Senecavirus vp1 protein antigenic epitope polypeptide, monoclonal antibody and application thereof

Abstract

The application belongs to the technical field of biological detection, and particularly relates to a Senecavirus VP1 protein antigen epitope polypeptide, a monoclonal antibody and application thereof. The amino acid sequence of the antigen epitope polypeptide is shown as SEQ ID NO:1. The monoclonal antibody specifically recognizes the antigen epitope polypeptide. The SVV VP1 protein is expressed in prokaryotes, and mice are immunized with the SVV VP1 protein. The monoclonal antibody against the VP1 protein is obtained by using the hybridoma technology. The linear B cell epitope of the monoclonal antibody is identified by expressing the VP1 protein fragment by truncation, and the application of the antigen peptide is preliminarily explored in vitro, thereby providing a powerful tool for pathogenicity research and diagnosis of the virus.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a Seneca virus VP1 protein antigenic epitope polypeptide, monoclonal antibody and their applications. Background Technology

[0002] Seneca Valley virus (SVV) is a non-enveloped virus belonging to the genus Senecavirus in the family Picornaviridae. It causes vesicular disease in pigs. The virus genome is a single-stranded positive-sense RNA, approximately 7.2 kb in length, containing a 5' untranslated region (UTR), an open reading frame (ORF), a 3' UTR, and a polyA tail. The ORF encodes a polyprotein, which is cleaved after synthesis into four structural proteins (VP1, VP2, VP3, VP4) and eight non-structural proteins (Lpro, 2A, 2B, 2C, 3A, 3B, 3C, and 3D).

[0003] The virus was first discovered incidentally in cell cultures in 2002, and SVV nucleic acid was detected in pigs exhibiting vesicular disease in 2007. SVV infection can cause lethargy, anorexia, lameness, and vesicular lesions on the mouth, nose, or hooves in pigs. These lesions are extremely similar to other vesicular diseases such as foot-and-mouth disease (FMD), vesicular disease (SVD), vesicular stomatitis (VS), and vesicular stomatitis (VES), making them difficult to distinguish based on clinical symptoms alone. Therefore, laboratory diagnostic methods are needed for definitive diagnosis.

[0004] Within the Picornaviridae family, the VP1 protein exhibits high immunogenicity. Although the sequence similarity of this protein is low among different species of picornaviridae, it shows high conservation within the same viral species: nucleotide sequence identity can reach 99%–100%, and amino acid sequence identity can reach 100%. Studies have shown that the SVV VP1 protein is involved in viral cell tropism and receptor binding. Given the high immunogenicity and conservation of the VP1 protein and its important role in the viral life cycle, exploring the antigenic region of the VP1 protein will provide crucial theoretical support for elucidating the pathogenic mechanism of SVV and improving immunodiagnostic techniques. Summary of the Invention

[0005] This invention addresses the problem of difficulty in diagnosing SVV infection in pigs based solely on clinical symptoms by providing a Seneca virus VP1 protein antigenic epitope polypeptide, a monoclonal antibody, and their applications, thereby resolving the aforementioned issues.

[0006] To achieve the above objectives, the technical solution claimed by this invention is as follows:

[0007] An antigenic epitope peptide of Seneca virus VP1 protein, the amino acid sequence of which is shown in SEQ ID NO:1 (DTDFSGELA); the antigenic epitope peptide is located at 16-24 amino acids of the VP1 protein.

[0008] The present invention also provides nucleotides encoding the said antigenic epitope polypeptide, the sequence of which is shown in SEQ ID NO:2 (GACACCGATTTCTCTGGTGAACTGGCG).

[0009] The present invention also provides a monoclonal antibody that can specifically recognize the antigenic epitope polypeptide; the heavy chain subtype of the monoclonal antibody is IgG2a, and the light chain is κ chain.

[0010] This invention provides the application of the antigenic epitope polypeptide in the preparation of reagents for detecting Seneca virus antibodies, in the design of Seneca virus antigens and novel vaccines, and in the diagnosis and detection of Seneca virus infection in animals. In a specific embodiment of this invention, the animal is a pig.

