Ssr molecular marker primer of sweet gene of prunus salicina and application thereof
By developing SSR molecular marker primer pairs for the plum SWEETs gene, we achieved efficient and precise screening of high-sugar germplasm in plum seedlings, solving the problem of low efficiency in traditional breeding and supporting precision breeding of high-sugar plums.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUIZHOU UNIV
- Filing Date
- 2026-05-15
- Publication Date
- 2026-06-16
Smart Images

Figure CN122214537A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural bio-breeding, and in particular to an SSR molecular marker primer for the plum SWEETs gene and its application. Background Technology
[0002] Plum (Prunus salicina Lindl.) is an important stone fruit tree belonging to the genus Prunus in the family Rosaceae. It originated in my country and has a cultivation history of over 3,000 years. Among them, the Honey Plum is a superior local variety in Guizhou Province, originating from Liuma Town, Zhenning County, Anshun City. It is a high-sugar, low-acid type, with a soluble sugar content of 13.54% to 20%, which is higher than that of ordinary plum varieties. It has extremely high market recognition and economic value.
[0003] However, significant varietal mixing and trait segregation exist within the cultivated population of Prunus cerasifera, with a coefficient of variation in soluble sugar content exceeding 15%, posing challenges to standardized cultivation and fruit grading. Fruit sugar content is a quantitative trait controlled by multiple genes; traditional phenotypic selection breeding has a cycle of 6-8 years, resulting in low efficiency and accuracy. Molecular marker-assisted selection can achieve precise genotyping at the seedling stage. SWEETs (sugar efflux transporters) are a core gene family regulating fruit sugar accumulation. In Prunus cerasifera, the expression of PsSWEET4 and PsSWEET7 shows a significant positive correlation with sucrose accumulation, providing clear gene targets for functional marker development. Candidate gene SSRs (genic-SSRs) developed based on functional genes have stronger associations with target traits and higher selection reliability, becoming the mainstream strategy for fruit tree functional marker development. However, there are currently no reports of functional SSR markers in the Prunus genus that are closely related to sugar content and developed based on sugar transport genes such as SWEETs.
[0004] In existing technologies, the Prunus SSR marker primer pairs developed based on transcriptome sequences and their applications (CN105238781B) are only used for germplasm resource diversity and variety identification. These markers are derived from random genomic sequences or non-functional regions of the transcriptome, exhibiting weak correlation with sugar content traits and low selection efficiency. Molecular markers based on Prunus species resources and their applications (CN114574621B) are used for variety identification but are not associated with sugar content traits and cannot be used for high-sugar breeding selection. The application of a sugar transporter protein, PpSWEET11, in regulating hexose content in peach fruit (CN121109479A), and the application of the cherry sugar transporter gene CpSWEET10 (CN121517521A) only elucidate the functions of the corresponding genes in sugar content improvement; no practically applicable molecular markers have yet been developed. None of the above existing technologies provide SSR molecular markers based on the Prunus SWEETs gene family that can be directly used for screening for high sugar content traits in seedlings.
[0005] In summary, given the current lack of technologies for applying plum sugar transporter genes, we propose an SSR molecular marker primer for the plum SWEETs gene and its application. Summary of the Invention
[0006] The main objective of this invention is to provide an SSR molecular marker primer for the plum SWEETs gene and its application, in order to address the gap in existing technologies for functional SSR markers related to sugar content in the plum genus, which makes it impossible to accurately screen for high sugar traits in seedlings. At the same time, it provides an efficient functional molecular marker method for high sugar precision breeding of plums.
[0007] Based on the first major aspect of the present invention, a primer pair combination for SSR molecular markers of the Prunus sweets gene is provided, including primer pair PS7-9 and primer pair PS14-4.
[0008] The primer pair PS7-9 consists of a forward primer PS7-9F and a reverse primer PS7-9R; the primer pair PS14-4 consists of a forward primer PS14-4F and a reverse primer PS14-4R.
[0009] The nucleotide sequence of the forward primer PS7-9F is: TAGGTGCTGTCACGTGGTTC; the nucleotide sequence of the reverse primer PS7-9R is: GGAAGCCGAGTATGTTTGGA;
[0010] The nucleotide sequence of the forward primer PS14-4F is: CAACGCCTTTGGTTGTATCA; the nucleotide sequence of the reverse primer PS14-4R is: AAACCCACCAAAATTCACCA.
