Application of InDel molecular markers in identifying or assisting in identifying small spike development in Leymus chinensis

Abstract

This application discloses the application of InDel molecular markers in the identification or auxiliary identification of spikelet development in Leymus chinensis, belonging to the field of molecular marker technology. To accurately screen Leymus chinensis with the target spikelet number trait using molecular markers, this application discloses InDel molecular markers related to spikelet number in Leymus chinensis and a detection composition. The InDel molecular markers include LcMPS1, LcMPS2, and LcMPS3. The molecular markers and their detection primer compositions provided in this application can effectively screen Leymus chinensis with a high spikelet number phenotype and are compatible with conventional PCR or high-throughput genotyping platforms, making them easy to promote in breeding practice. Furthermore, the molecular markers provided in this application are unaffected by environmental interference and can screen candidate Leymus chinensis with the target spikelet number phenotype for breeding at an early stage through molecular marker detection results, greatly improving the selection efficiency and accuracy of spikelet-related traits in Leymus chinensis.

Description

Technical Field

[0001] This application belongs to the field of molecular marker technology, specifically relating to the application of InDel molecular markers in the identification or auxiliary identification of Leymus chinensis spikelet development. Background Technology

[0002] sheepgrass ( Leymus chinensis Leymus is a perennial rhizomatous plant belonging to the genus Leymus in the tribe Triticum of the Poaceae family. Due to its outstanding drought resistance, salt and alkali resistance, and tolerance to poor soil, as well as its high nutritional value, it occupies a core position in ecological restoration and grassland animal husbandry development.

[0003] In grasses, the spikelet is the basic reproductive structural unit that constitutes the inflorescence and determines seed yield. The developmental status of the spikelets in Leymus chinensis, including but not limited to the number of spikelets, spikelet density, floret fertility, and timing of heading and flowering, directly determines the number of grains per spike and the seed setting rate, making them key agronomic traits affecting seed yield and biomass. In natural populations and germplasm resources, Leymus chinensis exhibits rich phenotypic variation in spikelet development. Therefore, identifying and aggregating genetic loci controlling desirable traits such as multiple spikelets, high fertility, and timely flowering is a core task and major challenge in current Leymus chinensis genetic breeding.

[0004] Currently, the selection of the aforementioned desirable traits in Leymus chinensis breeding practices mainly relies on traditional field phenotypic screening. This method requires breeding materials to reach the late reproductive growth stage before accurate identification can be performed, resulting in a long breeding cycle (usually 15 to 30 years). Furthermore, phenotypic expression is significantly affected by environmental conditions (such as moisture, temperature, and soil fertility) and annual fluctuations, exhibiting inherent drawbacks such as low selection efficiency, insufficient accuracy, and high costs, severely restricting the breeding efficiency and genetic gain of new Leymus chinensis varieties.

[0005] Marker-assisted selection (MAS) technology, by identifying DNA molecular markers closely linked to target traits, enables rapid, accurate, and environmentally resistant genotyping in early stages of plant growth and development (such as the seedling stage). It has been widely applied and highly successful in major crops such as rice, maize, and wheat. However, its application in Leymus chinensis has lagged significantly. The main reasons for this are the following technical bottlenecks: First, the Leymus chinensis genome is large and complex (it is an allotetraploid), with a complex genetic background and diverse phenotypic variations, making the development and localization of markers across the entire genome difficult. Second, the molecular genetics research foundation for the specific biological process of spikelet development in Leymus chinensis is extremely weak, lacking key candidate genes for reference. Third, the number of reported molecular markers for Leymus chinensis (such as SSR and RAPD) is limited, and most are related to stress resistance or simple qualitative traits. No practical molecular markers closely linked to complex quantitative traits such as spikelet number and fertility, suitable for efficient MAS, have been systematically developed and validated.

[0006] Therefore, overcoming the obstacles of the complexity of the Leymus chinensis genome and the weak foundation of genetic research, developing a set of stable and reliable molecular markers closely related to key quantitative traits in Leymus chinensis spikelet development, and establishing an efficient application system for them has become an urgent technical requirement to break through the traditional breeding bottlenecks of Leymus chinensis and achieve a leapfrog development in its breeding technology. This will not only provide direct tools for efficient molecular breeding of Leymus chinensis, but also lay a solid foundation for in-depth analysis of the molecular mechanisms of its reproductive development. Summary of the Invention

[0007] The technical problem this application aims to solve is: how to apply molecular markers to improve the breeding efficiency of Leymus chinensis, and more specifically, how to accurately screen Leymus chinensis with the target spikelet number trait using molecular markers. To solve this technical problem, this application provides the following technical solution: This application provides the application of InDel molecular markers or compositions for detecting said InDel molecular markers in the identification or auxiliary identification of spikelet number in Leymus chinensis, wherein said InDel molecular markers include LcMPS1, LcMPS2, and LcMPS3. The LcMPS1 is a DNA fragment whose nucleotide sequence is from position 459 to 466 (5'-GTTGAGCC-3') of SEQ ID NO:7; The LcMPS2 is a DNA fragment whose nucleotide sequence is from position 667 to 676 (5'-AGGTCTAAGC-3') of SEQ ID NO:8; The LcMPS3 is a DNA fragment whose nucleotide sequence is SEQ ID NO:9, positions 1133 to 1142 (5'-CGACGAGTAA-3').

