Wheat dwarf virus effector protein gene g2947 and the encoded protein and application thereof

Abstract

This invention discloses a *Ustilago maydis* effector protein gene g2947, its encoded protein, and its applications, belonging to the fields of agricultural biotechnology and plant pathology. The nucleotide sequence of the *Ustilago maydis* effector protein gene is shown in SEQ ID NO:1, and the amino acid sequence of its encoded protein is shown in SEQ ID NO:2. This invention verified through a tobacco transient overexpression system that this effector protein can effectively inhibit BAX protein-induced programmed cell death (PCD), indicating its important role in suppressing plant defense responses. This invention provides important genetic resources and theoretical basis for in-depth research on the pathogenic mechanism of *Ustilago maydis* and the development of wheat varieties resistant to wheat smut.

Description

Technical Field

[0001] This invention relates to the fields of agricultural biotechnology and plant pathology, specifically to a wheat dwarf smut fungus (… Tilletia controversa Kuhn (TCK) effector protein genes, particularly involving an effector protein gene of a wheat dwarf smut fungus. g2947 The application of its encoded proteins in inhibiting plant defense responses. Background Technology

[0002] Ustilago tritici ( Tilletia controversa Kuhn (TCK) can cause wheat dwarf smut, one of the most damaging and difficult-to-control quarantine diseases among wheat smuts. This disease can cause wheat yield losses exceeding 80%, and the trimethylamine released by the teliospores produces a foul, rotten, fishy odor, reduces flour quality, and can cause poisoning in humans and animals. This pathogen poses a risk of introduction, colonization, and spread in my country.

[0003] However, there are currently no detailed reports on its infection mechanism, either domestically or internationally, and a lack of theoretical basis for developing resistant varieties and controlling this disease. Effector proteins are key factors in pathogen infection of the host; elucidating the function of these effector proteins helps in understanding the interaction mechanism between pathogens and plants. Therefore, identifying key effector protein genes of *Ustilago maydis* is of great significance for developing effective disease control measures and breeding resistant varieties. Summary of the Invention

[0004] The present invention aims to provide a wheat smut effector protein gene to address the lack of existing technologies regarding the infection mechanism and key effector proteins of this pathogen, and to provide genetic resources for the development of wheat varieties resistant to wheat smut.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: Overexpression of wheat smut effector protein gene g2947 Application of the gene in inhibiting BAX protein-induced necrosis of tobacco leaf tissue. g2947 Inhibits BAX protein-induced programmed cell death in tobacco plants; the gene g2947 The nucleotide sequence is shown in SEQ ID NO:1.

[0006] Furthermore, the gene g2947 The amino acid sequence of the encoded protein is shown in SEQ ID NO:2.

[0007] This invention also provides an overexpression gene of wheat dwarf smut effector protein. g2947The application of related biomaterials in inhibiting BAX protein-induced necrosis of tobacco leaf tissue, wherein the biomaterials inhibit BAX protein-induced programmed cell death in tobacco plants; wherein the biomaterials are any one of A1) to A3) below: A1) An expression cassette containing a nucleic acid molecule with the sequence shown in SEQ ID NO:1; A2) A recombinant vector containing a nucleic acid molecule with the sequence shown in SEQ ID NO:1; A3) A recombinant microorganism containing a nucleic acid molecule with the sequence shown in SEQ ID NO:1, or a recombinant microorganism containing the expression cassette described in A1), or a recombinant microorganism containing the recombinant vector described in A2), wherein the microorganism is Agrobacterium; The gene g2947 The nucleotide sequence of the gene is shown in SEQ ID NO:1. g2947 The amino acid sequence of the encoded protein is shown in SEQ ID NO:2.

[0008] This invention also provides a method for inhibiting BAX protein-induced tissue necrosis in tobacco leaves, wherein the method involves overexpressing the wheat dwarf smut effector protein gene in tobacco. g2947 The gene g2947 Inhibits BAX protein-induced programmed cell death in tobacco plants; the gene g2947 The nucleotide sequence of the gene is shown in SEQ ID NO:1. g2947 The amino acid sequence of the encoded protein is shown in SEQ ID NO:2.

[0009] Furthermore, the overexpression of the wheat dwarf smut effector protein gene in tobacco... g2947 To introduce a recombinant expression vector containing the nucleotide sequence shown in SEQ ID NO:1 into Agrobacterium and then into tobacco.

