A high carbon dioxide resistant Ganoderma lucidum mutant strain and its application

Abstract

This invention relates to the field of fungal breeding technology, and more particularly to a high-carbon dioxide-resistant Ganoderma lucidum mutant strain and its applications, including the Ganoderma lucidum mutant strain MKLGE251213 acclimated to high-concentration carbon dioxide through ultraviolet mutagenesis and high-concentration carbon dioxide. The depositary institution is the China General Microbiological Culture Collection Center (CGMCC); address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; deposit date: March 11, 2026; deposit number: CGMCC No. 42591. Solid-state fermentation showed that the mycelial biomass of this strain was significantly increased compared to the wild-type strain, and the tensile strength was increased by 3.4%, with a thicker and more uniform mycelial layer. After 10 consecutive subcultures, the biomass and tensile strength remained stable. This strain can maintain high biomass accumulation and mechanical properties even under high carbon dioxide conditions, making it suitable for large-scale preparation of mycelial and mycelial materials, and applicable to the fields of bio-based packaging films, leather substitutes, and biodegradable materials.

Description

Technical Field

[0001] This invention relates to the field of fungal breeding technology, and in particular to a high carbon dioxide-resistant Ganoderma lucidum mutant strain and its application. Background Technology

[0002] Reishi mushroom, a traditional and precious medicinal fungus, not only possesses extremely high medicinal value, but its mycelial material has also attracted widespread attention in recent years as a novel bio-based leather alternative. During solid-state cultivation, Reishi mycelium can form a dense mycelial skin with a certain mechanical strength on the substrate surface. Through subsequent physical or chemical treatment of this mycelial skin, mycelial composite materials that are close to or even superior to traditional leather in appearance, feel, and mechanical properties can be obtained.

[0003] In solid-state fermentation processes for producing mycelial materials, to obtain dense, uniformly thick, and easily processed mycelial substrates, it is typically necessary to induce continuous mycelial extension and biomass accumulation during the vegetative growth stage, preventing the formation of primordia or fruiting bodies through reproductive growth. Primordia formation consumes a large amount of nutrients, disrupts the uniformity and density of the mycelial substrate structure, and ultimately leads to decreased mechanical strength and deteriorated surface quality of the final material. Therefore, effectively inhibiting primordia differentiation and maintaining a purely vegetative growth state of the mycelium during the solid-state fermentation cycle is a key technical challenge for achieving efficient production of high-performance mycelial materials.

[0004] Currently, the recognized and effective physical method for inhibiting primordium formation is to regulate the carbon dioxide concentration in the culture environment. High concentrations of carbon dioxide can significantly inhibit primordium differentiation in Ganoderma lucidum, promoting vigorous vegetative growth of the mycelium. However, as a strictly aerobic fungus, Ganoderma lucidum's normal respiratory metabolism and energy supply are highly dependent on sufficient oxygen. Under long-term conditions of high carbon dioxide and low oxygen partial pressure, the respiration of Ganoderma lucidum mycelium is significantly inhibited, cellular metabolic activity decreases, leading to a slowdown in mycelial growth rate and a significant reduction in biomass accumulation efficiency. Insufficient biomass directly restricts the thickness, density, and compactness of the mycelial skin per unit culture cycle, not only prolonging the production cycle but also increasing the risk of contamination by other microorganisms, thereby significantly increasing the production cost of mycelial material.

[0005] While traditional process optimization methods, such as intermittent ventilation and gas ratio adjustment, can alleviate the inherent contradiction between high carbon dioxide levels inhibiting primordia and low oxygen levels inhibiting growth, they cannot fundamentally resolve the conflict between the strain's physiological characteristics and environmental requirements. Essentially, this contradiction stems from the limitations of the strain's own genetic characteristics, which determine its carbon dioxide tolerance threshold and ability to maintain metabolic activity.

[0006] Therefore, if a Ganoderma lucidum strain that can maintain high metabolic activity and growth rate in a high carbon dioxide environment can be obtained through modern breeding technology, then a higher concentration of carbon dioxide can be applied in solid-state culture to completely inhibit primordia differentiation, while relying on the strain's own stress resistance to ensure rapid mycelial growth and efficient biomass accumulation. Summary of the Invention

[0007] Therefore, this invention provides a high carbon dioxide resistant Ganoderma lucidum mutant strain and its application, in order to overcome the problems of inhibited growth and insufficient biomass accumulation of Ganoderma lucidum in high-concentration carbon dioxide environments in the prior art.