[0008] In this application, the InDel molecular marker is composed of LcMPS1, LcMPS2 and LcMPS3.

[0009] The indicators for assessing spikelet development in Leymus chinensis include the number of spikelets. A spikelet is the basic unit of inflorescence in grasses and sedges, consisting of one or more florets, with two glumes at its base.

[0010] In this application, the composition may be a substance that detects the InDel molecular marker by at least one of the following methods: DNA sequencing, restriction enzyme fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and InDel chip.

[0011] The composition described in this application includes PCR primer pairs for amplifying genomic DNA fragments of Leymus chinensis containing LcMPS1, LcMPS2, or LcMPS3, respectively.

[0012] Specifically, the composition includes primer pairs for detecting whether a DNA fragment with a single strand of nucleotide sequence 5'-GTTGAGCC-3' is inserted between positions 458 and 467 of SEQ ID NO:7 in the Leymus chinensis genome, primer pairs for detecting whether a DNA fragment with a single strand of nucleotide sequence 5'-AGGTCTAAGC-3' is inserted between positions 666 and 677 of SEQ ID NO:8 in the Leymus chinensis genome, and primer pairs for detecting whether a DNA fragment with a single strand of nucleotide sequence 5'-CGACGAGTAA-3' is inserted between positions 1132 and 1143 of SEQ ID NO:9 in the Leymus chinensis genome.

[0013] In this application, the PCR primer pair for amplifying the Leymus chinensis genomic DNA fragment containing the LcMPS1 consists of a single-stranded DNA with the nucleotide sequence SEQ ID NO:1 (forward primer) and a single-stranded DNA with the nucleotide sequence SEQ ID NO:2 (reverse primer). The PCR primer pair for amplifying the Leymus chinensis genomic DNA fragment containing the LcMPS2 consists of a single-stranded DNA with the nucleotide sequence SEQ ID NO:3 (forward primer) and a single-stranded DNA with the nucleotide sequence SEQ ID NO:4 (reverse primer); The PCR primer pair for amplifying the Leymus chinensis genomic DNA fragment containing the LcMPS3 consists of a single-stranded DNA with the nucleotide sequence SEQ ID NO:5 (forward primer) and a single-stranded DNA with the nucleotide sequence SEQ ID NO:6 (reverse primer).

[0014] In this application, the PCR primer pairs may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moieties (positive or negative) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without a marker (e.g., direct sequence reading).

[0015] This application also provides the use of the above-described InDel molecular markers and / or the above-described compositions in at least one of the following: (A1) Application in identifying or assisting in the identification of whether the Leymus chinensis to be tested is a germplasm material with a high spikelet number; (A2) Application in identifying or assisting in the identification of whether the Leymus chinensis to be tested is a germplasm material with a low spikelet number; (A3) Application in screening or assisting in screening Leymus chinensis germplasm materials with high spikelet number; (A4) Application in screening or assisting in screening Leymus chinensis germplasm materials with low spikelet number; (A5) Application in comparing or assisting in the comparison of the number of spikelets of Leymus chinensis to be tested.

[0016] This application also provides the use of the above-described composition in at least one of the following: (B1) Application in the preparation of products for identification or auxiliary identification of whether the test Leymus chinensis is a germplasm material with a high spikelet number; (B2) Application in the preparation of products for identifying or assisting in the identification of whether the test Leymus chinensis is a germplasm material with a low spikelet number; (B3) Application in the preparation of products for screening or assisting in the screening of Leymus chinensis germplasm materials with high spikelet number; (B4) Application in the preparation of products for screening or assisting in the screening of Leymus chinensis germplasm materials with low spikelet number; (B5) Application in the preparation of products for comparison or auxiliary comparison of the number of spikelets of Leymus chinensis to be tested.

[0017] The products include reagents, probes, or kits for detecting or assisting in the detection of the InDel molecular markers described above.

[0018] This application also provides a method for identifying or assisting in the identification of whether a test specimen of Leymus chinensis is a germplasm material with a high spikelet number. The method includes the step of identifying or assisting in the identification of whether the test specimen of Leymus chinensis is a germplasm material with a high spikelet number by whether the test specimen of Leymus chinensis contains the above-mentioned InDel molecular marker.

[0019] In this application, the Leymus chinensis sample containing the above-mentioned InDel molecular marker is or is a candidate Leymus chinensis germplasm material with a high spikelet number.

[0020] In this application, the Leymus chinensis test material that does not contain the above-mentioned InDel molecular marker is or is a candidate for Leymus chinensis germplasm material with low spikelet number.

[0021] This application also provides a method for comparing or assisting in comparing the number of spikelets of Leymus chinensis, the method comprising the step of comparing or assisting in comparing the number of spikelets of Leymus chinensis by whether the Leymus chinensis to be tested contains the above-mentioned InDel molecular marker.

[0022] In this application, the number of spikelets of the tested Leymus chinensis containing the above-mentioned InDel molecular marker is higher than or higher than that of the tested Leymus chinensis without the above-mentioned InDel molecular marker.

[0023] In this application, whether the sheepgrass to be tested contains the above-mentioned InDel molecular marker can be obtained by using the above-mentioned composition.