[0010] Furthermore, the recombinant expression vector is constructed through the following steps: (1) Using cDNA synthesized by reverse transcription of total RNA extracted from wheat smut fungus as a template, primers were used... g2947 F1 and g2947 R1 was used for PCR amplification to obtain g2947 Gene fragment; the primer g2947 The nucleotide sequence of F1 is shown in SEQ ID NO:3, and the primers are as follows. g2947 The nucleotide sequence of R1 is shown in SEQ ID NO:4; (2) Using restriction endonucleases Cla I and Sal IThe pGR107 vector was double-digested, and the linearized pGR107 vector fragment was recovered. (3) Take the steps from (1) g2947 The gene fragment was ligated with the linearized pGR107 vector fragment from step (2), transformed into competent E. coli cells, and positive clones were obtained after screening and sequencing verification, thus obtaining the recombinant expression vector pGR107- g2947 .

[0011] Further, in step (1), the PCR reaction system is: 25 μL of 2× Phanta® Flash Master Mix, 2 μL each of 10 μM upstream and downstream primers, 0.5 μg of cDNA template, and ddH2O added to 50 μL.

[0012] Further, in step (1), the PCR reaction program is as follows: 95℃ for 5 min; 95℃ for 1 min, 57℃ for 1 min, 72℃ for 2 min, 35 cycles; 72℃ for 10 min.

[0013] Furthermore, the Agrobacterium is Agrobacterium tumefaciens GV3101. Beneficial effects

[0014] The effector protein gene (g2947) isolated by *Ustilago maydis* in this invention has been verified to effectively inhibit BAX-induced programmed cell death (PCD). This indicates that the effector protein plays an important role in suppressing plant defense responses. This invention provides important genetic resources and theoretical basis for in-depth research on the pathogenic mechanism of *Ustilago maydis* and the development of wheat varieties resistant to wheat smut. Attached Figure Description

[0015] Figure 1 The image shows the agarose gel electrophoresis results of the PCR amplification product of the g2947 gene of wheat dwarf smut.

[0016] Figure 2Figure A shows the phenotypic results of transient overexpression of the *Triticum aestivum* g2947 gene in tobacco leaves; Figure B: Schematic diagram of tobacco leaf injection; gene represents *Agrobacterium* bacterial suspension containing the g2947 gene, eGFP represents *Agrobacterium* bacterial suspension containing the eGFP gene, Buffer represents tobacco injection solution (blank control), gene+BAX represents an equal volume mixture of *Agrobacterium* bacterial suspension containing the g2947 gene and *Agrobacterium* bacterial suspension containing the BAX gene, eGFP+BAX represents an equal volume mixture of *Agrobacterium* bacterial suspension containing the eGFP gene and *Agrobacterium* bacterial suspension containing the BAX gene, Buffer+BAX represents an equal volume mixture of Buffer and *Agrobacterium* bacterial suspension containing the BAX gene; Figure C: Symptoms of tobacco leaves after injection; Figure D: Symptoms of tobacco leaves after trypan blue staining and decolorization.

[0017] Figure 3 This image shows the subcellular localization of the effector protein of wheat smut bacterium g2947. Detailed Implementation

[0018] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments.

[0019] Biomaterials and Carriers: Tilletia controversa Kuhn (TCK): The Tilletia controversa Kuhn strain used in the following examples is from the literature Xu TS, Qin DD, Muhae Ud Din G, Liu TG, Chen W, Gao L. Characterization of histological changes at the tillering stage (Z21) inresistant and susceptible wheat plants infected by Tilletia controversa Kühn. BMC Plant Biol, 2021, 18; 21(1): 49. This strain is available to the public from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0020] Escherichia coli Trans2-Blue competent cells: purchased from Beijing TransGen Biotech Co., Ltd.

[0021] Agrobacterium GV3101 (pJIC SA-Rep) competent cells: purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0022] The tobacco used in the following examples is Nicotiana benthamiana, which was provided by our laboratory.

[0023] The pGR107 vector used in the following examples is the potato X virus vector pGR107, which is commercially available (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number ZK2116). The potato X virus vector pGR107 is a binary expression vector containing the CaMV 35S promoter and the kanamycin resistance gene. The GenBank accession number for the vector sequence is AY297842.1, and its full length is 438 bp.

[0024] PBin-GFP vector: a commercially available vector.

[0025] Main reagents and solutions: Universal DNA purification and recovery kits and plasmid mini-prep kits were purchased from Beijing Tiangen Biotech Co., Ltd. 2× Pro Taq Master Mix (dye plus) was purchased from Hunan Aikerui Biotechnology Co., Ltd. High-fidelity enzyme 2× Phanta® Flash Master Mix (dye plus) and ClonExpress® Ultra One Step Cloning Kit were purchased from Nanjing Novizan Biotechnology Co., Ltd. Penicillin-streptomycin bispecific antibody was purchased from Gibco, catalog number: 15140-122.

[0026] (1) 0.25% NaClO: 250μL NaClO to 100mL.

