A molecular marker closely linked to a main-effect qst.c02 qtl site of brassica napus seedling salt tolerance and application

Abstract

This invention belongs to the field of rapeseed genetics and breeding technology, specifically relating to a molecular marker and its application that is closely linked to the major QTL locus qST.C02, which controls salt tolerance in rapeseed seedlings. This invention is the first to obtain the stable QTL locus qST.C02 controlling salt tolerance in rapeseed, and to identify a SNP (single nucleotide polymorphism) marker closely linked to this locus located at position 60446192 on chromosome CO2 of the published rapeseed Darmor-bzh v10 genome, which can explain 7.01% of the phenotypic variation. Based on this variant locus, the KASP molecular marker STC02J was designed. This marker can be used to identify superior allelic variations of the rapeseed seedling salt tolerance QTL locus qST.C02, enabling rapid and accurate screening of superior individual plants with strong salt tolerance, thus improving the efficiency of screening salt-tolerant breeding materials for rapeseed.

Description

Technical Field

[0001] This invention belongs to the field of rapeseed genetic breeding technology, specifically involving a molecular marker and its application that is closely linked to the major QTL site qST.CO2 of salt tolerance in Brassica napus. Background Technology

[0002] Soil salinization is a significant factor restricting agricultural development globally. Traditional rapeseed genetic breeding has focused primarily on improving yield, quality, and oil content, with relatively insufficient attention paid to abiotic stress resistance (such as salt tolerance, drought resistance, and cold resistance). With the increasing deterioration of the natural environment, the impact of abiotic stresses such as salinity, drought, and high temperatures on rapeseed production is becoming increasingly prominent, especially soil salinization, which has become one of the main factors limiting its yield and geographical distribution.

[0003] As a moderately salt-tolerant crop, rapeseed (Brassica napus) possesses good potential for salt and alkali tolerance. Some superior germplasm resources can even achieve good seed setting rates on saline-alkali land with a salinity exceeding 6‰. Therefore, fully utilizing and exploring the salt-tolerance genetic potential within rapeseed germplasm, and through genetic improvement, breeding and creating a batch of new rapeseed varieties that can maintain stable and high yields under saline conditions, is an economical and effective way to address the threat of soil salinization and ensure the safety and stability of rapeseed production and supply.

[0004] Traditional breeding methods suffer from inherent drawbacks such as lengthy breeding cycles, low efficiency in trait selection, strong environmental interference, and large phenotypic identification errors. Salt tolerance in rapeseed is a typical quantitatively inherited trait, controlled by multiple genes, and its phenotype is easily affected by environmental factors such as soil salinity, humidity, and temperature. Traditional phenotypic screening not only requires large-scale saline-alkali identification nurseries and consumes significant manpower and resources, but also struggles to accurately distinguish between salt-tolerant and salt-sensitive individual plants, easily leading to problems such as loss of target traits, prolonged breeding cycles, and unsatisfactory breeding results. It can no longer meet the current industry demand for rapid breeding and precise improvement of salt-tolerant rapeseed varieties. With the rapid development of molecular biology and sequencing technologies, accelerating the breeding process through genotypic selection has become a widely used technique in variety breeding. Utilizing molecular marker-assisted selection to detect molecular markers closely associated with salt tolerance in rapeseed can overcome the difficulties in salt tolerance phenotypic identification, guide the precise introduction or aggregation of traits, and greatly improve breeding efficiency. Currently, there are few reports on the development of molecular markers closely linked to major salt tolerance sites in rapeseed, and related breeding work still mainly relies on traditional large-scale phenotypic screening.

[0005] This invention aims to identify major QTL sites that have a modifying effect on salt tolerance in Brassica napus seedlings through genome-wide association analysis, and to develop practical molecular markers for marker-assisted selection of salt tolerance in Brassica napus. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker closely linked to the major QTL site qST.C02 of salt tolerance in Brassica napus. This molecular marker is an SNP marker located at the 60446192nd base on chromosome C02 of the published Brassica napus Darmor-bzh v10 genome.