[0011] As a further preferred embodiment, the annealing temperature of both primer pair PS7-9 and primer pair PS14-4 is 56°C.
[0012] The amplification target fragment lengths of the primer pair PS7-9 are 231bp and 237bp; the amplification target fragment lengths of the primer pair PS14-4 are 228bp and 238bp.
[0013] As a further preferred embodiment, the SSR site sequence lengths of the primer pair PS7-9 and primer pair PS14-4 are 20~28bp.
[0014] Based on a second key aspect of the present invention, a method for identifying high-sugar-content plum germplasm is provided, comprising the following steps:
[0015] Young leaves were collected from the plum trees to be tested, and genomic DNA was extracted.
[0016] Prepare a PCR reaction premix with a total volume of 10 μL. Perform a PCR amplification program on the PCR reaction premix to obtain the amplification product.
[0017] The amplification products were detected by capillary electrophoresis. The peaks of primer pair PS14-4 at 228bp and 238bp and primer pair PS7-9 at 231bp and 237bp were read. The bands with a concentration ≥0.4ng / µL were counted. The presence of a band was recorded as 1 and the absence of a band was recorded as 0. A 0 / 1 matrix list was created to complete the band statistics.
[0018] Identification was performed based on band statistics. When primer pair PS14-4 amplified the plum, the statistical values at 228bp and 238bp were both 1, and when primer pair PS7-9 amplified the plum, the statistical value at 231bp was 1 and the statistical value at 237bp was 0. Therefore, the plum plant to be tested was determined to be a high-sugar variety.
[0019] As a further preferred embodiment, in the aforementioned method, the OD260 / OD280 value of the genomic DNA is 1.7-1.9, and the concentration is 22 ng / μL-300 ng / μL.
[0020] As a further preferred embodiment, in the aforementioned method, the PCR reaction premix includes 5µL Taq PCRMix, 0.5µL each of upstream and downstream SSR primers, 1µL template DNA, and double-distilled water to a final volume of 10µL.
[0021] The Taq PCR Mi contains 0.1 U Taq Polymerase / µL, 500µM dNTP each, 20mM Tris-HC, 100mM KCl, and 3mM MgCl2.
[0022] As a further preferred embodiment, the specific steps of the PCR amplification procedure in the aforementioned method are as follows:
[0023] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s; annealing reaction at 50~60℃ for 30~45 s; extension reaction at 72℃ for 30~45 s; for a total of 35~40 cycles.
[0024] Finally, extend at 72℃ for 7–10 min; store at 4℃ after amplification.
[0025] As a further preferred embodiment, in the aforementioned method, the capillary electrophoresis detection is performed manually, and the same sample is subjected to at least three repeated PCR amplification and capillary electrophoresis detection.
[0026] Based on the third main aspect of the present invention, a method for constructing a DNA fingerprint of a plum variety is provided, comprising the following steps:
[0027] Young leaves were collected from the plum trees to be tested, and genomic DNA was extracted.
[0028] Based on genomic DNA, PCR amplification was performed using the SSR molecular marker primer pair combination of the Li SWEETs gene as described above to obtain amplification products.
[0029] The amplification products were detected by capillary electrophoresis. Bands with a concentration ≥0.4ng / µL were counted. The presence of bands at 228bp and 238bp of primer pair PS14-4 and at 231bp and 237bp of primer pair PS7-9 were recorded respectively. The presence of a band was recorded as 1, and the absence of a band was recorded as 0.
[0030] The 0 and 1 values at 228bp, 238bp, 231bp, and 237bp are arranged to form the DNA fingerprint of the plum plant to be tested.
[0031] Based on the fourth main aspect of the present invention, an application of the SSR molecular marker primer pair combination of the plum SWEETs gene as described above in the identification of plum germplasm resources is provided.
[0032] Compared with existing technologies, firstly, the SSR marker of this invention is directly developed based on the key regulatory genes for high sugar content in Prunus cerasifera (SWEETs family), and belongs to the candidate gene SSR (genic-SSR). It is closely linked to the sugar content trait of plum and has a very strong correlation. It can not only be used for germplasm identification, but also accurately correlate sugar content phenotype, which solves the core defect of existing technologies that cannot be used for screening high sugar trait, and greatly improves selection efficiency.
[0033] Meanwhile, this invention has developed SSR primers that can be directly applied, enabling precise identification of the sugar content genotype of plums during the seedling stage, achieving rapid and efficient screening of high-sugar germplasm, and truly transforming genetic resources into practical breeding technology that can be directly applied to the precision breeding of high-sugar plums.