[0024] In this application, the steps for detecting whether the test plant, *Leymus chinensis*, contains the aforementioned InDel molecular marker using the above-described composition are as follows: (S1) Using the genomic DNA of the target sheepgrass as a template, and the above-mentioned composition as amplification primers, PCR amplification was performed; (S2) The amplification products are subjected to gel electrophoresis or sequencing.

[0025] In this application, the compositions shown in SEQ ID NO:1 and SEQ ID NO:2 amplify the *Leymus chinensis* genomic DNA fragment including LcMPS1. The compositions shown in SEQ ID NO:3 and SEQ ID NO:4 amplify the *Leymus chinensis* genomic DNA fragment including LcMPS2. The primer compositions of SEQ ID NO:5 and SEQ ID NO:6 amplify the *Leymus chinensis* genomic DNA fragment including LcMPS3.

[0026] In gel electrophoresis, the amplified products containing three bands ranging in size from 250bp to 2000bp in the *Leymus chinensis* sample contained the InDel molecular markers, namely LcMPS1, LcMPS2, and LcMPS3. Based on this result, the *Leymus chinensis* candidate sample was determined to be *Leymus chinensis* with a high spikelet number phenotype.

[0027] During gel electrophoresis, the *Leymus chinensis* sample without any of the three bands ranging in size from 250 bp to 2000 bpp in the amplification products did not contain the InDel molecular markers, i.e., LcMPS1, LcMPS2, and LcMPS3. Based on this result, the *Leymus chinensis* candidate sample was determined to be *Leymus chinensis* with a low spikelet number phenotype.

[0028] In gel electrophoresis, the tested Leymus chinensis containing one or two bands in the 250bp-2000bp range of amplified products contains one or two of the InDel molecular markers (LcMPS1, LcMPS2, and LcMPS3). Based on this result, the number of spikelets in the tested Leymus chinensis is determined to be between the high spikelet number and the low spikelet number.

[0029] In this application, the Leymus chinensis samples containing the aforementioned InDel molecular markers LcMPS1, LcMPS2 and LcMPS3 are or candidate Leymus chinensis germplasm materials with high spikelet number.

[0030] In this application, the Leymus chinensis samples that do not contain the aforementioned InDel molecular markers LcMPS1, LcMPS2 and LcMPS3 are or are candidate Leymus chinensis germplasm materials with low spikelet number.

[0031] In this application, the number of spikelets of the tested Leymus chinensis containing the above-mentioned InDel molecular markers LcMPS1, LcMPS2 and LcMPS3 is higher than or higher than that of the tested Leymus chinensis without the above-mentioned InDel molecular markers.

[0032] This application also provides a method for breeding or assisted breeding of Leymus chinensis, the method comprising the step of using Leymus chinensis containing the above-mentioned InDel molecular marker as a parent for breeding.

[0033] In some embodiments of this application, the indicator for Leymus chinensis breeding includes the number of spikelets. The purpose of the Leymus chinensis breeding includes cultivating Leymus chinensis germplasm materials with a high number of spikelets.

[0034] The above-described composition is also protected under this application.

[0035] The above-described composition can be used to identify or assist in identifying the spikelet number of Leymus chinensis. The above-described composition can also be used to screen or assist in screening candidate Leymus chinensis with high or low spikelet numbers. The above-described composition can also be used to compare or assist in comparing the spikelet number of candidate Leymus chinensis.

[0036] In this application, the number of spikelets can be no less than 26.

[0037] In this application, the low number of spikelets can be no more than 16 spikelets.

[0038] In this application, the InDel molecular marker or the composition for detecting the InDel molecular marker can be used for identification or auxiliary identification, comparison or auxiliary comparison, and screening or auxiliary screening of spikelet development in Leymus chinensis seedlings.

[0039] In this application, when used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0040] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0041] The molecular markers described in this application refer to specific DNA fragments that can reflect certain differences in the genomes of individual organisms or populations.

[0042] In this application, InDel (insertion-deletion) refers to the nucleotide insertion or deletion differences between two parents at the whole-genome level. Molecular markers can be formed by amplifying and detecting insertion / deletion sites using designed specific PCR primers.

[0043] The beneficial technical effects achieved by this application are as follows: (1) The molecular markers and their detection primer compositions provided in this application can effectively screen or assist in screening sheepgrass with a high spikelet number phenotype. The provided molecular markers and primer compositions are compatible with conventional PCR or high-throughput genotyping platforms and are easy to promote in breeding practice.

[0044] (2) The molecular markers provided in this application are not affected by the environment and can be used to screen candidates with the target phenotype for breeding in the early stage through the detection results of molecular markers, which greatly improves the selection efficiency and accuracy of spikelet-related traits of Leymus chinensis.

[0045] (3) This application not only provides a practical tool, but also lays the foundation for in-depth analysis of the molecular genetic mechanism of spikelet development of Leymus chinensis, which helps to promote the transformation of Leymus chinensis from traditional breeding to precision breeding. Attached Figure Description

[0046] Figure 1Statistics on the distribution of spikelet number in the main spikelet of a natural population.

[0047] Figure 2 Statistics on spikelet density distribution in natural populations.

[0048] Figure 3 This is a distribution map of the Indel population in natural populations.

[0049] Figure 4 The results of the association analysis between Indel molecular markers and spikelet fertility of Leymus chinensis are presented.