[0007] Another objective of this invention is to provide an application of a molecular marker closely linked to the major QTL locus qST.C02 of salt tolerance in Brassica napus. By detecting the genotype of the 60446192nd base on the CO2 chromosome of the Darmor-bzh v10 genome of Brassica napus, screening and breeding for salt tolerance in rapeseed can be achieved.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: The application of SNP molecular markers in salt tolerance selection or breeding of Brassica napus seedlings: The SNP molecular marker is located on chromosome C02 of the Darmor-bzh v10 reference genome of Brassica napus, with a mutation of G to A at position 60446192. The genotype of the SNP molecular marker is AA, indicating that Brassica napus exhibits strong salt tolerance and large biomass in both aboveground and underground parts. The genotype of the SNP molecular marker is GG, indicating that Brassica napus exhibits weak salt tolerance and small biomass in both aboveground and underground parts.

[0009] The KASP primer set for detecting the above SNP molecular markers includes the forward primer of the sequence described in SEQ ID NO.1 and the reverse primers of the sequences described in SEQ ID NO.2 and 3.

[0010] A test kit for identifying salt tolerance in rapeseed seedlings, comprising a set of KASP primers with the sequences shown in SEQ ID NO.1-3.

[0011] A method for identifying salt tolerance in Brassica napus seedlings includes detecting the genotype at position 60446192 of chromosome C02 of the Darmor-bzh v10 reference genome of Brassica napus. Brassica napus with genotype AA exhibits stronger salt tolerance and larger biomass in both aboveground and underground parts, while Brassica napus with genotype GG exhibits weaker salt tolerance and smaller biomass in both aboveground and underground parts. Preferably, amplification and genotype detection are performed using primer sets based on the sequences described in SEQ ID NO. 1-3.

[0012] Compared with the prior art, the present invention has the following advantages: (1) This invention has for the first time obtained the major QTL site qST.C02, which is significantly associated with salt tolerance in Brassica napus. It can explain up to 7.01% of the phenotypic variation and can be stably detected in multiple replicates. It can be effectively applied to the genetic improvement of salt tolerance in Brassica napus.

[0013] (2) The molecular marker STC02J, which is significantly associated with salt tolerance of Brassica napus, was developed for the first time, providing a reliable source of molecular markers for the pre-selection of salt tolerance of Brassica napus.

[0014] (3) Using the molecular marker STC02J, the superior allelic variation of qST.C02 in rapeseed varieties or lines can be selected quickly in rapeseed seedlings, which can greatly reduce the workload of breeding screening, shorten the breeding cycle, and accelerate the salt tolerance breeding process of rapeseed. Detailed Implementation

[0015] Unless otherwise specified, the technical means described in this invention are all conventional methods in the art; the reagents or materials described, unless otherwise specified, are all from commercial sources. In this invention, unless otherwise specified, the genome of Brassica napus is based on Darmor-bzh v10.

[0016] Example 1: Obtaining the major QTL site qST.CO2 for salt tolerance in rapeseed 1. 326 inbred lines of Brassica napus from various countries around the world were collected as a rapeseed association population. Single leaves of each line in the association population were collected, and total DNA was extracted using the CTAB method. Genotyping of each sample was performed using the Brassica napus Bnapus50K chip developed by Wuhan Shuanglvyuan Innovation Core Technology Research Institute Co., Ltd.

[0017] 2. Using Illumina BeadStudio genotyping software (https: / / www.illumina.com / ), the heterozygous rate, missing rate, and minor allele frequency of the population materials at each locus were calculated. SNP markers were filtered using the criteria of missing rate ≤0.2, heterozygous rate ≤0.2, minor allele frequency >0.05, and unique matching of the SNP marker in the *Brassica napus* Darmor-bzh v10 genome. A total of 20,848 high-quality SNP markers were obtained for genome-wide association analysis.

