Nanobodies targeting psma and uses thereof

Abstract

The application belongs to the technical field of biology and specifically relates to a nano antibody targeting PSMA and application thereof. The nano antibody with a high PSMA protein binding rate is obtained through phage display technology combined with solid phase panning, multiple rounds of enrichment and monoclonal screening. The nano antibody is verified through ELISA and flow cytometry to ensure that the screened nano antibody can specifically bind to PSMA antigen and PSMA positive cells, and the binding positive rate meets the subsequent application requirements. Meanwhile, the nano antibody can be used as a core targeting element for further development of diagnostic reagents, imaging probes or therapeutic drugs, and provides a new candidate molecule for PSMA targeted diagnosis or treatment.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a nanobody that targets PSMA and its applications. Background Technology

[0002] Prostate cancer is one of the most common malignant tumors in men. Currently, clinical treatments for prostate cancer mainly include radical surgery, radiotherapy, endocrine therapy, and chemotherapy. However, for patients with metastases, the effectiveness of existing treatments remains limited, with a median survival of only about 12-15 months. Therefore, developing more precise diagnostic methods and more effective treatment strategies are core clinical problems that urgently need to be addressed in this field.

[0003] Prostate-specific membrane antigen (PSMA) is a type II transmembrane glycoprotein that is significantly overexpressed on the surface of prostate cancer cells. Its expression level is positively correlated with disease progression, especially peaking in metastatic castration-resistant prostate cancer. Due to its limited expression in normal tissues and its location on the cell membrane surface, which facilitates antibody binding, PSMA has become one of the most attractive targets in the diagnosis and treatment of prostate cancer.

[0004] Nanobodies (also known as single-domain antibodies or VHHs) are variable region fragments derived from natural heavy chain antibodies of camel-dwelling animals, with a molecular weight of approximately 12-15 kDa, making them the smallest known antigen-binding fragments. However, the types of anti-PSMA nanobodies reported to date are limited, and the availability of suitable molecular tools restricts the screening and application of nanobodies with different epitopes and properties. Furthermore, some existing nanobodies lack sufficient affinity or specificity, directly affecting the efficiency and accuracy of targeted binding.

[0005] Therefore, developing an efficient, low-cost, and high-affinity anti-PSMA nanobody has significant clinical application value and broad market prospects. Summary of the Invention

[0006] To address the shortcomings of the prior art, the present invention aims to provide a nanobody targeting PSMA and its application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention provides a PSMA-targeting nanobody, wherein the heavy chain variable region of the nanobody includes a complementarity-determining region and a framework region; the complementarity-determining region includes: (a1) CDR1 shown in SEQ ID NO:2, CDR2 shown in SEQ ID NO:4, and CDR3 shown in SEQ ID NO:6; or, (a2) CDR1 shown in SEQ ID NO:11, CDR2 shown in SEQ ID NO:13, and CDR3 shown in SEQ ID NO:15; or, (a3) CDR1 shown in SEQ ID NO:20, CDR2 shown in SEQ ID NO:22, and CDR3 shown in SEQ ID NO:24; or, (a4) CDR1 shown in SEQ ID NO:29, CDR2 shown in SEQ ID NO:31, and CDR3 shown in SEQ ID NO:33.

[0008] A second aspect of the invention provides isolated nucleic acid molecules that encode the nanobodies described in the first aspect.

[0009] A third aspect of the invention provides a carrier comprising the nucleic acid molecule described in the second aspect.

[0010] In a fourth aspect, a host cell is provided, comprising the nucleic acid molecule described in the third aspect or the vector described in the fourth aspect.

[0011] A fifth aspect of the present invention provides a method for preparing the nanobody described in the first aspect, comprising: culturing the host cell described in the fourth aspect under conditions that allow protein expression, and recovering the nanobody from the cultured host cell culture.

[0012] A sixth aspect of the invention provides a conjugate comprising the nanobody described in the first aspect and a conjugated portion.

[0013] A seventh aspect of the invention provides a pharmaceutical composition comprising the nanobody described in the first aspect, or the nucleic acid molecule described in the second aspect, or the carrier described in the third aspect, or the host cell described in the fourth aspect, or the conjugate described in the sixth aspect, and a pharmaceutically acceptable carrier and / or excipient.

[0014] An eighth aspect of the invention provides the use of the nanobody described in the first aspect, the nucleic acid molecule described in the second aspect, the carrier described in the third aspect, the host cell described in the fourth aspect, or the conjugate described in the sixth aspect in any of the following: (c1) Use in the preparation of medicaments for the prevention and / or treatment of diseases related to PSMA; (c2) Application in the preparation of diagnostic reagents for detecting the presence or level of PSMA in a sample or for diagnosing whether a subject has a disease related to PSMA.