[0011] The present invention also provides the application of the monoclonal antibody in the specific recognition of Seneca virus infection in animals, wherein, in a specific embodiment of the present invention, the animal is a pig.

[0012] Beneficial effects:

[0013] This invention expresses SVV VP1 protein in prokaryotes and immunizes mice with it. Using hybridoma technology, monoclonal antibodies against VP1 protein are obtained. Furthermore, the linear B-cell epitopes of the monoclonal antibodies are identified by truncating the VP1 protein fragment. The antigen peptide is synthesized in vitro, and its application is preliminarily explored, providing a powerful tool for the etiological research and diagnosis of this virus. Attached Figure Description

[0014] Figure 1 This is a schematic diagram of PCR amplification of the VP1 gene in an embodiment of the present invention; wherein: Marker is a nucleotide molecular weight standard.

[0015] Figure 2 This is a schematic diagram illustrating the identification of recombinant VP1 protein expressed in prokaryotes in an embodiment of the present invention; wherein: Marker is the protein molecular weight standard, and pET28a-VP1 is the VP1 protein fused with a His tag.

[0016] Figure 3This is a schematic diagram of the purification results of recombinant VP1 protein in an embodiment of the present invention, wherein: Marker is the protein molecular weight standard, and pET28a-VP1 is the purified VP1 protein fused with the His tag.

[0017] Figure 4 This is a schematic diagram of Western blot identification of the antigenicity of purified recombinant VP1 protein in an embodiment of the present invention, wherein: Marker is the protein molecular weight standard, and pET28a-VP1 is the purified VP1 protein fused with the His tag.

[0018] Figure 5 This is a schematic diagram of VP1 monoclonal antibody subtype identification in an embodiment of the present invention, wherein: OD450 represents the absorbance at 450nm, heavy chain is the heavy chain, IgA, IgG1, IgG2a, IgG2b, IgG3 and IgM heavy chain subtypes, light chain is the light chain, and κ and λ are light chain subtypes.

[0019] Figure 6 This is a schematic diagram illustrating the reactivity of the monoclonal antibody with SVV as identified by IFA in an embodiment of the present invention, wherein: Mock represents uninoculated BHK-21 cells, and SVV represents inoculated BHK-21 cells.

[0020] Figure 7 This is a schematic diagram illustrating the reactivity of the monoclonal antibody with SVV as determined by IFA in an embodiment of the present invention, wherein: Mock is lysate of uninoculated BHK-21 cells, and SVV is lysate of inoculated BHK-21 cells.

[0021] Figure 8 This is a schematic diagram of the antigenic epitopes for identifying monoclonal antibodies in an embodiment of the present invention, wherein: numbers represent the amino acid positions of the VP1 protein, dark gray represents a negative reaction with monoclonal antibodies, and light gray represents a negative reaction with monoclonal antibodies.

[0022] Figure 9 This is a spatial distribution diagram of the antigenic epitope DTDFSGELA on the VP1 protein in an embodiment of the present invention, where white represents the three-dimensional structure of the VP1 protein and red represents the location of the antigenic epitope.

[0023] Figure 10 This is a schematic diagram of the ELISA results of the synthesized Seneca virus VP1 antigen peptide reacting with standard positive serum, negative serum, and PBS in an embodiment of the present invention, wherein: OD450 represents the absorbance at 450nm. Detailed Implementation

[0024] To further illustrate the present invention, the technical solutions provided by the present invention are described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention. The embodiments provided below can serve as a guide for further improvements by those skilled in the art, and do not constitute a limitation on the present invention in any way.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0026] Example 1: Seneca virus VP1 protein antigenic epitope polypeptide

[0027] This embodiment provides a Seneca virus VP1 protein antigenic epitope peptide, the amino acid sequence of which is shown in SEQ ID NO:1 (DTDFSGELA); the antigenic epitope peptide is located at 16-24aa of the VP1 protein.