[0027] (2) 50× TAE Buffer: Dissolve 242g Tris and 37.2g EDTA-Na2·2H2O in 600mL of deionized water. Add 57.1mL of glacial acetic acid (anhydrous acetic acid) to the dissolved liquid and bring the volume up to 1L. Adjust the pH to 8.5 with NaOH.

[0028] (3) 2% soil extract culture medium: The soil used must first be sterilized in an autoclave at 60℃~100℃ for 30~60min. Take 75g of soil and filter it through 8 layers of gauze with 500mL of boiled distilled water, make up to 1000mL, and sterilize at 120℃ for 20min. (20g of agar needs to be added to the solid culture medium) (4) LB medium: Weigh 3g sodium chloride, 1.5g yeast extract, and 3g tryptone, bring the volume to 300mL, and sterilize at 120℃ for 20min. (For solid medium, add 4.5g agar powder) (5) Kanamycin antibiotic (50mg / ml): Weigh 2.5g of kanamycin and place it in a 50mL centrifuge tube. First, add 40mL of sterile distilled water, mix and dissolve thoroughly, and then bring the volume to 50mL. Filter with a 0.22μm filter membrane to sterilize, aliquot and store at -20℃.

[0029] (6) Rifampicin antibiotic (20mg / mL): Weigh 0.2g of rifampicin into a 50mL centrifuge tube, add 10mL of DMSO (dimethyl sulfoxide), filter to sterilize, and then dispense into aliquots. Store at -20℃.

[0030] (7) Tobacco injection (Buffer): Take 5 mL of 1 M MgCl2 stock solution, 5 mL of 1 M MES stock solution, and 0.5 mL of 0.2 M AS (acetylsyl syringone) stock solution, add sterile water to make up to 500 mL, mix well and set aside.

[0031] (8) Trypan blue staining solution: 10 mL lactic acid, 10 mL glycerol, 10 mL phenol, 10 mg trypan blue, 10 mL deionized water. First, completely dissolve the trypan blue in deionized water, then add it to the other solutions and mix well. Store at 4°C.

[0032] (9) Trypan blue decolorizing solution: 250g of hydrated trichloroacetaldehyde, diluted to 100mL with deionized water, shaken at low speed at 37℃ or at 65℃ until completely dissolved.

[0033] PCR primers: Table 1 Primers required for vector construction g2947F1 TCAGCACCAGCTAGCATCGATATGACTGCCGTCCAGAACGAG (SEQ ID NO:3) g2947R1 AACCGTTCATCGGCGGTCGACTTACTTCTTGTTGGAGTAGCATTGTC (SEQ ID NO:4) pGR107F ATAGCAGTCATAGCACTTCCT (SEQ ID NO:5) pGR107R GTTAGCAGGTGGACTGTTGTTA (SEQ ID NO:6) g2947F2 ATTTACGAACGATAGGGTACCATGACTGCCGTCCAGAACGAG (SEQ ID NO:7) g2947R2 GCCCTTGCTCACCATGGATCCCTTCTTGTTGGAGTAGCATTGT (SEQ ID NO:8) pBin107F ACAATCCCACTATCCTTCGC (SEQ ID NO:9) pBin107R AAGTCGTGCTGCTTCATGT (SEQ ID NO:10) Main instruments: PCR instrument, manufactured by Thermo Fisher Scientific, USA. Centrifuge and pipettes, manufactured by eppendrof Life Sciences, Germany. 50ml centrifuge, manufactured by Sigma, Germany. Electrophoresis apparatus, manufactured by Bio-Rad, USA. Autoclave, manufactured by Zealway, USA. GHB-202 thermostatic metal bath, manufactured by Hangzhou Borui Technology Co., Ltd. Thermostatic water bath, manufactured by Shanghai ZJ Biotech Co., Ltd. 85-2 digital display thermostatic magnetic stirrer, manufactured by Ronghua Instrument Manufacturing Co., Ltd., Jintan City, Jiangsu Province. Large-capacity full-temperature shaker, manufactured by Suzhou Peiying Experimental Equipment Co., Ltd. Clean bench, manufactured by Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd. Confocal laser microscope (Zeiss 980).