[0034] Finally, this invention focuses on the high sugar content trait in plums and develops SSR markers targeting the core SWEETs gene that regulates sugar accumulation. This approach combines the advantages of SSR markers, such as co-dominance, high polymorphism, and ease of operation, with the added advantage of a close correlation between functional markers and target traits. It enables seedling-stage, non-destructive, large-scale, and precise screening of plum sugar content traits, solving the bottlenecks of long breeding cycles and low selection efficiency in traditional breeding methods. It can also help solve the problems of mixed varieties of honey plum and identification of genuine and counterfeit seedlings, providing key technical support for precision breeding of high sugar content plums and filling the gap in existing technologies for functional SSR markers related to sugar content in the plum genus. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.
[0036] Figure 1 This figure shows the agarose gel electrophoresis results of a portion of plum genomic DNA in one embodiment of the present invention;
[0037] Figure 2 This shows an agarose gel electrophoresis image of PCR products during primer screening in one embodiment of the present invention;
[0038] Figure 3 The image shown is a capillary electrophoresis diagram of primer pair PS14-4 in one embodiment of the present invention;
[0039] Figure 4 The image shows a capillary electrophoresis diagram of primer pair PS7-9 in one embodiment of the present invention. Detailed Implementation
[0040] The preferred embodiments of the present invention will be described in detail below to provide a clearer understanding of the purpose, features, and advantages of the invention. It should be understood that the following embodiments are not intended to limit the scope of the invention, but are merely illustrative of the essential spirit of the technical solution of the invention.
[0041] In the following description, certain specific details are set forth for the purpose of illustrating various disclosed embodiments in order to provide a thorough understanding of the various disclosed embodiments. However, those skilled in the art will recognize that embodiments may be practiced without one or more of these specific details. In other instances, well-known techniques associated with the invention may not have been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments.
[0042] Throughout this specification, references to "an embodiment" or "an embodiment" indicate that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Therefore, the appearance of "in an embodiment" or "an embodiment" in various places throughout the specification does not necessarily refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic may be combined in any manner in one or more embodiments.
[0043] In one feasible embodiment, the present invention provides an SSR molecular marker primer for the Prunus sweets gene and its application, the specific steps of which are as follows:
[0044] DNA extraction from samples. Young plum leaves were collected as samples. If DNA extraction was not performed immediately, the samples could be stored at -80℃ for later use. DNA extraction was performed using a commercially available plant DNA extraction kit, following the instructions. The DNA concentration was adjusted to 40 ng / µL.
[0045] PCR amplification was performed using SSR molecular marker primers to obtain PCR products.
[0046] The SSR primer sequences are as follows:
[0047] PS7-9F:TAGGTGCTGTCACGTGGTTC
[0048] PS7-9R:GGAAGCCGAGTATGTTTGGA
[0049] PS14-4F:CAACGCCTTTGGTTGTATCA
[0050] PS14-4R:AAACCCACCAAAATTCACCA
[0051] The total volume of the reaction premix is 10µL, which includes 5µL Taq PCR Mix, 0.5µL each of upstream and downstream SSR primers, 1µL template DNA, and double-distilled water to bring the volume to 10µL.
[0052] The Taq PCR Mix should contain 0.1 U Taq Polymerase / µL, 500 µM dNTP each, 20 mM Tris-HCl (pH=8.3), 100 mM KCl, and 3 mM MgCl2.
[0053] PCR reaction procedure: pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 50~60℃ for 30~45 s, extension at 72℃ for 30~45 s, for a total of 35~40 cycles;
[0054] Finally, extend at 72℃ for 7–10 min; store at 4℃ after amplification.
[0055] PCR products were detected by capillary electrophoresis for sample identification. The capillary electrophoresis output was analyzed manually, with concentrations ≥0.4 ng / µL included in the statistical analysis.
[0056] The specific band range is as follows:
[0057] Primer PS14-4 amplified the bands at 228bp and 238bp, while primer PS7-9 amplified the bands at 231bp and 237bp.
[0058] Based on the presence or absence of the amplified fragment in the corresponding band range of the same primer pair, convert it into a "0 / 1" matrix, with "1" indicating the presence of the amplified fragment and "0" indicating its absence.