[0015] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention employs phage display technology combined with solid-phase panning. Through multiple rounds of enrichment and monoclonal screening, nanobodies with high binding rates to PSMA protein were obtained, enriching the molecular library of anti-PSMA nanobodies and providing new tool molecules for subsequent research. ELISA and flow cytometry verification ensured that the screened nanobodies could specifically bind to PSMA antigen and PSMA-positive cells, with a binding positivity rate meeting the requirements for subsequent applications. Furthermore, the nanobodies of this invention can serve as core targeting elements for further development of diagnostic reagents, imaging probes, or therapeutic drugs, providing new candidate molecules for PSMA-targeted diagnosis or treatment. Attached Figure Description

[0016] Figure 1 The first round of electrophoresis gel imaging was used to screen bacteriophages, where lane M represents the DNA molecular marker and lanes 1 to 2 represent the first round of amplification products.

[0017] Figure 2 The second round of electrophoresis gel imaging was used to screen bacteriophages, where lane M represents the DNA molecular marker and lanes 1 to 3 represent the second round of amplification products.

[0018] Figure 3 This is a gel electrophoresis image after enzyme digestion, where lane M represents a DNA molecular marker.

[0019] Figure 4 Enrichment factors were selected for nanobody phages, where R1 represents the first round, R2 the second round, R3 the third round, and R4 the fourth round.

[0020] Figure 5 For monoclonal phage OD 450nm and negative control OD 450nm The ratios are given, where A is the ratio of clones 1 to 30, B is the ratio of clones 31 to 60, and C is the ratio of clones 61 to 80.

[0021] Figure 6 The results are for verifying the affinity of PSMA nanobodies.

[0022] Figure 7 To detect the specificity of PSMA nanobodies by flow cytometry, A is a blank control and B is a 6B10-1 nanobodies.

[0023] Figure 8 To detect the specificity of PSMA nanobodies by flow cytometry, A is a blank control and B is 1A12-1 nanobodies.

[0024] Figure 9 To detect the specificity of PSMA nanobodies by flow cytometry, A is a blank control and B is a 4B2-1 nanobodies.

[0025] Figure 10 To detect the specificity of PSMA nanobodies by flow cytometry, A is a blank control and B is a 3H8-1 nanobodies. Detailed Implementation

[0026] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0027] Unless otherwise specified, the experimental methods used in the following embodiments are substantially the same as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and F.M. Ausubel et al., A Concise Guide to Molecular Biology, 3rd Edition, John Wiley & Sons, Inc., 1995. Those skilled in the art will understand that the embodiments are described by way of example and are not intended to limit the scope of the invention.

[0028] In one specific embodiment of the present invention, a PSMA-targeting nanobody is provided, wherein the heavy chain variable region of the nanobody includes a complementarity-determining region and a framework region; the complementarity-determining region includes: (a1) CDR1 shown in SEQ ID NO:2, CDR2 shown in SEQ ID NO:4, and CDR3 shown in SEQ ID NO:6; or, (a2) CDR1 shown in SEQ ID NO:11, CDR2 shown in SEQ ID NO:13, and CDR3 shown in SEQ ID NO:15; or, (a3) CDR1 shown in SEQ ID NO:20, CDR2 shown in SEQ ID NO:22, and CDR3 shown in SEQ ID NO:24; or, (a4) CDR1 shown in SEQ ID NO:29, CDR2 shown in SEQ ID NO:31, and CDR3 shown in SEQ ID NO:33.

[0029] The nanobodies described herein typically comprise a VHH consisting of four framework regions (FRs) and three complementarity-determining regions (CDRs), referred to as FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The antigen-binding fragment comprises at least a portion of the nanobody, sufficient to confer specific binding of the fragment to TNF. The ability of α. In some embodiments, the nanobody described in this invention may be truncated at the N-terminus or C-terminus to contain only a portion of FR1 and / or FR4, or to lack one or both of those backbone regions, as long as it substantially maintains antigen binding and specificity.

[0030] In some embodiments, the nanobody comprises a heavy chain framework region derived from human immunoglobulins (e.g., a heavy chain framework region contained in the amino acid sequence encoded by a human heavy chain germline antibody gene), the heavy chain framework region optionally comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) reversion mutations from human residues to camel residues.

[0031] In some embodiments, the nanobody comprises a framework region derived from a camel-derived heavy chain antibody.