[0008] To achieve the above objectives, this invention provides a high-carbon dioxide-resistant Ganoderma lucidum mutant strain, which is obtained by ultraviolet mutagenesis and high-concentration carbon dioxide acclimatization using Ganoderma lucidum as the starting strain; the mutant strain is named Ganoderma lucidum. Ganoderma lingzhi MKLGE251213; Depository Institution: China General Microbiological Culture Collection Center (CGMCC); Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit Date: March 11, 2026; Deposit Number: CGMCC No. 42591.

[0009] The present invention also provides the application of the high carbon dioxide resistant Ganoderma lucidum mutant strain in the preparation of mycelial materials.

[0010] Furthermore, the mycelial material is a mycelial skin.

[0011] Furthermore, the specific method for preparing the mycelial material includes the following steps: The mutant strain was inoculated into liquid culture medium and cultured on a shaker for 4 days to obtain a liquid bacterial strain; The liquid bacterial culture was sprayed onto the surface of a solid fermentation medium and cultured for 15 days under constant temperature and humidity conditions and a carbon dioxide concentration of 4% (v / v) to obtain the mycelial material.

[0012] Compared with the prior art, the present invention has the following beneficial effects: 1. The high carbon dioxide-resistant mutant strain of Ganoderma lucidum provided by this invention Ganoderma lingzhi Under solid-state fermentation conditions, the biomass of the mycelium of MKLGE251213 reached 138.7g, which is 160.3% of that of the wild-type strain, representing an increase of 60.3%. At the same time, the tensile strength was 3.36MPa, which is about 3.4% higher than that of the wild-type strain. The mycelium thickness increased and the uniformity improved, achieving a balance between high yield and good mechanical properties.

[0013] 2. After 10 consecutive passages, the biomass of the mutant strain of this invention remained stable between 138.4-139.2 g and the tensile strength remained stable between 3.35-3.40 MPa, without significant decline or variation. It has good genetic stability and meets the requirements for strain stability in industrial-scale production. Attached Figure Description

[0014] Figure 1 These are colony images of the wild-type strain and the potential mutagenized strain in embodiments of the present invention; Figure 2 The bar chart shows the colony diameters of wild-type strains and potential mutant strains in the embodiments of the present invention; ad: analysis was performed using Duncan's multiple range test method, the alphabetical order is the order of the mean, and different letters indicate significant differences (p ≤ 0.05, n = 3). Figure 3 The bar chart shows the biomass of wild-type strains and candidate mutagenized strains in the embodiments of the present invention; ae: analysis was performed using Duncan's multiple range test, the alphabetical order is the order of the mean, and different letters indicate significant differences (p≤0.05, n=3). Figure 4 This is a bar chart showing the tensile strength of wild-type strains and candidate mutant strains in the embodiments of the present invention; ac: analysis was performed using Duncan's multiple range test method, the alphabetical order is the order of the mean, and different letters indicate significant differences (p≤0.05, n=3). Figure 5 Wild-type strains and Ganoderma lucidum are examples of the present invention. Ganoderma lingzhi Image showing the culture results of strain MKLGE251213.

[0015] The preservation information is as follows: Classification and naming: Ganoderma lucidum Ganoderma lingzhi ; Preservation institution: China General Microbiological Culture Collection Center (CGMCC); Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: March 11, 2026; Accession number: CGMCC No.42591. Detailed Implementation

[0016] This invention discloses a high-carbon dioxide-resistant Ganoderma lucidum mutagenesis strain and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0017] The culture medium components used in the following examples are: PDA medium: 40g of potato dextrose agar powder, diluted to 1L with deionized water; Seed culture medium: glucose 35 g / L, peptone 5.0 g / L, yeast extract 2.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, potassium dihydrogen phosphate 1.0 g / L, vitamin B1 0.05 g / L, pH adjusted to 5.50 with dilute sulfuric acid; Regeneration medium: mannitol 109.3 g / L, glucose 4 g / L, maltose 10 g / L, yeast extract 4 g / L, agar 15 g / L; Solid-state fermentation medium: sawdust 77.84%wt, wheat bran 20%wt, sucrose 1%wt, gypsum 1%wt, potassium dihydrogen phosphate 0.1%wt, magnesium sulfate 0.05%wt, vitamin B 0.01%wt.

