stain at room temperature in the dark for 10–30 minutes; gently rinse the sections with running water for 5–10 minutes to remove excess Schiff's reagent.

[0033] The steps for hematoxylin staining and dehydration mounting are the same as for H&E staining.

[0034] (3) Detection of renal function-related indicators The ELISA method was used to detect biomarkers of kidney injury in rat urine, including urinary microalbumin, transferrin, N-acetyl-β-D-glucosidase, immunoglobulin G, retinol-binding protein, and kidney injury molecule-1 levels.

[0035] 1.1.3 Detection of apoptosis, inflammation, and mitochondrial function-related protein levels in the kidney (1) Preparation of tissue protein samples Prepare the required lysis buffer by adding 10 μL PMSF and 10 μL phosphatase inhibitor to 1 mL of lysis buffer, shake well, and place on ice. Remove the kidney tissue stored at -80℃, thaw it on ice, and weigh 20 mg of tissue into an EP tube. Add 200 μL of lysis buffer and a steel ball to the EP tube, and homogenize using a homogenizer to thoroughly grind the tissue. Centrifuge at 12000 rpm for 10 min at 4℃. Collect the supernatant, add 4×loading buffer according to the specified ratio, and boil in a 100℃ water bath for 10 minutes to fully denature the proteins. Aliquot and store.

[0036] (2) SDS-PAGE electrophoresis Cleaning the glass plate: Hold the glass plate firmly with one hand, and use the other hand to apply a little laundry detergent to gently scrub it. After scrubbing both sides, rinse with tap water, then rinse thoroughly with distilled water, and then stand it upright in a basket to dry.

[0037] Gel preparation: Select an appropriate concentration of pre-mixed gel based on the molecular weight of the target protein. The pre-mixed gel preparation ratio is as follows: the total volume of the lower gel is 8 mL, prepared according to the ratio of buffer: gel: coagulant = 100:100:1; the total volume of the upper gel is 2 mL, prepared in the same ratio as the lower gel.

[0038] Sample loading: Place the stacking gel into the electrophoresis tank and clamp it tightly. Fill the electrophoresis tank with electrophoresis buffer and remove the electrophoresis comb. Use a pipette to draw up the sample and insert it vertically into the sample well to slowly add the sample.

[0039] Electrophoresis: Set the electrophoresis parameters to 150V and 60 minutes (the electrophoresis time can be appropriately extended when the protein molecular weight is large).

[0040] Transfer: Remove the glass plate and place it in the tray containing ddH2O. Pry open the short glass plate and cut the gel to an appropriate width based on the protein molecular weight. Soak the NC membrane with equilibration buffer. Place the sponge → NC membrane → gel → sponge in sequence on the transfer clamp. Clamp the sandwich together and insert it into the transfer tank. Set the appropriate transfer time to perform the transfer.

[0041] Blocking: After the transfer, rinse the NC membrane with TBST, then place it in an incubation box containing 5% milk blocking solution and incubate on a decolorizing shaker at room temperature for 1 hour.

[0042] Washing: Discard the milk sealing solution, wash with TBST, 10 minutes / time × 3 times.

[0043] Incubate primary antibody: Discard TBST, add diluted primary antibody, and incubate overnight at 4°C.

[0044] Washing: Recover primary antibody, TBST wash, 10 minutes / time × 3 times.

[0045] Incubate the secondary antibody: Discard the TBST, add the diluted secondary antibody, and incubate at room temperature for 1 hour.

[0046] Washing: Recover secondary antibody, TBST wash, 10 minutes / time × 3 times.

[0047] Development: Prepare a chemiluminescent solution, fully wet the NC membrane, place it in a darkroom, take pictures using a gel imaging system, and save the images.

[0048] Data analysis: ImageJ software was used to calculate the gray values ​​of each band, and the ratio of each band was calculated using the objective / internal parameter. Difference analysis was then performed.