[0018] 3. The genotypic data of the obtained association analysis populations were imported into STRUCTURE v.2.3.4 for population structure analysis, dividing the 326 Brassica napus germplasm resources into 3 subgroups. The phylogenetic relationships among the 326 Brassica napus germplasm resources were calculated using SPAGeDi software.

[0019] 4. Evaluation of salt tolerance of the above 326 materials: Seeds were first germinated on sterile gauze, and transplanted on the seventh day. After transplanting, the seedlings were allowed to recover for two days, and salt treatment was started on the third day. A gradient salt tolerance treatment technique based on hydroponics was adopted. Initially, the seedlings were treated with an 8 g / L NaCl solution, with a one-day interval between treatments. A second salt treatment was performed on the fifth day, using a final NaCl solution concentration of 18 g / L for continuous salt treatment. Biomass is the primary indicator for salt tolerance evaluation; therefore, after three weeks of treatment, the fresh weight of the aboveground parts, the fresh weight of the underground parts, the dry weight of the aboveground parts, and the dry weight of the underground parts were measured, with three replicates.

[0020] 5. Combining biomass data, genotype data, and population structure from three replicates of *Brassica napus* under salt treatment, association analysis was performed using TASSEL 5.0 software. Only the SNP marker seq-new-rs29666, significantly associated with the fresh weight of the underground parts of *Brassica napus*, was detected on chromosome CO2. This marker was stable in both replicates, while other traits were not associated with stable and reproducible loci. This locus explained up to 7.01% of the phenotypic variation, with a significance level of 3.74E-06. This SNP locus (the variation from G to A) is located at nucleotide 60,446,192 on chromosome CO2 of the *Brassica napus* Darmor-bzh v10 genome. The major salt tolerance QTL locus closely linked to this SNP locus was named qST.C02. When the SNP locus is A, it is a type of rapeseed with large aboveground and underground biomass and strong salt tolerance. When the SNP locus is G, it is a type of rapeseed with small aboveground and underground biomass and weak salt tolerance.

[0021] Example 2: Development of molecular marker primers tightly linked to the major QTL site qST.CO2 for salt tolerance in Brassica napus 1. A 100 bp sequence was extracted from each of the bases upstream and downstream of chromosome 60446192 on chromosome C02 of Brassica napus. Following the primer design principles of KASP (Kompetitive Allele-Specific PCR), the KASP molecular marker STC02J was developed. This marker includes one forward universal primer STC02J-F and two competitive reverse primers STC02J-R1 and STC02J-R2, corresponding to the G and A bases at the SNP site, respectively. The primer sequences are as follows: STC02J-F: GTTAGACTGATAGTATCAGATCCGGTC (SEQ ID NO.1) STC02J-R1: ATGATTTGGAGCTGTGTGAACC (SEQ ID NO.2) STC02J-R2:AATGATTTGGAGCTGTGTGAACT (SEQ ID NO.3) Before use, the above primers need to be fitted with universal KASP-labeled adapters according to the principles of KASP-label development. The adapter sequence added before STC02J-R1 is GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4), and the adapter sequence added before STC02J-R2 is GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5).

[0022] The sequence amplified in Westar (a type of rapeseed) is of genotype A (i.e., the SNP site is of genotype GG), and the sequence is shown below: GTTAGACTGATAGTATCAGATCCGGTCTGATATCTAGCTAATGGTTTAGACGGTTCACACAGCTCCAAATCAT (shown in SEQ ID NO. 6).

[0023] The sequence amplified in the rapeseed variety Huayou 6 (salt-tolerant) is of genotype B (i.e., the SNP site is of genotype AA), and the sequence is shown below: GTTAGACTGATAGTATCAGATCCGGTCTGATATCTAGCTAATGGTTTAGACAGTTCACACAGCTCCAAATCATT (shown in SEQ ID NO. 7).