[0018] The reagent components used in the following examples are: 0.6M mannitol solution: 54.65g mannitol, diluted to 500mL with deionized water; Lesion enzyme solution: 1g of lysion enzyme from Guangdong Institute of Microbiology, diluted to 50mL with deionized water.

[0019] SPSS 19 software was used for data processing, and analysis of variance was employed. The average value of three experiments was used to obtain the measurement results, and p ≤ 0.05 was considered statistically significant.

[0020] Example 1: Homology Comparison of Starting Strains In this embodiment, the Ganoderma lucidum strain was isolated from Ganoderma lucidum fruiting bodies collected in a broad-leaved forest in Chengdu, Sichuan Province in June 2025.

[0021] The strain was identified by gene sequencing; the sequence of the internal transcribed spacers (ITS) located between the 3' end of 18S rDNA and the 5' end of 28S rDNA was determined; the internal transcribed spacers were determined using primers ITS1F and ITS4, and the internal transcribed spacer region sequence is shown in SEQ ID NO:1. The sequence of ITS1F is CTTGGTCATTTAGAGGAAGTAA; The sequence of ITS4 is TCCTCCGCTTATTGATATGC; Homology comparison of the internal transcription spacer region sequence with the GenBank nucleic acid sequence database showed that the ITS sequence of Ganoderma lucidum had a similarity of more than 99%, thus confirming that it was Ganoderma lucidum and that the strain was a wild-type strain.

[0022] Example 2: Determination of Experimental Carbon Dioxide Concentration The area of ​​the mycelium is 5cm² 2 The wild-type strain was inoculated into a 500mL culture flask containing 150mL of liquid seed culture medium and cultured on a shaker at 25℃ and 150r / min for 4 days to obtain a liquid inoculum. The liquid inoculum was then inoculated onto a solid-state fermentation medium and fermented to obtain mycelial sheets. The specific fermentation method was as follows: 1. Add water to the solid-state fermentation medium to adjust the moisture content to 65% wt, and use it as the fermentation substrate; 2. Divide the above fermentation substrate into the culture box at 10%, 30% and 50% of the volume of the 2400mL culture box respectively, cover the culture box and record them as group A, group B and group C respectively; 3. Place the culture boxes evenly into the sterilizer and sterilize at 121℃ for 90 minutes; 4. After sterilization, cool the incubator to room temperature in a clean room; 5. Inside the clean bench, open the lid and evenly spray the liquid inoculum containing 0.9g of dry mycelium (about 70mL) onto the surface of each substrate group, then close the lid. 6. Place the incubation room in a constant temperature and humidity chamber and incubate for 15 days at 28-30℃ and RH 60%-70%. 7. After the cultivation cycle is completed, open the lid and separate and remove the mycelium skin on top of the substrate.

[0023] During mycelial culture, the carbon dioxide concentration in the microenvironment is maintained by the carbon dioxide produced by the mycelium's own respiration, thus inhibiting primordium formation and causing the mycelium to grow excessively. Different loading coefficients determine the biomass of mycelium within the container, thereby affecting the carbon dioxide concentration in the microenvironment. As the loading coefficient increases, the carbon dioxide concentration gradually increases. It was observed that 5 primordia appeared on the entire mycelial substrate in group A, 2 primordia in group B, and no primordia appeared on the entire mycelial substrate in group C. The carbon dioxide concentration in group C was measured to be 4% (v / v), proving that this concentration can effectively inhibit primordium formation. Under these conditions, the 4% (v / v) carbon dioxide produced by the strain's own respiration also inhibits the mycelium's own growth. Therefore, 4% (v / v) was set as the experimental concentration for subsequent screening of high carbon dioxide-tolerant strains.