[0049] 1.2 Experimental Results (1) A rat model of impaired glucose tolerance and nephropathy was successfully established. like Figure 1 As shown in A and 1E, the area under the OGTT curve in the impaired glucose tolerance nephropathy group was significantly higher than that in the control group (P < 0.05); Figure 1 As shown in B and 1F, the area under the ITT curve in the impaired glucose tolerance nephropathy group was significantly higher than that in the control group (P < 0.05); Figure 1 As shown in C and 1D, fasting insulin and the insulin resistance homeostasis model index were significantly increased in rats with impaired glucose tolerance nephropathy (P < 0.05). These results indicate that rats with impaired glucose tolerance nephropathy exhibited insulin resistance and impaired glucose tolerance, demonstrating successful animal modeling.

[0050] (2) Morphological changes in kidney tissue of rats with impaired glucose tolerance like Figure 2 In Figure A, H&E and PAS staining revealed focal loss of the brush border of the proximal tubules in the renal tissue of the impaired glucose tolerance nephropathy group (black arrows) compared to the control group. Desquamated epithelial cells were present within the lumen (blue arrows), and occasional proteinoid casts were scattered throughout the tubules (green arrows). Transmission electron microscopy (TEM) analysis showed that the mitochondria in the control group had good structure and distribution. In the impaired glucose tolerance nephropathy group, most mitochondria exhibited electron-transparent regions within the matrix and decreased electron density (purple arrows), accompanied by occasional mitochondrial swelling.

[0051] (3) Increased levels of kidney damage markers in rats with impaired glucose tolerance like Figure 2 As shown, compared with the control group, the glomerular injury marker microalbumin (...) in the impaired glucose tolerance nephropathy group... Figure 2 B), Immunoglobulin G ( Figure 2 G) and transferrin ( Figure 2 Elevated levels of E (P < 0.05), a biomarker of renal tubular injury, renal injury molecule-1 (… Figure 2 C), N-acetyl-β-D-aminoglycanase ( Figure 2 F) and retinol-binding protein (F) Figure 2 The level of D was also significantly increased (P < 0.05).

[0052] (4) Increased levels of kidney inflammation, apoptosis, and mitochondrial damage in rats with impaired glucose tolerance. like Figure 3 As shown, compared with the control group, rats in the impaired glucose tolerance nephropathy group had increased levels of renal inflammation and apoptosis, and significantly impaired mitochondrial function. The increased inflammation was manifested as... Figure 3 B and Figure 3 E showed increased expression levels of IL-6, TNF-α, TGF-β1, and NF-κB (P < 0.05), and increased apoptosis levels were reflected in Figure 3 C and Figure 3 F shows increased levels of Cleaved Caspase-3 and Bax and decreased levels of Bcl-2 (P < 0.05). Mitochondrial dysfunction is manifested by increased levels of p-DRP1 (Ser616) and decreased levels of MFN1 and PGC1α, as shown in 3A and 3D (P < 0.05).

[0053] The results of Example 1 show that the kidneys of impaired glucose tolerance nephropathy rats have significant structural and functional damage, increased levels of local inflammation and apoptosis in the kidneys, and mitochondrial dysfunction.

[0054] Example 2: Detection of ALDH1A1 expression level and retinoic acid content in the kidneys and HK-2 cells of rats with impaired glucose tolerance 2.1 Experimental Procedure 2.1.1 Detection of ALDH1A1 expression level in rat kidney (1) The Western blotting method is the same as before.

[0055] (2) Immunohistochemistry Baking and dewaxing were performed in the same manner as H&E staining.

[0056] Antigen retrieval: Immerse the slide in pH 9.0 EDTA buffer, microwave on high to boil, then reduce to medium heat and maintain for 15 minutes, then cool to room temperature.

[0057] Endogenous enzyme inactivation: Treat with 3% H2O2 at room temperature in the dark for 10 minutes → wash 3 times with distilled water.

[0058] Non-specific binding blocking: Add 10% goat serum and incubate at room temperature for 30 minutes.

[0059] Primary antibody incubation: Add diluted ALDH1A1 primary antibody and incubate overnight at 4°C in a humidified chamber.

[0060] Rinse with PBS → Wash with PBS-T (0.1% Tween-20) for 3 x 5 minutes with shaking.

[0061] Secondary antibody incubation: Add HRP / AP-labeled secondary antibody (1:500) and incubate at room temperature for 30 minutes.

[0062] Colorimetric reaction: Add DAB colorimetric solution, observe under a microscope and control the colorimetric time.