[0028] Example 2: A nucleotide

[0029] This embodiment provides a polypeptide nucleotide encoding the Seneca virus VP1 protein antigenic epitope described in Embodiment 1, the sequence of which is shown in SEQ ID NO:2 (GACACCGATTTCTCTGGTGAACTGGCG).

[0030] Example 3: A monoclonal antibody

[0031] This embodiment provides a monoclonal antibody that can specifically recognize the Seneca virus VP1 protein antigenic epitope polypeptide described in Example 1; the heavy chain subtype of the monoclonal antibody is IgG2a, and the light chain is the κ chain.

[0032] Example 4: Application of Seneca virus VP1 protein antigenic epitope peptide

[0033] This embodiment provides the application of the Seneca virus VP1 protein antigenic epitope polypeptide described in Example 1. The application includes: its use in the preparation of reagents for detecting Seneca virus antibodies, its use in Seneca virus antigen design and novel vaccines, and its use in the diagnosis and detection of Seneca virus infection in animals. In a specific embodiment of the present invention, the animal is a pig.

[0034] Example 5: Application of Monoclonal Antibodies

[0035] This embodiment provides the application of the monoclonal antibody described in Example 1 in the specific recognition of Seneca virus infection in animals. In a specific embodiment of the present invention, the animal is a pig.

[0036] Experimental Example

[0037] 1. Materials and Methods

[0038] 1.1 Materials

[0039] 1.1.1 Viruses, cells, plasmids

[0040] SVV strain CHhb17 (GenBank No. MG983756.1), hamster kidney cells (BHK-21), myeloma cells (SP2 / 0), human embryonic kidney cells (HEK-293T), pET-28a prokaryotic expression plasmid, and pEGFP-N2 eukaryotic expression plasmid were all stored in our laboratory. BALB / c female mice (6 weeks old) were purchased from Liaoning Changsheng Biotechnology Co., Ltd.

[0041] 1.1.2 Main Reagents

[0042] DNA polymerase, restriction endonuclease, and T4 DNA ligase were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.; the homologous recombination cloning kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; the DNA gel extraction kit and plasmid extraction kit were purchased from Novizan Biotechnology Co., Ltd.; Ni-NTA agarose was purchased from Qiagen Biotechnology Co., Ltd.; DMEM and RPMI 1640 culture medium were purchased from Thermo Fisher Scientific Co., Ltd.; fetal bovine serum was purchased from Shanghai Nolai Biotechnology Co., Ltd.; Freund's adjuvant, 50×HAT, 50×HT, and PEG2000 fusion agent were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; the mouse monoclonal antibody subclass identification ELISA kit was purchased from Beijing Bio-Rad Biotechnology Co., Ltd.; His-tagged antibody and GFP-tagged antibody were purchased from Wuhan Sanying Biotechnology Co., Ltd.; and HRP-labeled goat anti-mouse secondary antibody was purchased from Zhongshan Jinqiao Biotechnology Co., Ltd.

[0043] 1.2.3 Construction and Identification of Prokaryotic Expression Vectors

[0044] Primers were designed based on the VP1 nucleotide sequence of the CHhb17 strain in GenBank, as shown in Table 1. These primers were synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd. RNA from the CHhb17 SVV strain was extracted using the FastPure Viral DNA / RNA Mini Kit (Novizan) and reverse transcribed into cDNA. The VP1 gene was amplified by PCR using the pET28a-VP1-F / pET28a-VP1-R primers (sequences shown in Table 1). After confirming the size met expectations by 1% agarose gel electrophoresis, the target fragment was purified using a gel extraction kit. Simultaneously, the pET-28a prokaryotic expression vector was digested with BamHI and HindIII restriction endonucleases, and the products were recovered. The purified VP1 target fragment and the digested vector were used to construct a recombinant plasmid using a homologous recombination cloning kit. This plasmid was then transformed into Trans 10 competent cells. Single colonies were picked and identified by PCR using universal primers: pET28a-F: TAATACGACTCACTATAGGG (SEQ ID NO:39); pET28a-R: GCTAGTTATTGCTCAGCGG (SEQ ID NO:40). Positive bacterial cultures were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. DNASTAR Lasergene was used for sequencing. 7.1 The Seqman module of the software compares the sequence obtained with the VP1 nucleotide sequence. If the sequences are completely identical, the construction is considered successful. Then, the recombinant plasmid pET-28a-VP1 is extracted.