[0050] Figure 5 The amplification results of LcMPSTAS in samples with high spikelet number (H) and low spikelet number (L).

[0051] Figure 6 Genotypic and phenotypic data for the 1st to 25th individual plants of Leymus chinensis from 100 F1 segregating populations.

[0052] Figure 7 Genotypic and phenotypic data for the 26th–50th individual plants of Leymus chinensis from 100 F1 segregating populations.

[0053] Figure 8 Genotypic and phenotypic data for Leymus chinensis plants 51–75 from 100 F1 segregating populations.

[0054] Figure 9 Genotypic and phenotypic data for the 76th–100th individual plantlets of Leymus chinensis in a 100 F1 segregating population.

[0055] Figure 10 The LcMPSTAS electrophoresis results of 30 random individual samples from the F1 segregating population.

[0056] Figure 11 Photographs of the ear of 30 random individual plants from the F1 segregating population.

[0057] Figure 12 The results of the genotype-phenotype association analysis between LcMPSTAS detection results and spikelet number phenotype are presented. Detailed Implementation

[0058] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] The *Leymus chinensis* cultivars described in the following examples are varieties bred by the team of researcher Liu Gongshe at the Institute of Botany, Chinese Academy of Sciences. The public may apply to obtain the aforementioned *Leymus chinensis* materials from the applicant within twenty years from the date of this application. The obtained materials may only be used for verification of the technical solution of this application and may not be used for other purposes.

[0061] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0062] Example 1. Development of Molecular Markers 1. Field planting and phenotypic identification of materials Two hundred accessions of Leymus chinensis germplasm resources from different sources (including bred varieties of Leymus chinensis from the CAS series, new lines, and key breeding materials) were selected and field-planted in April 2016 at the Leymus chinensis germplasm resource nursery of the Institute of Botany, Chinese Academy of Sciences, Haidian District, Beijing. Each germplasm was planted in a single PVC container, 60 cm in length and 30 cm in diameter, and was managed using conventional field methods. From the heading to maturity stage, a precise survey of spikelet traits was conducted on 30 individual plants from each material. Measurement indicators included: number of spikelets in the main spike (count) and spikelet density (number of spikelets / column length, unit: spikelets / cm). Spikelet trait data were measured for three consecutive years in 2018, 2019, and 2020. The frequency distributions of spikelet number and spikelet density are shown below. Figure 1 and Figure 2 As shown. Through phenotypic data analysis, Leymus chinensis germplasm with an average spikelet number ≥26 was identified as high spikelet number samples, and Leymus chinensis germplasm with a spikelet number ≤16 was identified as low spikelet number samples. Two materials with extreme differences in spikelet number trait were screened out: Leymus chinensis 'Zhongke No. 3' (LC-HS117) was a high spikelet number material with an average of 30 spikelets / spike; Leymus chinensis 'Zhongke No. 1' (LC-LS29) was a low spikelet number material with an average of 12 spikelets / spike; the phenotypic difference between the two was extremely significant (P<0.01).

[0063] 2. DNA extraction and high-throughput sequencing Young leaves from the above-mentioned germplasm resources, F1 offspring from artificial hybridization, and both parents were collected and flash-frozen in liquid nitrogen. Genomic DNA was extracted using a modified CTAB method. The specific steps are as follows: 0.1 g of leaves were ground in liquid nitrogen, and 1 mL of CTAB extraction buffer (2% (v / v), 100 mM Tris-HCl (pH 8.0), 20 mM EDTA, 1.4 M NaCl, solvent: H2O) preheated at 65℃ was added, and the mixture was incubated in a water bath at 65℃ for 1 hour; extraction was performed using an equal volume of chloroform:isoamyl alcohol (24:1); the supernatant was precipitated with 2 / 3 volume of isopropanol; after washing with 70% ethanol aqueous solution, the DNA was dissolved in 50 μL of TE buffer. The DNA concentration and mass were detected by Nanodrop and 1% agarose gel electrophoresis, and the concentration was uniformly diluted to 50 ng / μL.

[0064] Whole-genome resequencing was performed on DNA samples from both parents and the population. Library construction was performed using the Illumina TruSeq Nano DNA LT Library Prep Kit, the sequencing platform was Illumina NovaSeq 6000, the sequencing strategy was PE150, and the average sequencing depth was 9×.

[0065] 3. Bioinformatics Analysis and Label Development 3.1. Data Preprocessing and Variant Detection: FastP software was used for quality control of the raw sequencing data, removing low-quality reads and adapter sequences. BWA software was used to align clean reads to the *Leymus chinensis* reference genome. GATK best practices were employed for combined SNP and InDel detection and genotyping. Figure 3 ).

[0066] 3.2. Population Structure and Association Analysis: High-quality SNPs were screened using Plink software (MAF > 0.05, deletion rate < 0.1%), yielding approximately 18 million high-quality SNP loci. Population structure analysis (K value 1-10) was performed using ADMIXTURE software to determine the optimal population grouping. Genome-wide association analysis was conducted using the MLM model in TASSEL software, with population structure (Q matrix) and phylogenetic relationships (K matrix) as covariates. A LOD value > 5.0 (equivalent to P < 1 × 10⁻⁶) was set. -5 The threshold for significant association was set at 0.5. The results showed that multiple genomic regions on chromosomes 1, 2, and 7 were found to be highly significantly associated with the spikelet number trait. Figure 4 ).