[0034] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art, and are of laboratory purity. Unless otherwise specified, the experimental methods and conditions used in the following examples are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0035] Example 1: Cloning and functional verification of the g2947 gene from wheat dwarf smut. 1. Cultivation of wheat dwarf smut (1) Take 5-6 wheat dwarf smut galls and put them into a 2mL centrifuge tube. Add 2mL of sterile distilled water and let stand at room temperature for 30min. (2) Use tweezers to peel off the seed coat and pick out the small grains. Filter the impurities through 150-mesh gauze and then centrifuge. (3) Centrifuge at 6000 rpm for 1 min, discard the supernatant, add 2 mL of 0.25% NaClO for 10 min to sterilize; (4) Centrifuge at 6000 rpm for 1 min, discard the supernatant, and add sterile distilled water; (5) Repeat steps (3) and (4) above twice; (6) Using an optical microscope and a hemocytometer, the concentration of wheat smut teliospores was adjusted to the order of magnitude of 1×10⁻⁶ after dilution treatment. 6 cells / mL; (7) Add Gibco (1% by volume) to the 2% soil extract culture medium, pour the plates, and spread 220 μL of teliospore suspension in each petri dish. Place the plates in an artificial incubator at 5℃, 1Lx and 50% relative humidity under full light for about 45 days. Then observe the germination status of teliospores under an optical microscope. Collect the teliospores after they have grown to the stage of infecting mycelia for the extraction of RNA from wheat smut.

[0036] 2. Extraction of RNA and synthesis of cDNA from *Ustilago maydis* (wheat smut). RNA was extracted from the mycelial hyphae of *Ustilago maydis* using the Trizol method. The specific steps are as follows: (1) Collect the germinating mycelium of wheat dwarf smut, place it in an RNase-free 2mL spiral tube, and quickly place it in liquid nitrogen. Use a high-throughput rapid sample preparation instrument to grind the sample into powder. (2) Add 1 mL (the amount can be adjusted according to the sample amount) of TRIzol reagent (Invitrogen) to the well-ground mycelial powder, shake gently to mix well and let it stand at room temperature for 5-10 min; (3) Add chloroform to the liquid that has been lysed with TRIzol reagent at a ratio of 0.2 mL chloroform per 1 mL TRIzol reagent, shake vigorously for 15 s, extract, let stand at room temperature for 3 min, and centrifuge at 12000 rpm for 15 min at 4℃. (4) After centrifugation, the supernatant was transferred to a new 1.5 mL RNase-Free centrifuge tube, and an equal volume of isopropanol was added for sedimentation. After mixing, the mixture was placed on ice for 10 min, and then centrifuged at 12000 rpm for 15 min at 4 °C. (5) Discard the supernatant, add 1 mL of 75% ethanol (prepared with anhydrous ethanol and RNase-free water), mix by inversion, centrifuge at 4°C and 12000 rpm for 5 min to remove residual liquid as much as possible. (6) Repeat the previous step, and then dry in the clean bench for 5 to 10 minutes until the precipitate becomes transparent; (7) Add an appropriate amount of RNase-free water to dissolve the RNA, store it in a -80℃ refrigerator for later use.

[0037] The total RNA obtained was used to synthesize first-strand cDNA using the TaKaRa RNA Reverse Transcription Kit (catalog number: RR047A) according to the kit instructions, and the cDNA samples were used as gene cloning templates. The resulting cDNA samples were stored at -20°C.

[0038] 3. Cloning of the target gene Based on transcriptome data from *Ustilago maydis*, we discovered an effector protein gene, named g2947. The nucleotide sequence of the open reading frame (ORF) of the g2947 gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:2.

[0039] The N-terminal signal peptide sequence of the effector protein encoded by the g2947 gene was predicted using the online analysis software SignalP 5.0. The gene sequence encoding the signal peptide was then removed, and primers g2947F1 and g2947R1 were designed (primer sequences are shown in Table 1). Primer synthesis was commissioned to Beijing Qingke Biotechnology Co., Ltd. Using reverse-transcribed cDNA of *Ustilago maydis* as a template, the target gene fragment was amplified by PCR using the synthesized primers. The PCR reaction system is shown in Table 2.

[0040] Table 2 PCR reaction system for the target gene g2947F1 (10μM) 2μL g2947R1 (10μM) 2μL cDNA template 0.5μg <![CDATA[2×Phanta ® Flash Master Mix]]> 25μL <![CDATA[ddH2O]]> Up to 50 μL The PCR reaction program was as follows: 95℃ for 5 min; 95℃ for 1 min, 57℃ for 1 min, 72℃ for 2 min, 35 cycles; 72℃ for 10 min. The PCR products were detected by 1.0% agarose gel electrophoresis (150V, 30 min), and the results are as follows. Figure 1 As shown, the product size is correct. The target band was excised from the gel and recovered using a universal DNA purification and recovery kit (Tiangen Biotech, catalog number: DP214-03) according to the kit instructions. The recovered product was stored at -20°C.

[0041] 4. Enzyme digestion of the vector 10 µL of *E. coli* culture containing the pGR107 vector was placed in 10 mL of LB broth containing kanamycin (50 mg / mL) and incubated at 37 °C with a shaker at 200 rpm for 8–10 h. Plasmid extraction was then performed according to the instructions of the rapid plasmid miniprep kit (Tiangen Biotech, catalog number: DP105-03). Based on the vector and gene sequence, the pGR107 plasmid was double-digested using Cla I enzyme (Thermo Fisher Scientific, catalog number: FD0144) and Sal I enzyme (Thermo Fisher Scientific, catalog number: FD0644). The digestion reaction system is shown in Table 3.