[0024] Example 3: Preparation of Ganoderma lucidum protoplasts Wild-type Ganoderma lucidum strains were inoculated into test tubes containing PDA slant medium and cultured at 25°C for 7 days. Mycelia were picked and washed with 0.6M mannitol solution, centrifuged at 6000 rpm for 10 min, and the supernatant was discarded. This washing process was repeated twice. 2% (w / v) lysozyme solution was added at a ratio of 1 mL enzyme solution to 0.2 g of wet mycelia, and the mixture was shaken thoroughly to break up the mycelium. Enzymatic hydrolysis was carried out in a 31°C water bath for 3.5 h, shaking every 0.5 h during the process. After hydrolysis, the hydrolysate was filtered through a 0.45 μm microporous membrane, and the filtrate was centrifuged at 4000 rpm for 10 min. The supernatant was discarded, and protoplast precipitate was obtained. The protoplast precipitate was resuspended in 1 mL of 0.6M mannitol solution, centrifuged at 4000 rpm for 10 min, and the supernatant was discarded. This process was repeated twice to completely remove any enzyme residue. The protoplast precipitate was added to a 0.6 M mannitol solution to prepare a final concentration of 10. 6 A protoplast suspension of 1 protoplast per mL.

[0025] Example 4: Ultraviolet Mutagenesis and Domestication Add 2 mL of the above protoplast suspension to a sterile petri dish, and place the sterile petri dish containing the protoplast suspension 30 cm away from a 20 W UV lamp for irradiation and mutagenesis for 30 s. Spread 100 μL of the mutagenesis solution onto a regeneration medium plate, place it in a low-temperature carbon dioxide incubator (BIO-300C Ⅲ) with a carbon dioxide concentration of 4% (v / v) and a temperature of 25 °C, and incubate for 6-7 days. Select large, vigorous colonies and inoculate them into plates containing PDA solid medium, obtaining a total of 73 regenerated strains.

[0026] In this culture environment, the carbon dioxide produced by the mycelium itself cannot significantly affect the gas composition of the microenvironment. Therefore, during the acclimatization process, carbon dioxide is supplemented externally to keep the carbon dioxide concentration in the carbon dioxide low-temperature incubator at 4% (v / v), thereby affecting the growth environment of the colonies placed on the plates in the carbon dioxide low-temperature incubator.

[0027] Example 5 Screening of candidate mutagenic strains Wild-type strains were inoculated in the center of each plate containing PDA solid medium, and six regenerated strains were evenly distributed around them. The plates were incubated at 25°C in the dark. During the incubation period, the regenerated strains that formed antagonistic lines with the wild-type Ganoderma lucidum strains were identified as potential mutagenized strains. A total of 26 potential mutagenized strains were obtained.

[0028] Wild-type bacterial colonies and bacterial colonies of 26 potential mutant strains of equal area were inoculated separately into plates containing PDA solid medium and placed in a BIO-300C Ⅲ low-temperature incubator with a carbon dioxide concentration of 4% (v / v) and a temperature of 25°C. Colony diameters were measured after 7 days of incubation. Figure 1 and Figure 2 As shown, Figure 1 Images of colonies of wild-type strains and potential mutant strains. Figure 2 A bar chart showing the colony diameters of wild-type and potential mutant strains was generated. The colony diameters of 26 potential mutant strains were compared. The colony diameter of the wild-type strain was 2.9 cm. The four strains with the highest colony diameters compared to the wild-type strain were selected as candidate mutant strains: candidate mutant strain 22, candidate mutant strain 1, candidate mutant strain 15, and candidate mutant strain 23, with colony diameters of 3.6 cm, 3.5 cm, 3.5 cm, and 3.5 cm, respectively, all significantly higher than those of the wild-type strain.

[0029] Example 6: Detection of the skin properties of candidate mutagenic strains The area of ​​the mycelium is 5cm² 2 Wild-type strains and four candidate mutagenic strains were inoculated into 500mL culture flasks containing 150mL of liquid seed culture medium, and cultured on a shaker at 25℃ and 150r / min for 4 days to obtain liquid inoculum. The liquid inoculum was then inoculated onto a solid-state fermentation medium and fermented to obtain mycelial sheets. The specific fermentation method was as follows: 1. Add water to the solid-state fermentation medium to adjust the moisture content to 65% wt, and use it as the fermentation substrate; 2. Dispense the above fermentation substrate into the culture box at 50% of the 2400mL culture box volume, and cover the culture box with the lid; 3. Place the culture boxes evenly into the sterilizer and sterilize at 121℃ for 90 minutes; 4. After sterilization, cool the incubator to room temperature in a clean room; 5. Inside the clean bench, open the lid and evenly spray the liquid inoculum containing 0.9g of dry mycelium of different strains (70mL for wild-type strains; 68mL for candidate mutant strains 22, 1, and 15, with the same biomass, with the remaining 2mL made up with sterile water; and 64mL for candidate mutant strain 23, with the remaining 6mL made up with sterile water) onto the substrate surface, then close the lid. 6. Place the incubation room in a constant temperature and humidity chamber and incubate for 15 days at 28-30℃ and RH 60%-70%. 7. After the cultivation cycle is completed, open the lid and separate and remove the mycelium skin on top of the substrate.

