A molecular marker primer for the HEG1 gene associated with the number of follicles at the ovarian grade during peak egg production in chickens and its application.

Abstract

This invention relates to a trait related to the number of follicles in the ovary at peak egg production in chickens. HEG1 This invention relates to gene molecular marker primers and their applications, belonging to the field of biotechnology. The molecular marker of this invention is located at base 27564260 on chromosome 7 of the chicken reference genome GRCg7b version. This site exhibits T / C base polymorphism, including three genotypes: T / T, T / C, and C / C. The nucleotide sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The beneficial effects of this invention are that using this molecular method for genetic screening of high-quality chickens can not only significantly optimize the peak egg production performance of the flock, but also greatly improve breeding efficiency, shorten the breeding cycle, and reduce input costs. This achievement has significant industrial application prospects for promoting the precision breeding of high-producing laying hens.

Description

Technical Field

[0001] This invention relates to a trait related to the number of follicles in the ovary at peak egg production in chickens. HEG1 gene molecular marker primers and their applications belong to the field of biotechnology. Background Technology

[0002] Egg production is primarily limited by the ovulation efficiency of hens. In poultry reproductive physiology, ovarian follicle development is a highly ordered process precisely regulated by multiple factors. Although the left ovary of an adult hen stores a large number of quiescent primordial follicles and pre-grade follicles, only a very small number of follicles are recruited and successfully enter the graded development sequence during each laying cycle.

[0003] Hierarchical follicles are follicles that have crossed the critical selection threshold (typically >8-10 mm in diameter) and entered the rapid growth phase. These follicles are arranged in a step-like pattern according to size within the ovary, forming typical follicle grades (F1-Fn) (e.g., ...). Figure 1 (As shown). During peak egg production, the number of hierarchical follicles (NHF) in the ovary of a hen is a core indicator for measuring its reproductive potential. Studies have found that individuals with higher NHF values ​​typically have a more stable and denser ovulation sequence, manifested as shorter ovulation intervals and increased cumulative egg production; conversely, low-producing individuals often exhibit disordered hierarchical follicle sequence or increased follicle atresia rates in their ovaries.

[0004] Current research on improving egg production in chickens largely focuses on hormonal regulation of the hypothalamus-pituitary-gonadal (HPG) axis (such as the secretion of FSH and LH). However, the homeostasis and stress regulation of the ovarian microenvironment are equally crucial for follicular development. During their rapid growth phase, graded follicles require the absorption of large amounts of yolk precursors synthesized in the liver, a metabolic process accompanied by significant oxidative stress. The HEG1 gene encodes a transmembrane protein primarily expressed in vascular endothelial cells, involved in maintaining cell connectivity stability and the structural integrity of the tissue microenvironment. Studies have shown that HEG1 plays a vital role in regulating intercellular adhesion, maintaining vascular barrier function, and responding to local stress stimuli. In ovarian tissue, the rich vascular network is essential for follicular nutrient supply and metabolic waste removal; HEG1 may indirectly participate in regulating follicular development by maintaining ovarian vascular endothelial homeostasis and microenvironment stability. Furthermore, the potential role of HEG1 in cellular stress adaptation and apoptosis regulation suggests its significant research value in maintaining granulosa cell functional stability, defending against oxidative damage, and inhibiting abnormal follicular atresia.

[0005] Because NHF (non-nuclear egg production) is an internal reproductive trait and cannot be directly observed in vivo, traditional breeding methods relying on phenotypic records suffer from limitations such as long breeding cycles and slow genetic progress. Therefore, identifying functional SNP loci closely linked to the NHF trait and developing precise molecular marker detection tools has significant industrial application value for predicting egg production potential in chicks and accelerating the breeding process of high-producing breeder chickens. However, there are currently no publicly available reports on the application of the HEG1 gene and its related markers in the selection of chickens for egg production traits. Summary of the Invention

[0006] The purpose of this invention is to address the current limitations of poultry breeding, such as the inability to directly observe follicle development in vivo, long breeding cycles, and low accuracy. This invention provides a HEG1 gene molecular marker and its application that is significantly associated with the number of ovarian grade follicles (NHF) at peak egg production in chickens. This marker can be used for early and accurate identification of individuals with high egg production potential.