[0063] Counterstaining nuclei: Hematoxylin staining for 1 minute → differentiation with 0.5% hydrochloric acid ethanol → blueing with ammonia.

[0064] Dehydration and sealing: Gradient ethanol dehydration → xylene clearing → neutral resin sealing.

[0065] 2.1.2 Detection of retinoic acid content in rat kidneys Sample processing: Weigh 30 mg of fresh tissue, grind it on ice, and sonicate the tissue suspension (20% power, 2-3 seconds, repeat 3 times). Centrifuge (12000g, 10 min, 4℃) and collect the supernatant.

[0066] Kit preparation: Allow all reagents to equilibrate to room temperature for at least 30 minutes.

[0067] Sample addition: Set up blank wells, standard wells, and test sample wells. Do not add any liquid to the blank wells. Add 50 μL of standard or test sample to each of the remaining wells. Immediately add 50 μL of horseradish peroxidase conjugate working solution (do not add to blank wells). Cover with a plate and incubate at 37°C for 60 minutes.

[0068] Hole cleaning: Discard the liquid inside the hole, spin dry, and wash the plate 5 times.

[0069] Add substrate: Add 90 μL of substrate solution to each well in sequence, and develop color at 37°C in the dark for 20 minutes.

[0070] Termination: Add 50 μL of termination solution to each well sequentially to terminate the reaction.

[0071] Reading: Use an ELISA reader to measure the optical density (OD value) of each well sequentially at a wavelength of 450 nm.

[0072] Calculation: The concentration of retinoic acid in the sample was calculated based on the standard curve, and the protein concentration was measured using BCA. The results were then corrected for protein concentration.

[0073] 2.1.3 Detection of ALDH1A1 expression level in HK-2 cells The main pathophysiological manifestation of the kidneys in rats with impaired glucose tolerance is insulin resistance. Therefore, palmitic acid, a classic inducer of insulin resistance, was used in in vitro experiments. The HK-2 cell line (human proximal renal tubular epithelial cell line) was used in the in vitro experiments.

[0074] (1) Solution preparation: Normal culture medium: Add 45 mL of DF-12 culture medium and 5 mL of fetal bovine serum to a centrifuge tube, mix, filter, add 500 μL of 1% penicillin / streptomycin, mix well, seal, and store at 4°C.

[0075] 20% serum albumin (BSA) solution: Preheat 3 mL of PBS buffer in a 55°C water bath, add 0.6 g of albumin powder, vortex to mix, filter through a filter, and store at 4°C for later use.

[0076] Palmitic acid (PA) solution: Preheat 3 mL ddH2O in a 75°C water bath, add 33.40 mg PA powder, shake and mix until clear, quickly pour the solution into an equal volume of 20% BSA solution, place in a 55°C water bath and mix, filter with a filter and store at 4°C for later use.

[0077] The same concentration of BSA was used as a control for PA. The NC group HK-2 cells were cultured in a complete medium containing 100 μM BSA.

[0078] (2) Cell resuscitation: The sterile operating table was disinfected by irradiation with ultraviolet light for half an hour, and the culture medium was preheated in an incubator. HK-2 cells were removed from the -80℃ freezer and quickly placed in a 37℃ water bath to thaw. Once a cell suspension was formed, it was transferred to a centrifuge tube containing preheated culture medium and centrifuged at 800-1000 rpm for 4-5 minutes at room temperature, allowing the cells to settle at the bottom of the tube. The supernatant was discarded. Another 4 mL of culture medium was added to the centrifuge tube, and the cells were gently resuspended in the medium using a pipette. The cell suspension was then transferred to a cell culture flask and placed in an incubator.

[0079] (3) Cell plating and intervention The cell digestion procedure is the same as before. After centrifugation, discard the supernatant, add an appropriate amount of complete culture medium, resuspend the cells by pipetting, and seed them into six-well plates. When the cell density in the six-well plates reaches 60%, discard the culture medium and add cell intervention solution for 24 hours.

[0080] (4) CCK-8 assay for HK-2 cell viability Cells were seeded in 96-well plates. When the cell density reached 70%, different intervention solutions were used for 24 hours (3-6 replicates per group, and a blank control group without cells was set up). After the intervention, 10 μL of CCK-8 solution was added to each well, and the cells were incubated in a cell culture incubator. The wavelength of the microplate reader was set to 450 nm, and readings were taken at 0.5, 1, 2, and 3 hours, until the OD value of the experimental control group was close to 1.