[0030] Cut 2.5cm×10cm mycelial pieces from the obtained mycelial skin and fix them on a tensile testing machine to test their tensile strength.

[0031] The results are as follows Figure 3 and Figure 4 It can be seen that, Figure 3 Bar chart showing the biomass of wild-type strains and candidate mutagenized strains. Figure 4 The bar chart shows the tensile strength of the wild-type strain and the candidate mutant strains. Under the same solid-state fermentation conditions, neither the wild-type strain nor the candidate mutant strains exhibited primordia. However, the mycelial biomass of all candidate mutant strains was higher than that of the wild-type strain, indicating that mutagenesis effectively improved the mycelial biomass production capacity of the strains. Among them, the biomass of candidate mutant strain 23 reached 138.7 g, which was 160.3% of the 86.5 g of the wild-type strain, showing the most significant improvement. The biomass of candidate mutant strains 1, 15, and 22 were 115.5 g, 98.4 g, and 95.8 g, respectively, which were 33.5%, 13.8%, and 10.8% higher than that of the wild-type strain. Meanwhile, the mycelial tensile strength of candidate mutant strain 23 was 3.36 MPa, which was 3.4% higher than the 3.25 MPa of the wild-type strain. Candidate mutant strain 23 was named Ganoderma lucidum. Ganoderma lingzhi MKLGE251213.

[0032] like Figure 5 As shown, Figure 5 Wild-type strains and Ganoderma lucidum Ganoderma lingzhi Image showing the culture results of strain MKLGE251213. Compared to the wild-type strain, Ganoderma lucidum... Ganoderma lingzhi The mycelium formed by strain MKLGE251213 differs significantly in macroscopic morphology from that of the wild-type strain. The wild-type strain has a relatively thin and uneven mycelium with irregular edges and visible local depressions or protrusions on the surface. In contrast, the mycelium of Ganoderma lucidum... Ganoderma lingzhiThe overall thickness of the mycelium of strain MKLGE251213 was significantly increased, and it was evenly distributed with complete and smooth edges.

[0033] The above results indicate that mutagenesis breeding can effectively increase the mycelial biomass of strains, and the degree of increase varies among different mutagenic strains. The biomass increase of candidate mutagenic strain 23 is the most significant, reaching 1.6 times that of the wild-type strain, indicating that this strain may have undergone beneficial mutations in carbon source utilization, mycelial growth, or metabolite accumulation.

[0034] Example 7 Ganoderma lucidum Ganoderma lingzhi Genetic stability test of strain MKLGE251213 Ganoderma lucidum Ganoderma lingzhi The MKLGE251213 strain was inoculated onto slant agar containing PDA solid medium and passaged 10 times consecutively. A mycelial skin preparation experiment was conducted every two generations using solid culture, and the biomass and tensile strength of the mycelial skin were measured. The results are shown in Table 1. Table 1 shows the results of Ganoderma lucidum... Ganoderma lingzhi Data on the mycelial coating of strain MKLGE251213 at different passage numbers. Ganoderma lingzhi During 10 consecutive passages, the biomass and tensile strength of strain MKLGE251213 remained highly stable. From generation 1 to generation 10, the biomass fluctuated slightly between 138.4 g and 139.2 g, with the first generation at 138.7 g and the tenth generation at 138.4 g, showing no overall increasing or decreasing trend. The tensile strength fluctuated between 3.35 MPa and 3.40 MPa, with the first generation at 3.36 MPa and the tenth generation at 3.35 MPa; all measured values ​​were essentially consistent with the initial levels. This indicates that Ganoderma lucidum... Ganoderma lingzhi After 10 slant passages, the high mycelial biomass production and the ability to maintain tensile strength of strain MKLGE251213 did not show significant decline or variation. Table 1 Ganoderma lucidum Ganoderma lingzhi Skin detection data of strain MKLGE251213 at different passage numbers Generation 1 <![CDATA[138.7±0.9 a ]]> <![CDATA[3.36±0.03 a ]]> 3rd generation <![CDATA[138.5±0.5 a ]]> <![CDATA[3.38±0.02 a ]]> 5th generation <![CDATA[139.2±1.1 a ]]> <![CDATA[3.36±0.02 a ]]> 7th generation <![CDATA[139.0±0.8 a ]]> <![CDATA[3.40±0.03 a ]]> 10th generation <![CDATA[138.4±0.7 a ]]> <![CDATA[3.35±0.01 a ]]> Note: a: The analysis was performed using Duncan's multiple range test in the analysis of variance. Different letters in the same column indicate significant differences (p≤0.05, n=3).