[0007] This invention solves the above problems through the following technical solution: First, it provides a molecular marker for the HEG1 gene that is significantly associated with the number of follicles at the ovarian grade during peak egg production in chickens. This molecular marker is located at position 27564260 on chromosome 7 of the chicken reference genome GRCg7b version. The reference genome base is T, and the mutant base is C. This site is located in exon 20 of the HEG1 gene (corresponding to transcript XM_040703637.2 of the NCBI gene accession number), belonging to the 3'UTR (untranslated region exons) exon, corresponding to position 151 of the sequence shown in SEQ ID NO:3 or SEQ ID NO:4. Simultaneously, it provides a specific primer pair for detecting this marker, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The above specific primer pair is applied to the molecular detection of the follicle count trait at the ovarian grade during peak egg production in chickens.

[0008] This invention further provides applications of the aforementioned primers, including the identification of SNP genotypes related to NHF during peak egg production in chickens. Specifically, it relates to a method for detecting relevant SNP genotypes by combining PCR amplification with Sanger sequencing. The detection process includes the following steps: First, using a chicken DNA sample as a template, PCR amplification is performed using a specific primer pair to obtain amplification products. The sample contains base 27564260 on chromosome 7 of the chicken reference genome GRCg7b version; Second, Sanger sequencing is performed on the obtained amplification products; Third, the molecular marker genotype of the target site is determined based on the sequencing results.

[0009] In the first step of the above detection method, the specific primer pair consists of the upstream primer 5'-AAGCACGACGATGGGAAGAA-3' (SEQ ID NO: 1) and the downstream primer 5'-AATGCTGGAAGGGATGGGAG-3' (SEQ ID NO: 2), with an amplification product length of 454 bp covering the target site. The PCR reaction system (at a final concentration of 25 μl) is as follows: 50 ng of chicken DNA to be tested, 12.5 μl of 2×RapidTaqMasterMix, 1 μl of the upstream primer, 1 μl of the downstream primer, and finally, sterile water to a final volume of 25 μl. The corresponding PCR amplification conditions are set as follows: pre-denaturation at 95℃ for 3 min; followed by 35 cycles (denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec); finally, after extension at 72℃ for 5 min, storage at 4℃.

[0010] The nucleotide sequence of the amplified product is shown in SEQ ID NO:3 or SEQ ID NO:4. The judgment criterion in the third step above is: individuals with the C / C genotype at the SNP locus have a higher number of follicles at peak egg production than T / T and T / C genotype individuals, while the corresponding indicators of T / C genotype individuals are higher than those of T / T genotype individuals. This invention, through correlation analysis between this genotype and the trait, confirms that by using specific primer pairs for amplification, sequencing, and genotyping, effective selection of the number of follicles at peak egg production in chickens can be achieved based on the composition of this SNP locus.

[0011] In practical breeding applications, population performance can be optimized by culling individuals with the T / T genotype and retaining individuals with the C / C or T / C genotype, depending on specific breeding objectives. Its beneficial effects include the ability to predict future egg production potential in chicks, significantly shortening the selection cycle and reducing breeding and production costs, providing a scientific basis for early molecular-assisted breeding of high-quality chickens. Furthermore, the detection method disclosed in this invention is simple to operate, can be carried out in the laboratory, and can also be integrated into a genomic breeding system. The association between the HEG1 gene as a regulatory factor and the number of graded follicles also provides a new perspective for in-depth research on the survival mechanism of ovarian granulosa cells under metabolic stress. Attached Figure Description

[0012] Figure 1 This is a chicken follicle chart.

[0013] Figure 2 This is a Manhattan plot of GWAS analysis of the ovarian grade follicle number trait during peak egg production.

[0014] Figure 3 This is a gel imaging image of the DNA amplification product at the target mutation site.

[0015] Figure 4These are Sanger sequencing results of PCR amplification products from three genotypes.

[0016] Figure 5 This is a box plot showing the phenotypic distribution of individuals with three genotypes based on the chr7:27564260 molecular marker.

[0017] Figure 6 The expression differences of the HEG1 gene in the liver, ovarian matrix, small white follicles, and small yellow follicles of chickens in different egg production groups. Detailed Implementation

[0018] Suitable for breeding Chishui Silkie chickens.

[0019] Example 1 In this embodiment, the number of ovarian-grade follicles in Chishui Silkie hens (purchased in March 2022 from Luyuan Poultry Co., Ltd., Luoba Village, Baiyi Township, Wudang District, Guiyang City, Guizhou Province) during their peak egg production period was measured. SNP genotyping data was obtained through whole-genome resequencing, and genome-wide association analysis was used to screen for HEG1 locus molecular markers significantly associated with this trait. The correlation analysis map is detailed in [link to relevant data]. Figure 2 This embodiment identifies and validates the HEG1 gene molecular marker associated with the NHF trait during peak egg production in chickens through the following experimental procedure.