[0081] (5) Cell protein extraction: Prepare the required lysis buffer by adding 10 μL PMSF and 10 μL phosphatase inhibitor to 1 mL of lysis buffer, shake well, and place on ice. Discard the culture medium, add 2 mL of pre-chilled PBS buffer (4°C) to each well to wash the cells, then discard the wash buffer. Repeat the above steps twice, discarding the PBS buffer each time, and place the six-well plate on ice. Add 140 μL of lysis buffer containing PMSF to each well of cells, collect cell proteins using a cell scraper, and then transfer the lysis buffer to a 1.5 mL centrifuge tube. Centrifuge at 12,000 rpm for 5 min at 4°C. Transfer the supernatant to a new EP tube. Add 4× loading buffer according to the specified ratio, vortex to mix, and boil in a 100°C water bath for 10 min to fully denature the proteins. Store at -20°C for later use.

[0082] (6) The Western blotting method is the same as before.

[0083] 2.1.4 Detection of retinoic acid levels in HK-2 cells Sample processing: After the intervention, discard the culture medium, wash twice with PBS, scrape the cells into PBS, and collect them in EP tubes. Centrifuge (1500g, 5min) to obtain cell pellet. Resuspend the cells in ultrapure water. Sonicate the cells (20% power, 2-3 seconds, repeat 3 times), centrifuge (12000g, 10min, 4℃) and collect the supernatant.

[0084] Kit preparation: Allow all reagents to equilibrate to room temperature for at least 30 minutes.

[0085] Sample addition: Set up blank wells, standard wells, and test sample wells. Do not add any liquid to the blank wells. Add 50 μL of standard or test sample to each of the remaining wells. Immediately add 50 μL of horseradish peroxidase conjugate working solution (do not add to blank wells). Incubate at 37°C for 60 minutes.

[0086] Hole cleaning: Discard the liquid inside the hole, spin dry, and wash the plate 5 times.

[0087] Add substrate: Add 90 μL of substrate solution to each well in sequence, and develop color at 37°C in the dark for 20 minutes.

[0088] Termination: Add 50 μL of termination solution to each well sequentially to terminate the reaction.

[0089] Reading: Use an ELISA reader to measure the optical density (OD value) of each well sequentially at a wavelength of 450 nm.

[0090] Calculation: The concentration of retinoic acid in the sample was calculated based on the standard curve, and the protein concentration was measured using BCA. The results were then corrected for protein concentration.

[0091] 2.2 Experimental Results (1) ALDH1A1 expression and retinoic acid level were decreased in rats with impaired glucose tolerance and nephropathy. like Figure 4 As shown in A and 4B, compared with the control group, the expression of ALDH1A1 in the kidneys of rats with impaired glucose tolerance was reduced (P < 0.05). Figure 4 Immunohistochemical images of rats C showed that ALDH1A1 was mainly expressed in the proximal renal tubules; and compared with the control group, the area and signal of ALDH1A1 positivity in the kidneys of rats with impaired glucose tolerance were reduced. Figure 4 As shown in Figure D, compared with the control group, the content of retinoic acid in the kidneys of rats with impaired glucose tolerance was reduced (P < 0.05).

[0092] (2) Palmitic acid-treated HK-2 cells showed reduced ALDH1A1 expression and reduced retinoic acid content. The results of the CCK-8 experiment are as follows: Figure 5 A showed that as the PA concentration increased, the activity of HK-2 cells gradually decreased. When the PA concentration was 200 μM, it had a significant effect on cell activity (P < 0.05). When the PA concentration was 0-100 μM, cell activity was not affected (P > 0.05). Therefore, 100 μM was selected as the intervention concentration. Figure 5 B and 5C showed that ALDH1A1 expression was reduced in cells of the 100 μM PA group compared with the NC group (P < 0.05). Figure 5 D showed that, compared with the NC group, the retinoic acid level in the cells of the 100 μM PA group was decreased (P < 0.05).