[0045] Table 1. Primer design based on the VP1 nucleotide sequence of CHhb17 strain

[0046]

[0047] 1.2.4 Expression and purification of recombinant VP1 protein

[0048] The recombinant plasmid pET-28a-VP1 was transformed into BL21(DE3) competent cells. Single colonies were picked and inoculated into LB liquid medium containing kanamycin resistance and cultured in a shaker. The OD of the bacterial culture was measured. 600When the pH value reached 0.6–0.8, IPTG at a final concentration of 1 mM was added for induction culture for 6 h. The culture was centrifuged to collect the precipitate, washed twice with PBS, resuspended in an appropriate amount of PBS, and then sonicated on ice. After sonication lysis, whole-cell protein samples were collected for later use; then the sonicated lysis products were centrifuged at 12000×g for 5 min at 4℃, and the supernatant and precipitate were collected separately. The expression of recombinant VP1 protein was analyzed by SDS-PAGE combined with Coomassie brilliant blue staining. The recombinant protein was purified by Ni column affinity chromatography, and the purity and antigenicity of the purified product were determined by SDS-PAGE and Western blot experiments.

[0049] 1.2.5 Mouse Immunization and Acquisition of Hybridoma Cells

[0050] Six-week-old BALB / c female mice were immunized with purified recombinant VP1 protein via subcutaneous multiple-point injection on the back (immunization dose: 20 μg / mouse). Two weeks later, booster immunizations were administered using the same dose and route. Two weeks after the third immunization, serum antibody titers were detected using an indirect ELISA assay. Mice with high serum titers were selected, and spleen cells were fused with SP2 / 0 cells using standard hybridoma preparation methods. Positive hybridoma cells were screened using an indirect ELISA method, and after three rounds of subclonal purification and identification, a hybridoma cell line stably secreting VP1 monoclonal antibody was obtained.

[0051] 1.2.6 Identification of VP1 monoclonal antibody subtypes

[0052] Six-week-old female BALB / c mice were selected and injected intraperitoneally with Freund's incomplete adjuvant. The following day, hybridoma cells were injected in the same manner. One week later, peritoneal fluid was collected from the mice, and the supernatant was collected by centrifugation to obtain ascites containing a large amount of VP1 monoclonal antibody (MAb). Subsequently, the subtypes were identified by ELISA according to the instructions of the mouse monoclonal antibody subtype identification kit.

[0053] 1.2.7 Identification of the reactivity of VP1 monoclonal antibody with SVV

[0054] SVV strain CHhb17 was inoculated into BHK-21 cells at an MOI of 0.5, with a blank cell control set up. The culture medium was discarded 24 h after SVV infection, and the cells were collected for indirect immunofluorescence (IFA) and Western blot experiments.

[0055] (1) Indirect immunofluorescence (IFA) assay: 4% paraformaldehyde was added for fixation at room temperature for 10 min, followed by permeabilization of the cell membrane with a solution containing 0.1% Triton X-100. After blocking the cells with 2% BSA, MAb of VP1 protein was added and incubated at room temperature for 4 h. After washing three times with PBS, Alexa Fluor 488-labeled anti-mouse secondary antibody was added and incubated at room temperature for 1 h. After washing with PBS, the cells were observed under a fluorescence microscope.

[0056] (2) Western blot experiment: Cell lysis buffer was added, and the supernatant was collected after centrifugation to prepare protein samples. After separation by SDS-PAGE, the samples were transferred to NC membranes and blocked with 5% skim milk. Then, MAb of VP1 protein was added and incubated overnight at 4°C. After washing three times with PBS, HRP-labeled anti-mouse secondary antibody was added and incubated at room temperature for 1 h. After washing with PBS, ECL color development was performed.