[0059] Specifically, the technical solution of the present invention will be described in detail through the following embodiments:
[0060] Example 1
[0061] 1. Materials
[0062] A total of 43 samples were collected from the Guizhou Academy of Agricultural Sciences headquarters, the Guiyang Nongpao Mother Plant Garden in Guizhou Province, and the Zhenning Base in Guizhou Province, as shown in Table 1.
[0063] Fresh, tender leaves from the tips of new shoots were randomly selected from each sample material for identification. The leaves were wrapped in aluminum foil, and two copies of each sample were collected and placed in an ice box containing ice packs. One copy was used for laboratory testing, and the other copy was stored in an ultra-low temperature freezer at -80°C for later use.
[0064] Table 1 Material Number and Name
[0065] Sample number Sample Name Sampling location LZ01 6-1 Agricultural Science Academy Headquarters Base LZ02 4-6 Agricultural Science Academy Headquarters Base LZ03 5-1 Agricultural Science Academy Headquarters Base LZ04 4-3 Agricultural Science Academy Headquarters Base LZ05 2-2 Agricultural Science Academy Headquarters Base LZ06 3-1 Agricultural Science Academy Headquarters Base LZ07 1-2 Agricultural Science Academy Headquarters Base LZ08 P04 Agricultural Science Academy Headquarters Base LZ09 P01 Agricultural Science Academy Headquarters Base LZ10 P02 Agricultural Science Academy Headquarters Base LZ11 P05 Agricultural Science Academy Headquarters Base LZ12 P03 Agricultural Science Academy Headquarters Base LZ13 ZM001 Agricultural Science Academy Headquarters Base LZ14 ZJ3-3 Agricultural Science Academy Headquarters Base LZ15 ZJ2-10 Agricultural Science Academy Headquarters Base LZ16 ZJ1-26 Agricultural Science Academy Headquarters Base LZ17 1 Mother Garden of the Pao LZ18 3 Mother Garden of the Pao LZ19 4 Mother Garden of the Pao LZ20 5 Mother Garden of the Pao LZ21 6 Mother Garden of the Pao LZ22 7 Mother Garden of the Pao LZ23 8 Mother Garden of the Pao LZ24 9 Mother Garden of the Pao LZ25 11 Mother Garden of the Pao LZ26 12 Mother Garden of the Pao LZ27 13 Mother Garden of the Pao LZ28 14 Mother Garden of the Pao LZ29 15 Mother Garden of the Pao LZ30 16 Mother Garden of the Pao LZ31 18 Mother Garden of the Pao LZ32 20 Mother Garden of the Pao LZ33 27 Mother Garden of the Pao LZ34 29 Mother Garden of the Pao LZ35 31 Mother Garden of the Pao LZ36 32 Mother Garden of the Pao LZ37 Lu Rong'er Zhenning Base LZ38 Shang Banpao Zhenning Base LZ39 Breaking Through Peak Zhenning Base LZ40 May Evening PG Zhenning Base LZ41 Phoenix Li PG Zhenning Base LZ42 Zhang Hua Honey Plum Zhenning Base LZ43 Wang Anming's superior strain Zhenning Base
[0066] 2. Genomic DNA extraction
[0067] DNA was extracted from all samples using the new plant genomic DNA extraction kit (catalog number: DP320-02) from TIAGEN (Beijing). The procedure was performed according to the kit instructions.
[0068] After DNA extraction, DNA integrity was detected by 1% agarose gel electrophoresis, and its purity and concentration were detected by a Multiskan GO microplate reader.
[0069] Depend on Figure 1 It can be seen that the genomic DNA of plum leaves was highly intact after 1% agarose gel electrophoresis. The DNA sample bands were clear, the main band was obvious, and no DNA degradation was observed.
[0070] Using a Multiskan GO full-wavelength microplate reader, the OD260 / OD280 values of the DNA in the 43 samples ranged from 1.7 to 1.9, and the concentrations ranged from 22 ng / μL to 300 ng / μL. Both the purity and concentration met the requirements for PCR amplification of SSR molecular markers.
[0071] 3. Primer design and synthesis
[0072] Based on the plum SWEET gene sequence, 57 pairs of SSR primers were designed, with SSR locus sequence lengths ranging from 20 to 28 bp.
[0073] The main parameters for primer design are: annealing temperature (Tm) between 50 and 60℃, with 60℃ being optimal; PCR product size between 30 and 1000 bp; GC content between 30% and 60%, with 50% being optimal; and primers synthesized by Shanghai Bioengineering Co., Ltd.