[0093] The results of Example 2 show that the protein expression of ALDH1A1 in the renal tubules of impaired glucose tolerance nephropathy rats is reduced and the level of retinoic acid is decreased.

[0094] Example 3: Effects of ALDH1A1 overexpression on HK-2 cell function and damage 3.1 Experimental Procedure 3.1.1 Preparation of overexpression plasmids The target gene sequence is split into different primers, which will form an overlap. These primers are mixed together, and the target fragment is obtained by PCR amplification. The fragment is then ligated into the corresponding vector. Positive clones with 100% correct sequence are selected, and plasmids are extracted.

[0095] (1) Synthetic primers (28 in total): Synthetic primer-2 ACTGAATCATGCCATTCATTGTTTATGAAGATCTTAGTATATTGAATCTTCAAATCGGTGAGTAGGACAGGTAAGTC Synthetic primer-3 ATGGCATGATTCAGTGAGTGGCAAGAAATTTCCTGTCTTTAATCCTGCAACTGAGGAGGAGCTCTGCCAGGTAGAAGAA Synthetic primer-4 CTGAAAAGCCTGTCTTGCGGCCTTCACTGCCTTGTCAACATCCTCCTTATCTCCTTCTTCTACCTGGCAGA Synthetic primer-5 CAAGACAGGCTTTTCAGATTGGATCCCCGTGGCGTACTATGGATGCTTCCGAGAGGGGGCGACTATTATACA Synthetic primer-6 CATTGACTCCATTGTCGCCAGCAGCAGACGATCTCTTTCGATTAAATCAGCCAACTTGTATAATAGTCGCCCC Synthetic primer-7 CGACAATGGAGTCAATGAATGGTGGAAAACTCTATTCCAATGCATATCTGAATGATTTAGCAGGCTGCATCAAAAC Synthetic primer-8 TTCCATCAATTGGTATTGTACGGCCCTGGATCTTGTCAGCCCAACCTGCACAGTAGCGCAATGTTTTGATGCAGCCTG Synthetic primer-9 ACAATACCAATTGATGGAAATTTTTTTACATATACAAGACATGAACCTATTGGTGTATGTGGCCAAATCATTCCTTG Synthetic primer-10 GTTTCCACAGCTCAGTGCAGGCCCTATCTTCCAAATGAGCATAACCAACGGGAAATTCCAAGGAATGATTTGGCC Synthetic primer-11 ACTGAGCTGTGGAAACACAGTGGTTGTCAAACCAGCAGAGCAAACTCCTCTCACTGCTCTCCACGTGGCATCTTTAAT Synthetic primer-12 TGCTGTAGGCCCATAACCAGGAACAATATTCACTACTCCAGGAGGAAACCCTGCCTCTTTTATTAAAGATGCCACGTG Synthetic primer-13 TTATGGGCCTACAGCAGGGGCAGCCATTTCTTCTCACATGGATATAGACAAAGTAGCCTTCACAGGATCAACA Synthetic primer-14 TCACCCTCTTCAGATTGCTTTTCCCGGCAGCTTCTTTGATCAACTTGCCAACCTCTGTTGATCCTGTGAAGG Synthetic primer-15 CAATCTGAAGAGGGTGACCCTGGAGCTTGGAGGAAAGAGCCCTTGCATTGTGTTAGCTGATGCCGACTT Synthetic primer-16 ATACAACACTGGCCCTGGTGGTAGAATACCCCATGGTGTGCAAATTCAACAGCATTGTCCAAGTCGGCATCAGCTA Synthetic primer-17 AGGGCCAGTGTTGTATAGCCGCATCCAGGATTTTTGTGGAAGAATCAATTTATGATGAGTTTGTTCGAAGGAGT Synthetic primer-18 CCTTGAGTGACTCCTGGGGTCAGAGGATTTCCAAGGATATACTTCTTAGCCCGCTCAACACTCCTTCGAACAAACT Synthetic primer-19 CAGGAGTCACTCAAGGCCCTCAGATTGACAAGGAACAATATGATAAAATACTTGACCTCATTGAGAGTGG Synthetic primer-20 TAGCCTTTATTCCCCCACGGGCCTCCTCCACATTCCAGTTTGGCCCCTTCTTTCTTCCCACTCTCAATGAGGT Synthetic primer-21 TGGGGGAATAAAGGCTACTTTGTCCAGCCCACAGTGTTCTCTAATGTTACAGATGAGATGCGCATTGCCAAA Synthetic primer-22 CACGTCATCTAAAGATTTAAACTTCATGATTTGCTGCACTGGTCCAAAAATCTCCTCTTTGGCAATGCGCAT Synthetic primer-23 AAATCTTTAGATGACGTGATCAAAAGAGCAAACAATACTTTCTATGGCTTATCAGCAGGAGGTGTTTACCAAAGA Synthetic primer-24 TTCACCCACACTGTTCCTGCCTGCAGAGCAGAGGAGATTGTTATGGCTTTATCAATGTCTTTGGTAAACACTCCT Synthetic primer-25 GAACAGTGTGGGTGAATTGCTATGGCGTGGTAAGTGCCCAGTGCCCCTTTGGGTGGATTCAAGATGTCTGGAAATGG Synthetic primer-26 ACTGTTTTGACCTCTGTATATTCATGGAAACCGTACTCTCCCAGTTCTCTTCCATTCCAGACATCTTG Synthetic primer-27 ACAGAGGTCAAAACAGTCACAGTGAAAATCTCTCAGAAGAACTCAGAGGGCAGGGGAAGTCTTCTAACA Synthetic primer-28 ACAGCTCCTCGCCCTTGCTCACCATGGGGCCGGGATTTTCCTCCACGTCCCCGCATGTTAGAAGACTTCCCC (2) PCR to obtain the target sequence for cloning First-round full-length PCR amplification reaction system: Mixed primers (approximately 50 pmol / μL / primer) 0.5 µL Polymerase PV2 0.5 µL 5*PV2 buffer solution 10 µL 10mM dNTP 1 µL <![CDATA[ddH2O]]> 38 µL Total volume 50 µL Reaction conditions: 95℃, 3min 1 loop ①95℃, 25sec; ②60℃, 20sec; ③73℃, 40sec 25 cycles 72℃, 1min 1 loop