[0067] 3.3. Marker Development: Within this associated region, three InDel sites exhibiting stable polymorphism and significant differences in allele frequency within the population (ΔAF>0.6) were selected. Forward primers were designed approximately 400-1200 Å upstream of the INDEL site, and reverse specific primers were designed at the INDEL site itself, leading to the design of specific PCR primers. In samples with high spikelet counts, all three primer pairs bound perfectly, yielding complete PCR products. In samples with low spikelet counts, due to missing positional sequence information, none of the three primer pairs bound, preventing PCR amplification. In samples with intermediate spikelet counts, partial primer binding occurred, producing one or two PCR amplification products. The presence of INDELs and the range of spikelet counts in the sample were determined based on the electrophoresis results of the PCR products. These three INDELs constituted a molecular marker combination named LcMPSTAS.

[0068] Three INDEL molecular markers were named INDEL molecular marker LcMPS1, INDEL molecular marker LcMPS2, and INDEL molecular marker LcMPS3. INDEL molecular marker LcMPS1 is a DNA fragment with the nucleotide sequence of SEQ ID NO:7, positions 459 to 466 (5'-GTTGAGCC-3'); INDEL molecular marker LcMPS2 is a DNA fragment with the nucleotide sequence of SEQ ID NO:8, positions 667 to 676 (5'-AGGTCTAAGC-3'); and INDEL molecular marker LcMPS3 is a DNA fragment with the nucleotide sequence of SEQ ID NO:9, positions 1133 to 1142 (5'-CGACGAGTAA-3').

[0069] The specific primers developed for the INDEL molecular marker LcMPS1 are as follows: LcMPS1 forward primer: 5'-AAACTAGGCATGACCGAATAACC-3' (SEQ ID NO: 1); LcMPS1 reverse primer: 5'-TCATCTTCATGGCTCAACGTATAGCC-3' (SEQ ID NO:2).

[0070] The single-stranded DNA molecules shown in SEQ ID NO:1 and SEQ ID NO:2 form a primer pair to detect whether a DNA fragment with the nucleotide sequence 5'-GTTGAGCC-3' (positions 459 and 466 of SEQ ID NO:7) is inserted between positions 458 and 467 of SEQ ID NO:7 in the Leymus chinensis genome. Specifically, using the genomic DNA of *Leymus chinensis* as a template, PCR amplification was performed using primers specifically targeting the INDEL molecular marker LcMPS1. *Leymus chinensis* containing the INDEL molecular marker LcMPS1 produced a PCR amplification product of 476 bp, and the result was deemed positive, indicating that a DNA fragment with a 5'-GTTGAGCC-3' nucleotide sequence inserted between positions 458 and 467 of SEQ ID NO:7 of the *Leymus chinensis* genome was present. *Leymus chinensis* without the INDEL molecular marker produced no amplification product, and the result was deemed negative, indicating that a DNA fragment with a 5'-GTTGAGCC-3' nucleotide sequence deleted between positions 458 and 467 of SEQ ID NO:7 of the *Leymus chinensis* genome was present.

[0071] The specific primers developed for the INDEL molecular marker LcMPS2 are as follows: LcMPS2 forward primer: 5'-ATCCTTGTGAAGTTCTGTCCTGGTG-3' (SEQ ID NO: 3); LcMPS2 reverse primer: 5'-CGTACGCGCGCTTAGACCTTGGTG-3' (SEQ ID NO:4).

[0072] The single-stranded DNA molecules shown in SEQ ID NO:3 and SEQ ID NO:4 form a primer pair to detect whether a DNA fragment with the nucleotide sequence 5'-AGGTCTAAGC-3' (positions 667 and 676 of SEQ ID NO:8) is inserted between positions 666 and 677 of SEQ ID NO:8 in the Leymus chinensis genome. Specifically, using the genomic DNA of *Leymus chinensis* as a template, PCR amplification was performed using primers specifically targeting the INDEL molecular marker LcMPS2. *Leymus chinensis* containing the INDEL molecular marker LcMPS1 produced a PCR amplification product of 685 bp, and the result was deemed positive, indicating that a DNA fragment with a nucleotide sequence of 5'-AGGTCTAAGC-3' was inserted between positions 666 and 677 of SEQ ID NO:8 of the *Leymus chinensis* genome. *Leymus chinensis* without the INDEL molecular marker produced no amplification product, and the result was deemed negative, indicating that a DNA fragment with a nucleotide sequence of 5'-AGGTCTAAGC-3' was missing between positions 666 and 677 of SEQ ID NO:8 of the *Leymus chinensis* genome.

[0073] The specific primers developed for the INDEL molecular marker LcMPS2 are as follows: LcMPS3 forward primer: 5'-CTAACCATGTTTCTCATACATGTG-3' (SEQ ID NO: 5); LcMPS3 reverse primer: 5'-TGCATCATTTACTCGTCGGCGACG-3' (SEQ ID NO: 6).