[0035] In summary, this invention successfully obtained a high-yielding and genetically stable mutant strain of Ganoderma lucidum through protoplast preparation, ultraviolet mutagenesis and domestication, antagonistic screening, and colony diameter comparison. Ganoderma lingzhiMKLGE251213. Experimental results showed that the mycelial biomass of this strain under solid-state fermentation conditions reached 138.7 g, which was 160.3% of that of the wild-type strain. The tensile strength was 3.36 MPa, approximately 3.4% higher than that of the wild-type strain. Furthermore, the mycelial biomass was thicker, more uniform, and had smoother edges. Genetic stability tests after 10 consecutive subcultures showed that the *Ganoderma lucidum*... Ganoderma lingzhi The biomass of strain MKLGE251213 remained stable between 138.4 and 139.2 g, and its tensile strength remained stable between 3.35 and 3.40 MPa, without significant decline or variation, indicating that its high-yield and good mechanical properties can be stably inherited. This strain significantly improved the biomass of the mycelium bark while maintaining mechanical properties, and also improved its thickness and uniformity, demonstrating good potential for industrial application and large-scale production in fields such as bio-based materials, packaging films, leather substitutes, and biodegradable materials.

[0036] The relevant sequences used in this invention are as follows: SEQ ID NO:1 (nucleotide sequence of the internal transcribed spacer region) GGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGATTGCGAGGCACGCTCTTTACCGGGCTTGCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGT GTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTG CGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGT TCCTTGCGGATCGGCTCTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCGTTTGGCGAGCTTCTAACCGTCTTATAAGACAGCTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT The technical solution of the present invention has been described above with reference to the preferred embodiments shown in the accompanying drawings. However, it will be readily understood by those skilled in the art that the scope of protection of the present invention is obviously not limited to these specific embodiments. Without departing from the principles of the present invention, those skilled in the art can make equivalent changes or substitutions to the relevant technical features, and the technical solutions after these changes or substitutions will all fall within the scope of protection of the present invention.

Claims

1. A high carbon dioxide-resistant Ganoderma lucidum mutant strain, characterized in that, The mutant strain was obtained by using Ganoderma lucidum as the starting strain, and through ultraviolet mutagenesis and high-concentration carbon dioxide domestication; the mutant strain was named Ganoderma lucidum (Ganoderma lucidum). Ganoderma lingzhi MKLGE251213; Depository Institution: China General Microbiological Culture Collection Center (CGMCC); Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit Date: March 11, 2026; Deposit Number: CGMCC No. 42591.

2. The application of the high carbon dioxide-resistant Ganoderma lucidum mutant strain according to claim 1, characterized in that, The mutant strain was used to prepare mycelial coating.

3. The application of the high carbon dioxide-resistant Ganoderma lucidum mutagenesis strain according to claim 2, characterized in that, The specific method for preparing the mycelium skin includes the following steps: The mutant strain was inoculated into liquid culture medium and cultured on a shaker for 4 days to obtain a liquid bacterial strain; The liquid bacterial culture was sprayed onto the surface of a solid fermentation medium and cultured at a constant temperature and humidity for 15 days under conditions of 4% carbon dioxide concentration to obtain the bacterial skin.

Images