[0096] Second round full-length PCR amplification reaction system: Template: First round PCR products 0.3 µL G93211-1_1 0.5 µL G93211-1_28 0.5 µL polymerase pv2 0.5 µL 5*PV2 buffer solution 10 µL 10mM dNTP 1 µL <![CDATA[ddH2O]]> 37.2 µL Total volume 50 µL Reaction conditions: 95℃, 3min 1 loop ①95℃, 25sec; ②60℃, 20sec; ③72℃, 40sec 25 cycles 72℃, 1min 1 loop

[0097] (3) Rubber cutting and recycling After the second round of PCR amplification, the PCR products are analyzed by electrophoresis to verify the product bands. Products meeting the criteria of "unique and clear bands" are considered acceptable. The acceptable PCR products are then gel-cleaved and used for the next ligation experiment.

[0098] (4) Enzyme digestion of vector plasmid Enzyme digestion system (37℃, 60 min): Circular empty vector plasmid PCDNA3.1-EGFP 1µg plasmid (calculate the dosage based on plasmid concentration) Restriction endonuclease NheI 2 µL Restriction endonuclease AgeI 2 µL buffer solution 5 µL <![CDATA[ddH2O]]> Add water to 50 µL Total volume 50 µL (5) Recombination and ligation experiment Connection system (52℃ water bath for 40 min, followed by 5 min of cooling): Circular empty vector plasmid PCDNA3.1-EGFP 1µg plasmid (calculate the dosage based on plasmid concentration) Restriction endonuclease NheI 2 µL Restriction endonuclease AgeI 2 µL buffer solution 5 µL (6) Transformation experiment a. Ice recovery of competent cells; b. Transfer the product of the ligation reaction into competent cells and incubate on ice for 10 min; c. After an ice bath, heat shock at 42°C for 90 seconds, immediately ice bath for 3 minutes, then add 800µL of antibiotic-free culture medium and incubate for 1 hour. d. Centrifuge the cultured sample to remove some of the supernatant, mix the remaining sample thoroughly, spread it onto a culture dish, and incubate it upside down overnight.