[0074] 4. PCR amplification system and procedure
[0075] PCR amplification was performed using a 10 μL system: 1 μL template genomic DNA, 0.5 μL each of forward and reverse primers, 5 μL of 2×TaqPCR Master Mix, and ddH2O to bring the total volume to 10 μL. The Mix was sourced from Beijing Tiangen Biotech Co., Ltd.
[0076] SSR-PCR amplification reaction cycling program: pre-denaturation at 94℃ for 4 min; then continue denaturation at 94℃ for 30 s, annealing at 55-60℃ for 30 s, annealing at 72℃ for 30 s, for a total of 35 cycles; extension at 72℃ for 7 min; store at 4℃.
[0077] 5. Primer initial screening
[0078] PCR amplification of 57 primer pairs was performed using 2% agarose gel electrophoresis. The DNA materials used were Lu Rong'er, Shangbanpao, Poguanfeng, and Wuyuewan PG. Primers with target bands were initially screened out.
[0079] Combination Figure 2 As shown in Table 2, in the numbers “37~PS7-3”, 37 represents Lu Rong’er and PS7-3 represents the primer number; in the numbers “38~PS7-3”, 38 represents Shangbanpao and PS7-3 represents the primer number; the other numbers are similar.
[0080] All primers were able to amplify the target band, but only two primer pairs amplified bands that were related to the sugar content trait of the material.
[0081] Table 2 Primer information related to sugar content trait
[0082]
[0083] 6. Capillary electrophoresis
[0084] Combination Figure 3 , Figure 4As shown, 1 represents the size marker; 2-44 represent 43 plum samples, namely: 1, 1-2, 2-2, 3, 3-1, 4, 4-3, 4-6, 5, 5-1, 6, 6-1, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 20, 27, 29, 31, 32, Lu Rong'er, Shang Banpao, Po Guanfeng, Wuyue Wan PG, Fenghuang Li PG, Zhang Hua Fengtang Li, Wang Anming Youzhu, PO1, PO2, PO3, PO4, PO5, ZJ1-26, ZJ2-10, ZJ3-3, ZMOO1.
[0085] The above two primer pairs were used to perform PCR amplification on 43 plum resource samples, and the amplification products were subjected to capillary electrophoresis.
[0086] 7. Spectral band statistics
[0087] PCR amplification was performed on 43 plum samples using SSR primers PS14-4 and PS7-9, with each experiment repeated at least three times. The majority of the band patterns were reproducible, and the very few unstable reproducible bands were ignored in the statistical analysis.
[0088] Based on Table 3, the bands were counted manually by reading the bands. At the same size (bp), the presence of a band was recorded as 1 and the absence of a band was recorded as 0, creating a "0 / 1" matrix list. A DNA fingerprint was then constructed and a database was established.
[0089] Table 3 Primer information related to sugar content trait
[0090]
[0091] 8. Soluble sugar content of different plum resources
[0092] Based on Table 4, mature fruits from different plum resources were collected, and the total soluble sugar content was determined using the anthrone colorimetric method.
[0093] Table 4 Soluble sugar content of different plum resources
[0094]
[0095] 9. Correlation between SSR markers and sugar content
[0096] Based on a comprehensive analysis of the band statistics and sugar content determination results of different plum resources, when the bands show a pattern of "1 1 10", that is, when amplified with primer PS14-4, bands appear at both 228bp and 238bp, and when amplified with PS7-9, a band appears at 231bp, but no band appears at 237bp, the sugar content of the plum resources is between 95.9 and 137.6 mg / g.
[0097] Among them, the number of plum resources with a sugar content of 110 mg / g or more reached 76.4%, and the number of plum resources with a sugar content of more than 100 mg / g reached 82.3%.
[0098] The technical terms, principles, or means related to the technical solutions of the present invention mentioned in the above embodiments, which are not described in detail above, are all well-known technologies or common practices that are known to those skilled in the art.