[0020] In the phenotypic and genotypic testing phase, 128 Chishui Silkie hens were selected as the experimental group. These chickens lived under completely identical feeding and management conditions and had free access to feed and water. After individuals entered the egg-laying period, the number of ovarian-grade follicles at the peak egg production of each chicken was observed and recorded in detail, which served as the original phenotypic data for the egg production trait of this group.

[0021] Genomic DNA extraction was then performed. Blood samples were collected from the subwing veins of the individuals being tested, and the samples were anticoagulated and lysed. Genomic DNA was extracted using proteinase K digestion combined with saturated sodium chloride, and finally dissolved in TE buffer and frozen at -20°C.

[0022] In the PCR amplification step, the extracted genomic DNA was used as the amplification template to amplify the fragment containing the SNP marker at locus 27564260 on chicken chromosome 7. The upstream primer sequence used was 5'-AAGCACGACGATGGGAAGAA-3' (SEQ ID NO: 1), and the downstream primer sequence was 5'-AATGCTGGAAGGGATGGGAG-3' (SEQ ID NO: 2). The reaction system, with a final concentration of 25 μl, contained 50 ng of the chicken DNA to be tested, 12.5 μl of 2×RapidTaqMasterMix, 1 μl each of the upstream and downstream primers, and finally brought to a final concentration of 25 μl with sterile water. The specific PCR amplification program was set as follows: pre-denaturation at 95℃ for 3 min; followed by 35 cycles (denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec); and finally, complete extension at 72℃ for 5 min, followed by storage at 4℃. 2 μl of the amplification product was subjected to agarose gel electrophoresis to verify the presence of a single specific band of 454 bp in length that covered the target SNP site (e.g., Figure 3 (As shown).

[0023] The sequences of the amplified products are as follows: SEQIDNO:3 AAGCACGACGATGGGAAGAACATGAAGCAGGCTGACTGAGGAAGCACAAATAAATGCTTAAAATTCAGCTTTTGAAAGAGACCTCACTAAAGGTGAGCATTACTACCACGGTTCTGAATGCTGTTAAAGAAACTGTGGTGACTTTACATATAAAATTTTGGTTTCTGCAGGAGAACATCCTGCAGAATGTAACGGGGCTTAAAACAAGTGATTGAGTTTAGTAGGAA GAATTACACGCTTATTCTGTCTTGTGGTGGTTGTTTTCTGTCCTTAAAGTAAGTTATCCGTACTGATGGTTTCTGTAACAGACACGTCAGGCAAATTTTGTGGCACTGCTCAAGAAAACTGACCACTTTTTACCAGATTCCCCAGGCCTTTTCCATGTGGGGCTGTGCAGATTTGGGCCACTTGCTGTGGTACTACCCAAGCAAGACTCCCATCCCTTCCAGCATT SEQ ID NO:4 AAGCACGACGATGGGAAGAACATGAAGCAGGCTGACTGAGGAAGCACAAATAAATGCTTAAAATTCAGCTTTTGAAAGAGACCTCACTAAAGGTGAGCATTACTACCACGGTTCTGAATGCTGTTAAAGAAACTGTGGTGACTTTACATACAAAATTTTGGTTTCTGCAGGAGAACATCCTGCAGAATGTAACGGGGCTTAAAACAAGTGATTGAGTTTAGTAGGAA GAATTACACGCTTATTCTGTCTTGTGGTGGTTGTTTTCTGTCCTTAAAGTAAGTTATCCGTACTGATGGTTTCTGTAACAGACACGTCAGGCAAATTTTGTGGCACTGCTCAAGAAAACTGACCACTTTTTACCAGATTCCCCAGGCCTTTTCCATGTGGGGCTGTGCAGATTTGGGCCACTTGCTGTGGTACTACCCAAGCAAGACTCCCATCCCTTCCAGCATT After sequencing verification and genotyping, the PCR products of each sample were sent to Sanger sequencing, and the resulting sequencing peak diagram is shown below. Figure 4 As shown.