[0024] 2. Genotyping of the associated rapeseed population described in Example 1 was performed using competitive allele-specific PCR. The amplification kit used was the five-primer amplification inhibited mutagenesis system (PARMS). Following the instructions for the PARMS SNP Genetyping 2×PARMS Mix kit (E001-3, Jingtai), a 10µL reaction system was designed as follows: 5µL 2×PARMS premix, 0.4µL STC02J-F (10µM), 0.15µL STC02J-R1 (10µM), 0.15µL STC02J-R2 (10µM), and 10-100ng rapeseed genomic DNA. The amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, annealing at 65℃, decreasing by 0.8℃ per cycle, for 10 cycles; 94℃ denaturation for 20 s, extension at 57℃ for 1 min, for 30 cycles; fluorescence signal was collected once, and genotyping results were output. Further association analysis using Tassel software confirmed that the marker was significantly associated with the major QTL site qST.C02 for salt tolerance in Brassica napus.

[0025] Example 3: Application of KASP molecular marker STC02J in salt tolerance screening breeding of Brassica napus 1. Based on the above-ground and below-ground biomass phenotypes of the aforementioned 326 related population materials under salt treatment, 20 materials each of extreme salt tolerance and extreme salt sensitivity were selected. Salt tolerance was assessed in the hydroponic glass room of the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, with three replicates. A gradient salting method was used, with continuous salt treatment using a final concentration of 18 g / L NaCl solution. The fresh weight of the below-ground parts was measured after three weeks of treatment.

[0026] 2. The distribution of the two genotypes of the molecular marker STC02J in the above-mentioned extreme salt-tolerant and extreme salt-sensitive materials was detected. The results showed that in 20 extreme salt-tolerant materials, 2 were genotype A (SNP site was GG genotype) and 18 were genotype B (SNP site was AA genotype). In contrast, in 20 extreme salt-sensitive materials, 17 were genotype A (SNP site was GG genotype) and 3 were genotype B (SNP site was AA genotype) (Table 1).

[0027] Table 1: Genotypes of molecular marker STC02J in salt-tolerant extreme materials of Brassica napus

[0028] 3. The A and B genotypes detected by molecular marker STC02J showed extremely significant differences in the fresh weight of the underground parts of Brassica napus under salt treatment (P = 3.97E17).

[0029] The above results are sufficient to demonstrate that the molecular marker STC02J developed in this invention is highly correlated with salt tolerance in Brassica napus, and therefore can be used for marker-assisted selection of salt tolerance in Brassica napus.

Claims

1. The application of reagents for detecting SNP molecular markers in salt tolerance selection or breeding of Brassica napus seedlings, characterized in that... The SNP molecular marker is located on chromosome C02 of the Darmor-bzh v10 reference genome of Brassica napus, with a mutation of base G to A at position 60446192. The genotype of the SNP molecular marker is AA, indicating strong salt tolerance in Brassica napus. The genotype of the SNP molecular marker is GG, indicating weak salt tolerance in Brassica napus.

2. The method for detecting the KASP primer set of the SNP molecular marker described in claim 1, characterized in that, It includes the forward primer of the sequence described in SEQ ID NO.1 and the reverse primers of the sequences described in SEQ ID NO.2 and 3.

3. A test kit for identifying salt tolerance in rapeseed seedlings, characterized in that, Includes the KASP primer set as described in claim 2.

4. The application of the KASP primer set according to claim 2 in the identification or breeding of salt tolerance in Brassica napus seedlings, characterized in that, The genotype of the SNP molecular marker is AA, indicating strong salt tolerance in Brassica napus; the genotype of the SNP molecular marker is GG, indicating weak salt tolerance in Brassica napus.

5. A method for identifying salt tolerance in rapeseed seedlings, characterized in that, This includes detecting the genotype of Brassica napus at chromosome 60446192 on chromosome C02 of the Darmor-bzh v10 reference genome. Brassica napus with genotype AA exhibits strong salt tolerance, while Brassica napus with genotype GG exhibits weak salt tolerance.

6. The method according to claim 5, characterized in that, Amplification and genotyping were performed using primer sets with the sequences shown in SEQ ID NO.1-3.

Images