[0042] Table 3. Cla I and Sal I double enzyme digestion reaction system pGR107 plasmid 5µL (concentration greater than 200ng / µL) 10×Buffer 2µL Cla I 1µL Sal I 1µL <![CDATA[ddH2O]]> Up to 20µL The prepared enzyme digestion reaction system was placed in a 37°C metal bath for 1 hour. After the reaction, the digestion products were detected by 1.0% agarose gel electrophoresis. The target band was cut off with a sterile blade and recovered using a universal DNA purification and recovery kit (Tiangen Biotech, DP214-03), following the kit instructions. The recovered product was stored at -20°C.

[0043] 5. Ligation of the target gene and the vector (1) The purified linear vector and the target gene fragment were ligated using the Vazyme ClonExpress® Ultra One Step Cloning Kit.

[0044] (2) The recombinant connection system is shown in Table 4.

[0045] Table 4. Ligation reaction system of plasmid pGR107 and target gene Linearization of pGR107 plasmid 1µL Target gene fragment 3µL 2×ClonExpress Mix 5µL <![CDATA[ddH2O]]> Up to 10µL (3) After gently mixing the prepared system, place it in a 50°C metal bath for 10 minutes, and then place it on ice for 2 minutes.

[0046] (4) Immediately transfer 5-10 µL of recombinant plasmid into 100 µL of Escherichia coli Trans2-Blue competent cells in a molten state and incubate on ice for 30 min.

[0047] (5) Heat shock in a water bath at 42°C for 45 seconds, then place on ice for 2-3 minutes.

[0048] (6) Add 800µL of antibiotic-free liquid LB medium to the clean bench.

[0049] (7) Shake the bacteria at 37℃ and 200rpm for 1 hour. Use a sterile glass rod to spread the bacterial solution evenly on an LB solid plate containing kanamycin (50mg / ml). Incubate in an inverted position in a 37℃ incubator overnight.

[0050] (8) Select 6-8 single clones for bacterial culture PCR verification. The PCR primers are pGR107F and pGR107R (primer sequences are shown in Table 1). The PCR reaction system is shown in Table 5.

[0051] Table 5. Bacterial PCR Reaction System pGR107F (10μM) 1μL pGR107R (10μM) 1μL Bacterial template 2μL 2× Pro Taq Master Mix 12.5μL <![CDATA[ddH2O]]> Up to 25μL The PCR reaction program was as follows: 95℃ for 5 min; 95℃ for 1 min, 57℃ for 1 min, 72℃ for 2 min, 35 cycles; 72℃ for 10 min. The amplified products were sequenced and verified by Beijing Qingke Biotechnology Co., Ltd.

[0052] 6. Transformation of Agrobacterium competent cells The positive colonies that were correctly sequenced in the previous step were subjected to plasmid extraction using a rapid plasmid miniprep kit (Tiangen Biotech, catalog number: DP105-03). The extracted recombinant plasmid pGR107-g2947 was then introduced into Agrobacterium GV3101 (pJIC SA-Rep) competent cells. The Agrobacterium transformation method is as follows: (1) Take out the competent Agrobacterium cells stored at -80℃, let them thaw at room temperature or in your palm for a period of time, and insert them into ice when they are in a state of ice-water mixture.

[0053] (2) Then add the extracted plasmid to the competent cells. Add 0.01 to 1 µg of plasmid to every 100 µL of competent cells. After adding, gently tap the bottom of the tube to mix.

[0054] (3) Place it on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, and ice bath for 5 minutes in sequence.

[0055] (4) Add 700µL of LB liquid medium without resistance to the competent cells and culture them in a shaker at 200rpm at 28℃ for 2-3 hours; (5) Centrifuge the shaken bacterial solution at 6000 rpm for 1 min to collect the bacterial cells. Resuspend the bacterial cells in about 100 µL of supernatant and spread the bacterial solution on an LB solid plate containing rifampicin (25 mg / ml) and kanamycin (50 mg / ml) using a sterile glass rod.

[0056] (6) Invert the plate and incubate it in a 28°C incubator for 2-3 days. When a single colony grows on the plate, pick 8 single colonies for bacterial PCR verification. The PCR reaction system and reaction procedure are the same as above.

[0057] (7) Pick the PCR-verified colonies into 10 mL of liquid LB medium containing rifampicin (25 mg / ml) and kanamycin (50 mg / ml), and incubate at 28°C and 200 rpm for 2 days. Store the bacterial solution for later use.