[0099] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A primer pair combination of SSR molecular marker of Prunus SWEETs gene, characterized in that, This includes primer pair PS7-9 and primer pair PS14-4; The primer pair PS7-9 consists of forward primer PS7-9F and reverse primer PS7-9R; the primer pair PS14-4 consists of forward primer PS14-4F and reverse primer PS14-4R. The nucleotide sequence of the forward primer PS7-9F is: TAGGTGCTGTCACGTGGTTC; the nucleotide sequence of the reverse primer PS7-9R is: GGAAGCCGAGTATGTTTGGA; The nucleotide sequence of the forward primer PS14-4F is: CAACGCCTTTGGTTGTATCA; the nucleotide sequence of the reverse primer PS14-4R is: AAACCCACCAAAATTCACCA. 2.The primer pair combination of the SSR molecular marker of Prunus SWEETs gene according to claim 1, wherein, The annealing temperature for both primer pair PS7-9 and primer pair PS14-4 is 56℃. The amplification target fragment lengths of the primer pair PS7-9 are 231bp and 237bp; the amplification target fragment lengths of the primer pair PS14-4 are 228bp and 238bp. 3.The primer pair combination of the SSR molecular marker of Prunus SWEETs gene according to claim 1, wherein, The SSR site sequence lengths of the primer pairs PS7-9 and PS14-4 are 20-28 bp.
4. A method for identifying a Prunus domestica high sugar content germplasm, characterized by, Includes the following steps: Young leaves were collected from the plum trees to be tested, and genomic DNA was extracted. Prepare a PCR reaction premix with a total volume of 10 μL. Run the PCR amplification program on the PCR reaction premix to obtain the amplification product. The amplification products were detected by capillary electrophoresis. The peaks of primer pair PS14-4 at 228bp and 238bp and primer pair PS7-9 at 231bp and 237bp were read. The bands with a concentration ≥0.4ng / µL were counted. The presence of a band was recorded as 1 and the absence of a band was recorded as 0. A 0 / 1 matrix list was created to complete the band statistics. Identification was performed based on band statistics. When primer pair PS14-4 amplified the plum plant and the statistical value was 1 at both 228bp and 238bp, and primer pair PS7-9 amplified the plum plant plant and the statistical value was 1 at 231bp and 0 at 237bp, the plum plant plant was determined to be a high-sugar variety.
5. The method of identifying a Prunus salicina germplasm with high sugar content according to claim 1, characterized in that, The genomic DNA has an OD260 / OD280 value of 1.7-1.9 and a concentration of 22 ng / μL-300 ng / μL.
6. The method of identifying a Prunus salicina germplasm with high sugar content according to claim 1, characterized in that, The PCR reaction premix includes 5µL Taq PCR Mix, 0.5µL each of the forward and reverse primers for primer pair PS7-9 and primer pair PS14-4, 1µL template DNA, and double-distilled water to a final volume of 10µL. The Taq PCR Mi contains 0.1 U Taq Polymerase / µL, 500 µM dNTP each, 20 mM Tris-HCl, 100 mM KCl, and 3 mM MgCl2.
7. The method of identifying a Prunus salicina germplasm with high sugar content according to claim 1, characterized in that, The specific steps of the PCR amplification procedure are as follows: Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s; annealing reaction at 50~60℃ for 30~45 s; extension reaction at 72℃ for 30~45 s; for a total of 35~40 cycles. Finally, extend at 72℃ for 7-10 minutes; store at 4℃ after amplification.
8. The method of identifying a Prunus salicina germplasm with high sugar content according to claim 1, characterized in that, The capillary electrophoresis detection was performed manually, and the same sample was subjected to at least three repeated PCR amplification and capillary electrophoresis detections.
9. A method for constructing a DNA fingerprint of a Prunus domestica cultivar, characterized by, Includes the following steps: Young leaves were collected from the plum trees to be tested, and genomic DNA was extracted. Based on genomic DNA, a PCR amplification procedure was performed using the SSR molecular marker primer pair combination of the Li SWEETs gene as described in claims 1 to 3 to obtain amplification products. The amplification products were detected by capillary electrophoresis, and bands with a concentration ≥0.4ng / µL were counted. The presence of bands at 228bp and 238bp for primer pair PS14-4 and at 231bp and 237bp for primer pair PS7-9 were recorded respectively. The presence of a stripe is recorded as 1, and the absence of a stripe is recorded as 0. The 0 and 1 values at 228bp, 238bp, 231bp, and 237bp are arranged to form the DNA fingerprint of the plum plant to be tested.
10. The application of an SSR molecular marker primer pair combination of the plum SWEETs gene as described in claims 1 to 3 in the identification of plum germplasm resources.
Citation Information
Patent Citations
Li SSR marker primers developed based on transcriptome sequences and their applications
CN105238781B
A molecular marker for Prunus species and its application
CN114574621B
Application of sugar transporter PpSWEET11 in regulation and control of hexose content of peach fruits
CN121109479A
Cherry sugar transporter gene CpSWEET10 and application thereof
CN121517521A