[0074] The single-stranded DNA molecules shown in SEQ ID NO:5 and SEQ ID NO:6 form a primer pair used to detect whether a DNA fragment with the nucleotide sequence 5'-CGACGAGTAA-3' (positions 1133 to 1142 of SEQ ID NO:9) is inserted between positions 1132 and 1143 in the Leymus chinensis genome. Specifically, using the genomic DNA of *Leymus chinensis* as a template, PCR amplification was performed using primers specifically targeting the INDEL molecular marker LcMPS3. *Leymus chinensis* containing the INDEL molecular marker LcMPS1 produced a PCR amplification product of 1150 bp, and the result was deemed positive, indicating that a DNA fragment with an inserted nucleotide sequence of 5'-CGACGAGTAA-3' between positions 1132 and 1143 of SEQ ID NO:9 in the *Leymus chinensis* genome was present. *Leymus chinensis* without the INDEL molecular marker produced no amplification product, and the result was deemed negative, indicating that a DNA fragment with a deleted nucleotide sequence of 5'-CGACGAGTAA-3' between positions 1132 and 1143 of SEQ ID NO:9 in the *Leymus chinensis* genome was present.

[0075] Candidates of Leymus chinensis that are positive for all three INDEL molecular markers (LcMPS1, LcMPS2, and LcMPS3) are Leymus chinensis with high spikelet count; candidates that are negative for all three INDEL molecular markers are Leymus chinensis with low spikelet count; and candidates of Leymus chinensis containing one or two molecular markers are Leymus chinensis with a spikelet count between high and low spikelet count.

[0076] The nucleotide sequence of SEQ ID NO:7 is as follows: AAACTAGGCATGACCGAATAACCAAATTAAAGTAGATTTTGCTTATATATATCACCAAAAGGTTCCCGTTTTGAAATGTATCGATTGTTGTCCGGCCGGCTTTTGATTATTGTTTGATCTGGCCCTGATTCTAGCTCGATCCAAATCCAACGGCTAGTGGTTACTAGTTCTCCTACATACATGTACTTACATACCTACCTCTTACATGAGATGATGATTCATGTCTCTTGCAGATTAGTCTCGACCATACGAACTACGTGATGGAAATCTCTGGGACAGTGGGTAAATTTGAGAACGATGAAATCACAACGTCTCTTAAAATTGTCACATTGAAGGGGAGTCCCAGGACATATGGCTCAGCTACCGGGACTCCTTTCCGCATCCCGGTGCTCGACGGAGGTAAGGTGGTCCGCTTCTTTGCACGCGCTGGCGCCTTCCTGGACGCGATTGGGCTATACGTTGAGCCATGAAGATGA。

[0077] The nucleotide sequence of SEQ ID NO:8 is as follows: ATCCTTGTGAAGTTCTGTCCTGGTGCTAATTAGTTGTTTGCGGTTGTGCGTTCAGGTGATTTCACCCCGGTGTGCACGACGGAGCTGGCGGCGATGGCCAACTACGCCAAGGAGTTCGAGAAGAGGGGCGTCAAGCTGCTCGGCATCTCCTGCGACGACGTGCAGTCCCACAAAGAGTGGACCAAGGACATCGAGGCCTACAAGGTTCGCCGATAATCCGTGATCCCCATTTCGATTGCGTCTATCAGTGATTGATCTGGATCTGAAAATTCTGGCGCGTGCAGCCTGGGAGCAAGGTGACGTACCCGATCATGGCGGACCCGGACCGGTCGGCCATCAAGCAGCTCAACATGGTGGACCCGGACGAGAAGGACGGCGAGGGGCAGCTCCCGTCACGCACCCTGCACATCGTGGGGCCGGACAAGAAGGTGAAGCTGAGCTTCCTGTACCCGTCGTGCACGGGGCGGAACATGGACGAGGTGGTGCGCGCCGTGGACTCGCTGCTGACGGCGGCCAAGCACAAGGTGGCCACCCCGGCCAACTGGAAGCCCGGCGAGTGCGTGGTCATCGCGCCGGGCGTCTCCGACGACGAGGCCAGGAAGATGTTCTCGCAGGGGTTTGAGACCGCCGACCTGCCCTCCAAGAAGGGGTACCTCCGCTTCACCAAGGTCTAAGCGCGCGTACG。

[0078] The nucleotide sequence of SEQ ID NO:9 is as follows:

[0079] 4. Validation based on natural populations: Three Leymus chinensis germplasms with high spikelet counts (LC-HS117, Lc035, and Lc426) and three Leymus chinensis germplasms with low spikelet counts (Lc421, LC-LS29, and Lc319) were selected. DNA was extracted from seedling leaves after the plants turned green in spring. PCR amplification was performed using the three primer pairs mentioned above, with one primer pair containing a molecular marker added to each reaction system.

[0080] Reaction system (20 μL): 10 μL of 2× Taq Master Mix, 0.5 μM each of forward and reverse primers, 50 ng of template DNA, and ddH2O to make up the volume.

[0081] PCR program: 95℃ for 5 min; 35 cycles (95℃ for 30 s, 58-60℃ for 30 s, 72℃ for 30 s); 72℃ for 5 min. PCR products were electrophoresed on a 1.2% agarose gel at 160V for 50 minutes. The genotype of each material was recorded.