[0057] 1.2.8 Identification of VP1 antigenic epitopes

[0058] The antigenic epitopes targeted by VP1 protein MAb were identified using a truncated expression strategy. This strategy involves artificially deleting portions of the target gene sequence using genetic engineering, retaining only functional domains (such as catalytic domains, binding domains, or antigenic epitopes) to achieve efficient and soluble expression of the target protein. Specifically, the VP1 nucleotide sequence was truncated into different fragments, and a series of these truncated fragments were inserted into the pEGFP-N2 vector via Xho I and KpnI double restriction enzyme sites to construct recombinant plasmids. The recombinant plasmids were extracted and transfected into HEK 293T cells using PEI. After 48 h, the cells were collected, and Western blot analysis was used to detect the reactivity of VP1 protein MAb with different truncated proteins to determine the antigenic epitopes recognized by VP1 protein MAb.

[0059] 1.2.9 Analysis of the conservation of VP1 antigenic epitopes

[0060] Download the VP1 protein sequence from the Genbank database and perform sequence alignment using MEGA-X software to analyze the conservation of the VP1 antigenic epitope.

[0061] 1.2.10 Spatial distribution analysis of antigenic epitopes

[0062] The three-dimensional structure of the VP1 protein was predicted using AlphaFold based on its amino acid sequence. The predicted structure was then imported into Pymol software to analyze the spatial distribution characteristics of the antigenic epitopes within the VP1 protein's three-dimensional structure. 1.2.11 Application of antigenic epitope peptides in the diagnosis and detection of SVV infection.

[0063] An epitope peptide conjugated with ovalbumin (OVA) was synthesized and diluted to 2 μg / mL with ELISA coating buffer and added to an ELISA plate (100 μL / well). The plate was incubated overnight at 4°C. After washing with PBST, the plate was blocked with 10% rabbit serum at 37°C for 2 h. SVV positive and negative sera were diluted 50-fold each as primary antibodies, with a PBS control included. The plate was incubated at 37°C for 1 h. After washing, HRP-labeled anti-pig secondary antibody was added, and the plate was incubated at 37°C for 45 min. After washing again, TMB chromogenic buffer was added for 3 min in the dark. The reaction was terminated with stop solution, and the OD values ​​of each well were read using an ELISA reader. 450 value.

[0064] 2. Results and Analysis

[0065] 2.1 Expression and purification of recombinant VP1 protein

[0066] SVV was reverse transcribed into cDNA, which was then used as a template to amplify the VP1 gene by PCR. The amplified products were identified by agarose gel electrophoresis. The results are as follows: Figure 1 As shown, a specific band appeared at approximately 750 bp, consistent with the expected size. Homologous recombination was used to insert it into the pET-28a vector, constructing the pET-28a-VP1 recombinant plasmid. After successful sequencing, it was transformed into BL21 competent cells, and IPTG was added to induce expression. SDS-PAGE and Coomassie Brilliant Blue staining results showed a distinct band at approximately 30 kDa, consistent with the expected size (30 kDa), indicating successful expression of the recombinant VP1 protein. Figure 2 The recombinant protein was purified using affinity chromatography, and SDS-PAGE analysis confirmed that the purification effect was good. Figure 3 Western blot analysis showed that the purified recombinant VP1 protein could be recognized by His protein, indicating that it has good immunogenicity. Figure 4 ).

[0067] 2.2 Preparation and Identification of VP1 Monoclonal Antibody

[0068] Mice with the highest serum antibody titers after triple immunization were selected, and their spleen cells were aseptically fused with SP2 / 0 cells. Positive hybridoma cells were screened using indirect ELISA, followed by subcloning. After three rounds of screening and subcloning, a stable hybridoma cell line secreting VP1 MAb was obtained. The cell line was propagated, and ascites fluid was prepared by injecting it into the peritoneal cavity of mice. The VP1 MAb subtype was identified using indirect ELISA, such as... Figure 5 As shown, the results indicate that its heavy chain subtype is IgG2a and its light chain is the κ chain.