[0058] 7. Transient overexpression of genes in tobacco The BAX gene (Gengbank accession number: L22472.1) is a member of the Bcl-2 family of apoptosis genes. The protein expressed by this gene induces apoptosis, similar to the hypersensitive necrosis response mechanism in pathogen-plant interactions. The eGFP gene (Gengbank accession number: EU746493.1) is an enhanced green fluorescent protein gene that fluoresces under blue light excitation. Agrobacterium GV3101 containing the BAX gene expression vector (PGR107-BAX) and Agrobacterium GV3101 containing the eGFP gene expression vector (PGR107-eGFP) were strains prepared and preserved in our laboratory. The PGR107-BAX vector was constructed as follows: the PGR107 vector and the BAX gene fragment were double-digested with Sal I and Cla I restriction endonucleases, respectively, and then the BAX gene fragment was inserted into the PGR107 vector via a ligation reaction. The PGR107-eGFP vector was constructed as follows: the PGR107 vector and the eGFP gene fragment were double-digested with SalI and ClaI restriction endonucleases, respectively, and then the eGFP gene fragment was inserted into the PGR107 vector through a ligation reaction.

[0059] The method for transient overexpression of genes in tobacco is as follows: (1) Agrobacterium containing the g2947 gene expression vector, Agrobacterium containing the eGFP gene expression vector, and Agrobacterium containing the BAX gene expression vector were inoculated into 10 mL of LB liquid medium containing rifampicin (25 mg / mL) and kanamycin (50 mg / mL), respectively, and cultured by shaking at 28 °C and 200 rpm for 2 days.

[0060] (2) Collect bacterial cells by centrifugation at 5000 rpm for 10 min and resuspend the cells in Buffer (Tobacco Injection) (10 mmol / L MES, 200 μmol / L AS, 10 mmol / L MgCl2).

[0061] (3) Repeat the above steps, wash three times, and then activate in a dark environment at 28°C for 3 hours. Adjust the volume with an appropriate amount of tobacco injection solution to OD600 = 0.3-0.5.

[0062] (4) Using a 1 mL sterile syringe with the needle removed, draw an appropriate amount of the bacterial suspension. Infiltrate *Agrobacterium* onto tobacco leaves that are 4–6 weeks old and in good growth condition. Inject the bacterial suspension onto the underside of the tobacco leaves using the infiltration method. Use the 6-zone injection method, following the... Figure 2 As shown in Figure A, the injection method involved injecting Agrobacterium-containing bacterial suspension (containing the g2947 gene), Agrobacterium-containing bacterial suspension (containing the eGFP gene), and Buffer (tobacco injection solution) into the left side of the tobacco leaf from top to bottom, and marking the injection areas. Each tobacco leaf had six injection areas, with the Buffer in the lower left corner serving as a blank control. Three to five leaves were injected per tobacco plant. Each sample was repeated three times.

[0063] (5) 24 hours after vaccination, follow the instructions. Figure 2 As shown in Figure A, injection methods were performed on the right side of the tobacco leaf (to the right of the area marked in the previous step), from top to bottom: gene+BAX (a mixture of equal volumes of Agrobacterium-containing solutions of the g2947 gene and Agrobacterium-containing solutions of the BAX gene), eGFP+BAX (a mixture of equal volumes of Agrobacterium-containing solutions of the eGFP gene and Agrobacterium-containing solutions of the BAX gene), and Buffer+BAX (a mixture of equal volumes of buffer and Agrobacterium-containing solutions of the BAX gene). Here, gene represents the g2947 gene. The tobacco leaves were then incubated at 25°C for 3–8 days. The phenotype of necrosis in the injected areas was observed, data were recorded, and photographs were taken.

[0064] (6) Mix trypan blue staining solution with anhydrous ethanol at a volume ratio of 1:1. Place the tobacco leaves showing symptoms into the mixed staining solution, boil them in boiling water for 5 minutes, stain them overnight, and then place the leaves into a decolorizing solution for decolorization. Take a picture after decolorization is completed.

[0065] The results are as follows Figure 2 B (symptom diagram of tobacco leaves after injection) and Figure 2Figure C (symptoms of tobacco leaves after trypan blue staining and decolorization) shows the following: In the left injection area of ​​the tobacco leaf: no cell necrosis was observed at the sites where Buffer was injected alone (blank control), eGFP was injected alone, or the g2947 gene was injected alone. In the right injection area: the Buffer+BAX injection site and the eGFP+BAX injection site both showed symptoms of leaf tissue drying and necrosis. However, after injection of Agrobacterium tumefaciens gene + BAX, no tissue necrosis was observed in the corresponding tobacco parts. These phenotypic symptoms indicate that BAX can successfully induce an allergic necrosis response in tobacco cells; the absence of cell necrosis at the site where the g2947 gene was injected alone indicates that the effector protein overexpressed by the g2947 gene cannot induce an allergic necrosis response in tobacco; and the absence of tissue necrosis at the site where g2947+BAX was injected indicates that the g2947 gene can effectively inhibit BAX-induced programmed cell death (PCD). Therefore, the effector protein overexpressed by the g2947 gene plays an important role in suppressing plant defense responses.