[0082] The results are as follows Figure 5 As shown, Figure 5 The Maker (Jiangsu Kangwei Century Biotechnology Co., Ltd., product number: DM2000) bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Figure 5 From top to bottom, LC-HS117, Lc035, and Lc426 contain PCR amplification products of LcMPS3, LcMPS2, and LcMPS1, respectively. The results show that all three high-spike-number Leymus chinensis germplasms (LC-HS117, Lc035, and Lc426) amplified three PCR products of the expected size, indicating that all three germplasms contain the three INDEL molecular markers LcMPS1, LcMPS2, and LcMPS3. The three low-spike-number Leymus chinensis germplasms (LC421, LC-LS29, and Lc319) did not amplify the expected PCR products, meaning they do not contain the three INDEL molecular markers LcMPS1, LcMPS2, and LcMPS3. The genotype is highly consistent with the spikelet quantitative trait.

[0083] Example 2. Validation and assisted selection of molecular markers in segregating populations 1. Hybridization and Segregation Population Construction In the 2021 growing season, artificial emasculation hybridization was performed using *Leymus chinensis* 'Zhongke No. 3' (LC-HS117, high spikelet number HS) as the female parent and *Leymus chinensis* 'Zhongke No. 1' (LC-LS29, low spikelet number LS) as the male parent to obtain F1 generation seeds. After seed collection in June 2021, 300 F1 generation plants were planted in the *Leymus chinensis* resource nursery of the Institute of Botany, Chinese Academy of Sciences, Haidian District, Beijing. Spikelet trait data of the F1 population were investigated for three consecutive years from 2023 to 2025. One hundred randomly selected individual plants from the F1 segregating population (300 plants) constructed in the examples were used as validation subjects; these individual plants already possessed mature spikelet trait data (number of spikelets).

[0084] 2. Laboratory testing Following the method described in "4. Validation based on natural populations" of Example 1, genomic DNA was extracted from young leaves of 100 individual plants using the LcMPSTAS marker combination for genotyping. The genotype of each individual plant was recorded, and the determination rules are as follows: In gel electrophoresis, the tested Leymus chinensis containing three bands in the 250bp-2000bp range of amplified products contained the InDel molecular markers, namely LcMPS1, LcMPS2, and LcMPS3. The LcMPSTAS genotype was indicated as positive homozygote. Based on this result, the tested Leymus chinensis was determined to have a high spikelet number phenotype.

[0085] In gel electrophoresis, the tested Leymus chinensis samples with no bands in the 250bp-2000bpp range did not contain the InDel molecular markers, i.e., they did not contain LcMPS1, LcMPS2, and LcMPS3. The LcMPSTAS genotype was represented as negative homozygous. Based on this result, the tested Leymus chinensis was determined to have a low spikelet number phenotype.

[0086] In gel electrophoresis, the tested Leymus chinensis containing one or two bands in the 250bp-2000bp range contained one or two of the InDel molecular markers (LcMPS1, LcMPS2, and LcMPS3), and the LcMPSTAS genotype was represented by a heterozygous site. Based on this result, the number of spikelets in the tested Leymus chinensis was determined to be between high and low spikelet numbers, and the predicted spikelet number phenotype was represented by an intermediate state.

[0087] The LcMPSTAS test results for each individual plant were compared with the actual number of spikelets surveyed.

[0088] Figure 6 Hezhi Figure 9 The detection results of LcMPSTAS marker combinations and the spikelet number statistics for 100 F1 samples (where the spikelet number is the three-year average). Figure 10 Electrophoresis images of 30 random samples from the F1 segregating population, obtained using LcMPSTAS. Figure 11 Photos of spikelets corresponding to 30 samples.

[0089] The results showed that: 30 *Leymus chinensis* plants were classified as having a high spikelet number by LcMPSTAS testing, with ≥26 spikelets in 30 individual plants (100.0%), and a mean spikelet number of 30.23; 37 *Leymus chinensis* plants were classified as having a low spikelet number by LcMPSTAS testing, with ≤16 spikelets in 37 individual plants (100.0%), and a mean spikelet number of 13.27; the co-segregation ratio of marker and trait was 100%. 33 *Leymus chinensis* plants were classified as having an intermediate spikelet number by LcMPSTAS testing, with a mean spikelet number of 19.78. Genotype-phenotype association analysis results of LcMPSTAS testing results and spikelet number phenotype are shown below. Figure 12 .

[0090] The above results indicate that LcMPSTAS can effectively screen for candidate Leymus chinensis with high spikelet number or low spikelet number. This marker combination was used to test the seedling stage of an F1 population obtained by crossing Zhongke 3 (LC-HS117) with another low spikelet number material, Zhongke 1 (LC-LS29). At the seedling stage, H-type individual plants were selected for the next generation solely based on the LcMPSTAS marker. Compared to traditional methods (which require planting all individual plants for three years and then evaluating them during heading and grain-filling stages before selecting the best-performing Leymus chinensis germplasm), this method achieves the same effect at the seedling stage, avoiding the subsequent planting, management, and investigation costs of 90% of non-target individual plants, significantly improving selection efficiency and breeding speed. The selection cycle for this trait was shortened from 3-5 years to 3-5 months.

[0091] The above embodiments demonstrate that the LcMPSTAS molecular marker combination development process provided by this invention is clear, stable, and reliable. This marker combination is closely associated with spikelet number, a key yield trait in Leymus chinensis, and the accuracy rate in both natural and segregating populations reached 100%. Using this marker, high-throughput, low-cost, and high-accuracy genotyping can be achieved at the seedling stage of Leymus chinensis, shortening the selection cycle for spikelet number traits from several years to several months, reducing human and material costs by more than 90%. This provides a practical tool for molecular marker-assisted breeding of Leymus chinensis targeting complex quantitative traits and has significant prospects for industrial application.