[0069] 2.3 Reactivity of VP1 monoclonal antibody with SVV

[0070] The reactivity of the obtained VP1 MAb with the SVV strain CHhb17 was identified. BHK-21 cells were infected with SVV, and after 24 h, cells were harvested for IFA and Western blot experiments. IFA results showed that cells inoculated with SVV showed a specific green fluorescent signal when incubated with VP1MAb, while cells infected with the virus did not produce a fluorescent signal. Figure 6 This indicates that VP1 MAb can specifically recognize SVV infection. Western blot experiments showed that VP1 MAb can specifically recognize the VP1 protein expressed by the virus, but does not react with the protein of uninfected cells, indicating its good reactivity with viral proteins. Figure 7 ).

[0071] 2.4 Identification of VP1 antigenic epitopes

[0072] Using a protein truncation expression strategy, VP1 proteins of different lengths were expressed with GFP fusion tags to identify the antigenic epitopes recognized by VP1 MAb. Western blot results showed that VP1 MAb did not bind to the empty vector, T1-2, and T1-3, but specifically bound to T1-1, indicating that the recognized antigenic epitope is located at amino acids 1-70 of the VP1 protein. These 70 amino acids were divided into three segments: T2-1 (1-30 aa), T2-2 (21-50 aa), and T2-3 (41-70 aa). Western blot analysis confirmed that VP1 MAb recognizes amino acids 1-30. Following the same method, these 30 amino acids were further truncated: T3-1 (1-15 aa) and T3-2 (15-30 aa), revealing that VP1 MAb recognizes amino acids 15-30. Subsequently, the N-terminus and C-terminus of the T3-2 peptide were sequentially reduced by two amino acids to identify the shortest antigenic epitope recognized by VP1 MAb. The results showed that, as Figure 8 As shown, the shortest antigenic epitope recognized by VP1 MAb is 16 DTDFSGELA 24 (SEQ ID NO:1).

[0073] 2.5 Conservation analysis of VP1 antigenic epitopes

[0074] The conservation of antigenic epitopes was analyzed by aligning VP1 protein sequences in GenBank using MEGA-X. Sequence alignment analysis revealed the antigenic epitopes in this study. 16 DTDFSGELA 24 (SEQ ID NO:1) Highly conserved.

[0075] 2.7 Spatial distribution analysis of antigenic epitopes

[0076] The three-dimensional structure of the VP1 protein was predicted using AlphaFold, and the position of amino acids DTDFSGELA from position 16 to 24 in the VP1 protein's three-dimensional structure was analyzed using PyMOL software. The results are as follows: Figure 9 As shown, DTDFSGELA is exposed on the surface of the VP1 protein structure. 2.6 Application of antigenic epitope peptides in the diagnosis and detection of SVV infection.

[0077] Antigenic epitope peptides conjugated with OVA were coated onto ELISA plates, and SVV-positive serum, negative serum, and PBS were used as primary antibodies for ELISA. Results showed that... Figure 10 As shown, the OD value of the antigenic epitope peptide reacting with positive serum was significantly higher than that of negative serum and PBS, indicating that the antigenic epitope peptide can be used for the diagnosis and detection of SVV infection.

Claims

1. A Seneca virus VP1 protein antigenic epitope polypeptide, characterized in that, The amino acid sequence of the Seneca virus VP1 protein antigenic epitope polypeptide is shown in SEQ ID NO:

1.

2. The antigenic epitope polypeptide according to claim 1, characterized in that, The antigenic epitope peptide is located at 16-24aa of the VP1 protein.

3. The nucleotide encoding the antigenic epitope polypeptide of claim 1, characterized in that, The sequence of the nucleotide is shown in SEQ ID NO:

2.

4. The use of the antigenic epitope polypeptide of claim 1 in the preparation of reagents for detecting Seneca virus antibodies.

Images