[0066] Example 2: Subcellular localization of the effector protein gene of wheat smut g2947

[0067] 1. Cloning of the target gene Using wheat smut cDNA as a template, PCR amplification was performed using primers gg2947F2 and gg2947R2 (primer sequences are shown in Table 1). The PCR reaction system and procedure were the same as in Example 1 (cloning of the target gene).

[0068] 2. Enzyme digestion of the vector First, the *E. coli* culture containing the pBin-GFP vector was amplified. Then, plasmid extraction was performed using a rapid plasmid miniprep kit (Tiangen Biotech, catalog number: DP105-03) according to the kit instructions. Based on the vector and gene sequence, the pBin-GFP plasmid was double-digested using Kpn I enzyme (Thermo Fisher Scientific, catalog number: FD0524) and BamH I enzyme (Thermo Fisher Scientific, catalog number: FD0054). The digestion system is shown in Table 6.

[0069] Table 6 Kpn I and BamH I double enzyme digestion reaction system pBin-GFP plasmid 5µL (concentration greater than 200ng / µL) 10×Buffer 2µL I enzyme 1µL I enzyme 1µL <![CDATA[ddH2O]]> Up to 20µL The prepared enzyme digestion reaction system was placed in a 37°C metal bath for 1 hour. After the reaction, the enzyme digestion products were detected by 1.0% agarose gel electrophoresis. The target band was cut off with a sterile blade and recovered using a universal DNA purification and recovery kit (Tiangen Biotech, catalog number: DP214-03).

[0070] 3. Ligation of the target gene and the vector (1) The purified linear vector and the target gene fragment were ligated using the Vazyme ClonExpress® Ultra One Step Cloning Kit.

[0071] (2) The recombinant connection system is shown in Table 7.

[0072] Table 7 Linearized pBin-GFP plasmid 1µL Target gene fragment 3µL 2×ClonExpress Mix 5µL <![CDATA[ddH2O]]> Up to 10µL Linearized pBin-GFP plasmid 1µL (3) After gently mixing the prepared system, place it in a 50°C metal bath for 10 minutes, and then place it on ice for 2 minutes.

[0073] (4) Immediately transfer 5-10 µL of recombinant plasmid into 100 µL of Escherichia coli Trans2-Blue competent cells in a molten state and incubate on ice for 30 min.

[0074] (5) Heat shock in a water bath at 42°C for 45 seconds, then place on ice for 2-3 minutes.

[0075] (6) Add 800µL of antibiotic-free liquid LB medium to the clean bench.

[0076] (7) Shake the bacteria at 37℃ and 200rpm for 1 hour. Use a sterile glass rod to spread the bacterial solution evenly on an LB solid plate containing kanamycin (50mg / ml). Incubate in an inverted position in a 37℃ incubator overnight.

[0077] (8) Select 6-8 single clones for bacterial culture PCR verification. The PCR primers are pBin107F and pBin107R (primer sequences are shown in Table 1). The PCR reaction system is shown in Table 8.

[0078] Table 8 pBin107F (10μM) 1μL pBin107R (10μM) 1μL bacterial solution 2μL 2× Pro Taq Master Mix 12.5μL <![CDATA[ddH2O]]> Up to 25μL The PCR reaction program was as follows: 95℃ for 5 min; 95℃ for 1 min, 57℃ for 1 min, 72℃ for 2 min, 35 cycles; 72℃ for 10 min. The amplified products were sequenced and verified by Beijing Qingke Biotechnology Co., Ltd.

[0079] 4. Transformation of Agrobacterium competent cells The positive colonies that were correctly sequenced in the previous step were subjected to plasmid extraction using a rapid plasmid miniprep kit (Tiangen Biotech, catalog number: DP105-03) according to the kit instructions. The extracted recombinant plasmid pBin-gg2947 was then transformed into Agrobacterium GV3101 (pJIC SA-Rep) competent cells. The Agrobacterium transformation method was the same as in Example 1 (Transformation of Agrobacterium competent cells).