[0099] (7) Colony screening experiment a. Pick a single colony from the overnight plate; b. Perform colony PCR using N-5 and G13270-1V-SEQR; c. Identify positive clones by electrophoresis; d. Randomly select 3 positive bacteria and incubate them overnight in a 4 mL single tube at 37°C on a shaker.

[0100] Colony PCR reaction system: 1*Taq enzyme MIX 27 µL Monoclonal colonies 1 µL N-5 1 µL G13270-1V-SEQR 1 µL Total volume 30 µL Reaction conditions: 95℃, 3min 1 loop ①95℃, 25sec; ②60℃, 20sec; ③72℃, 40sec 25 cycles 72℃, 1min 1 loop

[0101] (8) Extract plasmids and send them for testing Positive clone bacterial cultures were cultured overnight, and then plasmids were extracted. Sequencing verification was performed using forward sequencing primers, reverse sequencing primers, and walking sequencing primers to ensure that the full length of the target sequence was detected.

[0102] Sequencing primer sequences: G93211-1-seq1 CACAGTGGTTGTCAAACCAG PEGFP-N-5 TGGGAGGTCTATATAAGCAGAG G13270-1V-SEQR GCCGGACACGCTGAACTTGT (9) Obtain the correct plasmid The final plasmid digestion bands were correct, and the sequencing results showed that the sequence was 100% correct. The plasmid sequence is shown in SEQ ID NO.1.

[0103] 3.1.2 Transfection of HK-2 cells with ALDH1A1 overexpression plasmid and verification of overexpression efficiency 1) Seed HK-2 cells in six-well plates and transfected the next day (transfect when cell density is 50-70%). 2) Prepare a mixture by adding 245 μL of Opti-MEM and 5 μL of Lipofectamine 3000 to each well of the six-well plate. Mix well by blowing and let stand at room temperature for 5 minutes. 3) Take 1 μg of each of the overexpression plasmid (oe-ALDH1A1) and the control plasmid (oe-NC) and add them to 245 μL of Opti-MEM. Mix well by pipetting and let stand at room temperature for 5 minutes. 4) Mix the Lipo 3000-Opti mixture with the plasmid-Opti mixture and let it stand at room temperature for 20 minutes; 5) Discard the old culture medium in the six-well plate, wash twice with PBS, and add 1.5 mL of Opti-MEM; Add the plasmid-Lipo-Opti mixture dropwise into the wells, in a circular motion, to ensure that cells in each area are in contact. 6) Place the six-well plate in a 37°C incubator for 4-6 hours, discard the culture medium, replace it with 2 mL of culture medium without antibiotics, and extract cell proteins after 48 hours of culture.

[0104] 7) The Western blotting method is the same as before.

[0105] 3.1.3 Measurement of mitochondrial membrane potential in HK-2 cells (CMXRos staining method) 1) Reagent preparation: Prepare PBS buffer, CMXRos staining solution (50 nmol / L), and Hoechst 33342 staining solution (1 μg / mL) in advance. Store in the dark after preparation and use immediately.

[0106] 2) Cell washing: Discard the old culture medium and gently wash the cells 3 times with PBS buffer.

[0107] 3) CMXRos staining: Add the prepared CMXRos working solution to the culture dish, ensuring that the working solution completely covers the cells, and place it in a 37°C, 5% CO2 incubator for 20–30 minutes in the dark.

[0108] 4) Washing and destaining: Discard the staining solution and gently rinse the cells 3 times with PBS buffer.

[0109] 5) Hoechst 33342 counterstaining: Add the prepared Hoechst 33342 working solution to the culture dish to completely cover the cells, and incubate at room temperature in the dark for 5–10 minutes to ensure that the cell nuclei are fully stained.

[0110] 6) Wash again: Discard the staining solution and rinse the cells 2–3 times with PBS buffer.

[0111] 7) Mounting and photographing: Add a small amount of anti-fluorescence quencher (to avoid fluorescence quenching), and gently cover with a coverslip using tweezers, avoiding air bubbles. Turn on the fluorescence microscope and select a suitable field of view to capture the image.

[0112] 3.1.4 Assay of HK-2 cell endocytosis capacity (FITC-BSA staining method) 1) Reagent preparation: Prepare PBS buffer, FITC-BSA staining solution (500 μg / mL) and DAPI staining solution (1 μg / mL) in advance. Store in the dark after preparation and use immediately.