[0024] Finally, transcriptome sequencing and... HEG1 Gene expression analysis was used to analyze the differences between individuals with high and low egg production. HEG1 Differences in gene expression in different tissues. From the 128 Chishui Silkie chickens mentioned above, they were ranked from highest to lowest cumulative egg production at 300 days of age. The six chickens with the lowest egg production (low egg production group, sample numbers Sample2-Sample7) and the six chickens with the highest egg production (high egg production group, sample numbers Sample8-Sample13) were selected. After aseptic necropsy, four tissues were collected: liver, ovarian stroma, small white follicles, and small yellow follicles. Each tissue sample contained approximately 100 mg and was immediately flash-frozen in liquid nitrogen, then transferred to a -80℃ freezer for later storage.

[0025] ① Total RNA Extraction and Quality Assay: Total RNA was extracted from each of the tissue samples according to the TRIzol reagent (Invitrogen, USA) instructions. The concentration of the extracted RNA was determined using a NanoDrop 2000 micro spectrophotometer, and the purity was assessed using the OD260 / 280 ratio. RNA integrity (RIN value) was then detected using an Agilent 2100 Bioanalyzer. Only qualified samples with an OD260 / 280 ratio between 1.8 and 2.1 and a RIN ≥ 7.0 were selected for subsequent library construction.

[0026] ② Library Construction and Sequencing: 1 μg of total RNA from each qualified sample was used as the starting template. PolyA-tailed mRNA was enriched using Oligo(dT) magnetic beads. The mRNA was then fragmented, reverse transcribed using random primers to synthesize the first-strand cDNA, synthesized the second-strand cDNA, completed end repair, added A-tails, ligated adapters, screened for fragment size, and amplified by PCR to construct a strand-specific sequencing library. After the library passed quality control, paired-end 150bp sequencing (PE150) was performed on the BGI MGI high-throughput sequencing platform. The raw data was then converted into FASTQ format raw sequencing reads using WriteFQ software for base identification.

[0027] ③ Data Processing and Expression Calculation: The raw sequencing data (Raw Reads) underwent quality control, filtering the following three categories of reads sequentially to obtain high-quality clean reads: (i) adapter-contaminated reads, i.e., reads with adapter-contaminated bases greater than 5 bp; (ii) low-quality reads, i.e., reads with a quality value Q ≤ 19 accounting for more than 50% of the total bases; (iii) reads containing N greater than 5%. For paired-end sequencing, if one end read was filtered, the other end read was also removed. The clean reads of each sample were aligned to the chicken reference genome (GRCg7b version) using HISAT2 software. The alignment results were used for transcript assembly and expression quantification using StringTie software. The expression level of each sample was calculated using the Transcripts Per Million (TPM) method. HEG1 The expression levels of the gene in the liver, ovarian stroma, small white follicles, and small yellow follicles are shown in Table 2.

[0028] In the results analysis section, 128 Chishui Black-boned Chickens with clear NHF phenotype records were selected for correlation statistics. Statistical tests were performed using the t.test function in R4.0 software, and the association between genotype and graded follicle number traits was assessed using the intergroup mean comparison model. [Setting...] P <0.05 indicates a significant difference. P<0.01 indicates a highly significant difference. Statistical results are shown in Table 1 and... Figure 5 As shown, among the individuals examined, there were 81 individuals with the T / T genotype, 38 with the T / C genotype, and 9 with the C / C genotype. The number of graded follicles among the three genotypes showed a highly significant difference. P <0.01). Among them, the mean number of graded follicles in C / C genotype individuals was 3.222, significantly higher than that in T / C and T / T genotype individuals, by 1.895 and 1.012 respectively. Notably, the coefficient of variation for C / C genotype individuals was the lowest among all groups, indicating that this genotype exhibits more robust egg production performance and higher population uniformity. In conclusion, the experimental results confirm that chickens… HEG1 Molecular markers at genotype loci are closely associated with the number of graded follicles during peak egg production. In practical breeding work, based on established breeding goals, the number of graded follicles can be increased by targeted selection of C / C genotype individuals, or the evenness of population traits can be adjusted using T / C genotype individuals, thereby effectively optimizing breeding efficiency.