[0092] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of InDel molecular markers or compositions for detecting said InDel molecular markers in the identification or auxiliary identification of Leymus chinensis spikelet number, characterized in that, The InDel molecular markers include LcMPS1, LcMPS2, and LcMPS3. The LcMPS1 is a DNA fragment whose nucleotide sequence is from position 459 to 466 of SEQ ID NO:7; The LcMPS2 is a DNA fragment whose nucleotide sequence is from position 667 to 676 of SEQ ID NO:8; The LcMPS3 is a DNA fragment whose nucleotide sequence is from position 1133 to 1142 of SEQ ID NO:9; The Leymus chinensis samples containing the InDel molecular marker are or are candidates for Leymus chinensis germplasm materials with high spikelet number; The Leymus chinensis samples without the InDel molecular marker are or are candidates for Leymus chinensis germplasm materials with low spikelet number.

2. The application according to claim 1, characterized in that, The composition includes PCR primer pairs for amplifying the *Leymus chinensis* genomic DNA fragment containing LcMPS1, PCR primer pairs for amplifying the *Leymus chinensis* genomic DNA fragment containing LcMPS2, and PCR primer pairs for amplifying the *Leymus chinensis* genomic DNA fragment containing LcMPS3.

3. The application according to claim 2, characterized in that, The PCR primer pair for amplifying the Leymus chinensis genomic DNA fragment containing the LcMPS1 consists of a single-stranded DNA with the nucleotide sequence SEQ ID NO:1 and a single-stranded DNA with the nucleotide sequence SEQ ID NO:

2. The PCR primer pair for amplifying the Leymus chinensis genomic DNA fragment containing the LcMPS2 consists of a single-stranded DNA with the nucleotide sequence SEQ ID NO:3 and a single-stranded DNA with the nucleotide sequence SEQ ID NO:

4. The PCR primer pair for amplifying the Leymus chinensis genomic DNA fragment containing the LcMPS3 consists of a single-stranded DNA with nucleotide sequence SEQ ID NO:5 and a single-stranded DNA with nucleotide sequence SEQ ID NO:

6.

4. The use of the InDel molecular marker as described in claim 1 or / and the composition of any one of claims 1 to 3 in at least one of the following: (A1) Application in identifying or assisting in the identification of whether the Leymus chinensis to be tested is a germplasm material with a high spikelet number; (A2) Application in identifying or assisting in the identification of whether the Leymus chinensis to be tested is a germplasm material with a low spikelet number; (A3) Application in screening or assisting in screening Leymus chinensis germplasm materials with high spikelet number; (A4) Application in screening or assisting in screening Leymus chinensis germplasm materials with low spikelet number; (A5) Application in comparing or assisting in the comparison of the number of spikelets of Leymus chinensis to be tested.

5. The use of the composition according to any one of claims 1 to 3 in at least one of the following: (B1) Application in the preparation of products for identification or auxiliary identification of whether the test Leymus chinensis is a germplasm material with a high spikelet number; (B2) Application in the preparation of products for identifying or assisting in the identification of whether the test sheepgrass is a germplasm material with a low spikelet number; (B3) Application in the preparation of products for screening or assisting in the screening of Leymus chinensis germplasm materials with high spikelet number; (B4) Application in the preparation of products for screening or assisting in the screening of Leymus chinensis germplasm materials with low spikelet number; (B5) Application in the preparation of products for comparison or auxiliary comparison of the number of spikelets of Leymus chinensis to be tested.

6. A method for identifying or assisting in the identification of whether a test specimen of Leymus chinensis is a germplasm material with a high spikelet number, the method comprising the step of identifying or assisting in the identification of whether the test specimen of Leymus chinensis contains the InDel molecular marker as described in claim 1; The Leymus chinensis samples containing the InDel molecular marker are or are candidates for Leymus chinensis germplasm materials with high spikelet number; The Leymus chinensis samples without the InDel molecular marker are or are candidates for Leymus chinensis germplasm materials with low spikelet number.

7. The method according to claim 6, characterized in that, Whether the sheepgrass to be tested contains the InDel molecular marker as described in claim 1 is detected by using the composition described in any one of claims 1 to 3.

8. A method for comparing or assisting in comparing the number of spikelets of Leymus chinensis, characterized in that, The method includes the step of comparing or assisting in comparing the number of spikelets of Leymus chinensis by determining whether the Leymus chinensis to be tested contains the InDel molecular marker as described in claim 1; The number of spikelets in the tested Leymus chinensis containing the InDel molecular marker was higher than or higher than that in the tested Leymus chinensis without the InDel molecular marker.

9. The method according to claim 8, characterized in that, Whether the sheepgrass to be tested contains the InDel molecular marker as described in claim 1 can be detected by using the composition described in any one of claims 1 to 3.

10. A method for breeding or assisted breeding of Leymus chinensis spikelet number trait, characterized in that, The method includes the step of breeding sheepgrass containing the InDel molecular marker as described in claim 1 as a parent.

Images