[0113] 2) Cell washing: Discard the old culture medium from the culture dish and rinse the cells three times with PBS.

[0114] 3) FITC-BSA staining: Add the prepared FITC-BSA working solution to the culture dish, ensuring that the working solution completely covers the cells, and place it in a 37℃, 5% CO2 incubator for 20 minutes in the dark.

[0115] 4) Washing and destaining: Discard the FITC-BSA staining solution and gently rinse the cells 3 times with PBS buffer.

[0116] 5) DAPI counterstaining: Add the prepared DAPI working solution to the culture dish to completely cover the cells, and incubate at room temperature in the dark for 5–10 minutes to ensure that the cell nuclei are fully stained.

[0117] 6) Wash again: Discard the DAPI staining solution and rinse the cells 2–3 times with PBS buffer.

[0118] 7) Mounting and photographing: Add a small amount of anti-fluorescence quencher (to avoid fluorescence quenching), and gently cover with a coverslip using tweezers, avoiding air bubbles. Turn on the fluorescence microscope and select a suitable field of view to capture the image.

[0119] 3.2 Experimental Results 3.2.1 Validation of ALDH1A1 overexpression efficiency The results of the Western blotting experiment are as follows: Figure 6 As shown in A and 6B, compared with the control plasmid group (PA+oe-NC), the expression of ALDH1A1 protein in the ALDH1A1 overexpression group (PA+oe-ALDH1A1) was significantly increased, and the difference was statistically significant (P<0.05).

[0120] Figure 6 The detection of retinoic acid levels in cells C showed that, compared with the control plasmid group (PA+oe-NC), the retinoic acid level in cells overexpressing ALDH1A1 (PA+oe-ALDH1A1) was increased (P<0.05).

[0121] 3.2.2 Overexpression of ALDH1A1 improved mitochondrial damage and reduced inflammation and apoptosis levels. Based on 100 μM PA intervention, ALDH1A1 was overexpressed, and the expression levels of mitochondrial damage, inflammation, and apoptosis-related proteins were detected. Western blotting results are as follows: Figure 7 The results showed that, compared with the control plasmid group (PA+oe-NC), overexpression of ALDH1A1 reduced the expression of p-DRP1(Ser616) / DRP1 (P<0.05) and increased the expression of MFN1 (P<0.05); overexpression of ALDH1A1 significantly reduced the expression of Cleaved Caspase-3 and Bax (P<0.05); and TGF-β1 protein expression was significantly decreased after overexpression of ALDH1A1 (P<0.05).

[0122] 3.2.3 Overexpression of ALDH1A1 increased mitochondrial membrane potential and endocytic capacity. CMXRos staining results are as follows Figure 8 As shown in A and 8B, overexpression of ALDH1A1 significantly increased mitochondrial membrane potential compared with the control plasmid group (PA+oe-NC) (P<0.05).

[0123] FITC-BSA staining results as follows Figure 8As shown in C and 8D, compared with the control plasmid group (PA+oe-NC), the endocytic capacity of HK-2 cells was improved after overexpression of ALDH1A1 (P<0.05).

[0124] The results of Example 3 show that overexpression of ALDH1A1 can significantly increase intracellular retinoic acid levels, improve mitochondrial dysfunction, inhibit excessive cellular inflammation and abnormal apoptosis, and ultimately restore the cell's endocytic capacity.

[0125] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.

Claims

1. The use of an expression vector containing a nucleotide sequence encoding the ALDH1A1 protein in the preparation of a drug for treating impaired glucose tolerance nephropathy, characterized in that, The expression vector is used to increase the expression level of ALDH1A1 in renal tubular epithelial cells, thereby increasing the level of retinoic acid in renal tubular epithelial cells, improving mitochondrial damage, reducing inflammation and apoptosis levels, and thus improving renal tubular reabsorption function.

2. The application according to claim 1, characterized in that, The expression vector is a recombinant expression plasmid or a recombinant viral expression vector.

3. The application according to claim 2, characterized in that, The expression vector is a recombinant expression plasmid, which contains the nucleotide sequence shown in SEQ ID NO.1.

Images