[0029] To investigate the different tissues in high and low egg production groups HEG1 To investigate gene expression differences, this embodiment collected liver, ovarian stroma, small white follicles, and small yellow follicles from the low egg production group (n=6, samples 2-7) and the high egg production group (n=6, samples 8-13) for transcriptome sequencing to obtain... HEG1 The expression levels of genes (TPM) were analyzed, and a one-tailed t-test was used to compare the differences in transcriptome expression levels between the two groups in four tissues: liver, ovarian stroma, small white follicles, and small yellow follicles. The results showed that ( Figure 6 In liver tissue, the expression level of HEG1 in the high-laying group (2.81±1.06TPM) was significantly higher than that in the low-laying group (1.87±0.59TPM). p =0.0445, the difference was statistically significant. However, in ovarian stromal tissue (high-yield 3.55±1.47 vs. low-yield 3.88±0.61), p =0.388), small white follicles (high-yield 6.03±1.90 vs. low-yield 6.25±2.64), p =0.433) and small yellow follicles (high-yield 5.30±2.74 vs. low-yield 6.80±1.96, p No significant differences were detected in any of the values ​​(=0.730). In summary, HEG1 The expression level in the liver is positively correlated with the high egg production performance of chickens, suggesting that this gene may play an important role in the regulation of liver metabolism, thereby affecting egg production efficiency.

[0030] Table 1. Association analysis between molecular marker at position 27564260 on chromosome 7 and follicle number at ovarian grade during peak egg production. T / T 81 <![CDATA[1.012 a ]]> 1.32 130.20% T / C 38 <![CDATA[1.895 b ]]> 1.72 90.83% C / C 9 <![CDATA[3.222 c ]]> 1.48 45.97% Note: Data with the same subscript letter in the same column indicate no significant difference, while data with different subscript letters indicate a significant difference. P <0.05).

[0031] Table 2. Transcriptome sequencing HEG1 Gene expression levels (TPM) in high and low laying hens .

[0032] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. The application of a primer for a HEG1 gene SNP molecular marker associated with the trait of ovarian grade follicle number at peak egg production in the genetic improvement of the trait associated with the ovarian grade follicle number at peak egg production in Chishui Silkie chickens, characterized in that: The application includes genotyping of SNP loci related to the number of graded follicles in the ovaries during the peak egg production period of Chishui Silkie chickens. The SNP locus is located at base 27564260 on chromosome 7 of the chicken reference genome GRCg7b version. This locus exhibits T / C base polymorphism, including three genotypes: T / T, T / C, and C / C. The nucleotide sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. During the peak egg production period, individuals carrying the C / C genotype have a higher number of graded follicles than individuals carrying the T / C or T / T genotypes, and individuals carrying the T / C genotype have a higher number of graded follicles than individuals carrying the T / T genotype.

2. The application of the primers for the HEG1 gene SNP molecular marker associated with the follicle number at the ovarian grade during peak egg production, as described in claim 1, in the genetic improvement of the follicle number at the ovarian grade during peak egg production in Chishui Silkie chickens, characterized in that: The genotype detection method includes the following steps: Step 1, using the upstream primer shown in SEQ ID NO:1 and the downstream primer shown in SEQ ID NO:2 to perform PCR amplification on the genomic DNA of the sample to be tested and obtain the target amplification product; Step 2, performing Sanger sequencing on the obtained amplification product; Step 3, based on the base information returned by sequencing, identifying the molecular marker genotype at position 27564260 on chromosome 7 of the chicken reference genome GRCg7b version.

3. The application of the primers for the HEG1 gene SNP molecular marker associated with the follicle number at the ovarian grade during peak egg production, as described in claim 2, in the genetic improvement of the follicle number at the ovarian grade during peak egg production in Chishui Silkie chickens, characterized in that: In step one, an amplification product with a length of 454 bp was obtained, covering the 27564260th base on chromosome 7 of the chicken reference genome GRCg7b version.

4. The application of the primers for the HEG1 gene SNP molecular marker associated with the follicle number at the ovarian grade during peak egg production, as described in claim 2, in the genetic improvement of the follicle number at the ovarian grade during peak egg production in Chishui Silkie chickens, characterized in that: The PCR reaction system in step one is based on a 25 μl volume. Chicken DNA 50ng to be tested 2xRapidTaqMasterMix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Add ddH2O to a final volume of 25 μl. The PCR amplification reaction conditions were as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 sec, 60°C annealing for 15 sec, 72°C extension for 15 sec, for a total of 35 cycles; 72°C extension for 5 min; and storage at 4°C.

5. The application of the primers for the HEG1 gene SNP molecular marker associated with the follicle number at the ovarian grade during peak egg production, as described in claim 4, in the genetic improvement of the follicle number at the ovarian grade during peak egg production in Chishui Silkie chickens, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO:3 or SEQ ID NO:4.

Images