[0080] 5. Transient overexpression of genes in tobacco Successfully transformed Agrobacterium colonies were placed in 10 mL of LB broth containing rifampin and kanamycin (Kan: 50 μg / mL; Rif: 25 μg / mL) for shake culture and propagation. The cells were cultured at 28°C with shaking until OD600 = 1.0–2.0, then centrifuged at 5000 rpm for 5 min to collect the cells. The cells were resuspended in an equal volume of tobacco injection buffer (10 mmol / L MES, 200 μmol / L AS, 10 mmol / L MgCl2), and this process was repeated three times. The volume was then adjusted to OD600 = 0.5, and the bacterial solution was activated at 28°C in the dark for 2–3 h. Four-week-old, well-grown *Nicotiana benthamiana* seedlings were selected, and the activated Agrobacterium solution was injected into the underside of the tobacco plants using a 1 mL syringe (without the needle). After injection, the plants were cultured for another 2–3 days. Leaf tissue was then harvested, and sections were prepared with the underside of the leaves facing upwards. The fluorescence expression and localization information of the leaves were observed using a confocal laser microscope. This study used EGFP tags, with an excitation wavelength range of 488 nm and an image acquisition wavelength range of 515-540 nm. The expression of EGFP was observed using 488 nm excitation light, and the images were saved.

[0081] The results are as follows Figure 3 As shown, under confocal laser microscopy, the fluorescent expression of the g2947 effector protein was observed on the cell membrane. It is speculated that this effector protein acts on the cell membrane and exerts its function on the cell.

Claims

1. The application of overexpression of the wheat smut effector protein gene g2947 in inhibiting BAX protein-induced necrosis of tobacco leaf tissue, characterized in that, The gene g2947 inhibits programmed cell death in tobacco plants induced by BAX protein; the nucleotide sequence of the gene g2947 is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the gene g2947 is shown in SEQ ID NO:

2.

3. The application of biomaterials overexpressing the *Ustilago maydis* effector protein gene g2947 in inhibiting BAX protein-induced necrosis of tobacco leaf tissue, characterized in that... The biomaterial inhibits BAX protein-induced programmed cell death in tobacco plants; the biomaterial is any one of A1) to A3) below: A1) An expression cassette containing a nucleic acid molecule with the sequence shown in SEQ ID NO:1; A2) A recombinant vector containing a nucleic acid molecule with the sequence shown in SEQ ID NO:1; A3) A recombinant microorganism containing a nucleic acid molecule with the sequence shown in SEQ ID NO:1, or a recombinant microorganism containing the expression cassette described in A1), or a recombinant microorganism containing the recombinant vector described in A2), wherein the microorganism is Agrobacterium; The nucleotide sequence of the gene g2947 is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the gene g2947 is shown in SEQ ID NO:

2.

4. A method for inhibiting BAX protein-induced necrosis of tobacco leaf tissue, characterized in that, The method involves overexpressing the wheat dwarf smut effector protein gene g2947 in tobacco, wherein the gene g2947 inhibits programmed cell death in tobacco plants induced by BAX protein; the nucleotide sequence of the gene g2947 is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the gene g2947 is shown in SEQ ID NO:

2.

5. The method according to claim 4, characterized in that, The overexpression of the wheat dwarf smut effector protein gene g2947 in tobacco was achieved by transferring a recombinant expression vector containing the nucleotide sequence shown in SEQ ID NO:1 into Agrobacterium and then introducing it into tobacco.

6. The method according to claim 5, characterized in that, The recombinant expression vector was constructed through the following steps: (1) Using cDNA synthesized by reverse transcription of total RNA extracted from wheat dwarf smut fungus as a template, PCR amplification was performed using primers g2947F1 and g2947R1 to obtain the g2947 gene fragment; the nucleotide sequence of primer g2947F1 is shown in SEQ ID NO:3, and the nucleotide sequence of primer g2947R1 is shown in SEQ ID NO:4; (2) The pGR107 vector was double-digested with restriction endonucleases Cla I and Sal I, and the linearized pGR107 vector fragment was recovered. (3) The g2947 gene fragment from step (1) is ligated with the linearized pGR107 vector fragment from step (2), and transformed into competent Escherichia coli cells. After screening and sequencing verification, positive clones are obtained, that is, the recombinant expression vector pGR107-g2947 is obtained.

7. The method according to claim 6, characterized in that, In step (1), the PCR reaction system is as follows: 25 μL of 2×Phanta® Flash Master Mix, 2 μL each of 10 μM upstream and downstream primers, 0.5 μg of cDNA template, and ddH2O added to 50 μL.

8. The method according to claim 6, characterized in that, In step (1), the PCR reaction program is as follows: 95℃ for 5 min; 95℃ for 1 min, 57℃ for 1 min, 72℃ for 2 min, 35 cycles; 72℃ for 10 min.

9. The method according to claim 5, characterized in that, The Agrobacterium is Agrobacterium tumefaciens GV3101.

Images