[0032] In some implementations, the frame region includes: (b1) FR1 shown in SEQ ID NO:1, FR2 shown in SEQ ID NO:3, FR3 shown in SEQ ID NO:5, and FR4 shown in SEQ ID NO:7; or, (b2) FR1 shown in SEQ ID NO:10, FR2 shown in SEQ ID NO:12, FR3 shown in SEQ ID NO:14, and FR4 shown in SEQ ID NO:7; or, (b3) FR1 shown in SEQ ID NO:19, FR2 shown in SEQ ID NO:21, FR3 shown in SEQ ID NO:23, and FR4 shown in SEQ ID NO:25; or, (b4) FR1 shown in SEQ ID NO:28, FR2 shown in SEQ ID NO:30, FR3 shown in SEQ ID NO:32, and FR4 shown in SEQ ID NO:34.

[0033] In some embodiments, the nanobody comprises the sequence shown in any one of SEQ ID NO:8, SEQ ID NO:17, SEQ ID NO:26, and SEQ ID NO:35.

[0034] The sequences shown here do not contain an amino acid (such as methionine (Met)) encoded by a start codon (such as ATG) at their N-terminus. Those skilled in the art will understand that during the preparation of proteins through genetic engineering, the first molecule of the resulting polypeptide chain often contains an amino acid (such as Met) encoded by the start codon due to the effect of the start codon. The nanobodies or antigen-binding fragments of the present invention encompass not only amino acid sequences that do not contain an amino acid (such as Met) encoded by a start codon at their N-terminus, but also amino acid sequences that do contain an amino acid (such as Met) encoded by a start codon at their N-terminus. Therefore, sequences that further contain an amino acid (such as Met) encoded by a start codon at the N-terminus of the aforementioned amino acid sequences are also within the scope of protection of the present invention.

[0035] The nanobodies or antigen-binding fragments of the present invention may include variants that differ from their derived nanobodies or antigen-binding fragments only in one or more (e.g., up to 20, 15, 10, or 5 conserved substitutions of amino acid residues) conserved substitutions, or have at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with their derived antibodies or antigen-binding fragments, and substantially retain the biological function of their derived nanobodies or antigen-binding fragments (e.g., specific binding of PSMA, neutralization of PSMA biological activity).

[0036] In another specific embodiment of the invention, isolated nucleic acid molecules are provided, said nucleic acid molecules encoding the nanobody described in the invention.

[0037] In some embodiments, the nucleic acid molecule encoding the heavy chain variable region of the nanobody described in this invention is selected from the sequences shown in either SEQ ID NO:9 or SEQ ID NO:17.

[0038] In another specific embodiment of the present invention, a carrier is provided which comprises the nucleic acid molecule described in the present invention.

[0039] In some embodiments, the vector of the present invention may be a plasmid, a granule, a bacteriophage, etc.

[0040] In another specific embodiment of the invention, a host cell is provided, which comprises the nucleic acid molecule or the vector described in the invention. Such host cells include, but are not limited to, prokaryotic cells such as Escherichia coli cells, and eukaryotic cells such as yeast cells, insect cells, plant cells, and animal cells (such as mammalian cells, such as mouse cells, human cells, etc.).

[0041] In another specific embodiment of the present invention, the method for preparing the nanobody according to the first aspect of the present invention includes: culturing the host cell according to the present invention under conditions that allow protein expression, and recovering the nanobody from the cultured host cell culture.

[0042] The antibodies of the present invention can be prepared by various methods known in the art, such as through genetic engineering recombination techniques. For example, DNA molecules encoding the antibodies of the present invention can be obtained by chemical synthesis or PCR amplification, the resulting DNA molecules can be inserted into an expression vector, and then transfected into host cells. The transfected host cells can then be cultured under specific conditions to express the antibodies of the present invention.

[0043] In another specific embodiment of the present invention, a conjugate is provided, comprising the nanobody described in the present invention and the conjugation portion.

[0044] In some embodiments, the nanoantibodies of the present invention are optionally conjugated to the coupling portion via a linker.

[0045] In some embodiments, the coupling portion is selected from protein tags. Such protein tags are well known in the art, and examples include, but are not limited to, His, Flag, GST, MBP, HA, Myc, GFP, or biotin, and those skilled in the art know how to select a suitable protein tag according to the desired purpose (e.g., purification, detection, or tracing).

[0046] In some embodiments, the coupling portion is selected from detectable markers, such as enzymes (e.g., horseradish peroxidase), radionuclides, fluorescent dyes, luminescent substances (e.g., chemiluminescent substances), or biotin. The detectable markers described in this invention can be any substance detectable by fluorescence, spectroscopy, photochemistry, biochemistry, immunology, electrical, optical, or chemical means. Such markers are well known in the art, and examples include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, β-phosphatase). Galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g., 3H, 125I, 35S, 14C, or 32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas Red, rhodamine, quantum dots or cyanine dye derivatives (e.g., Cy7, Alexa 750), luminescent substances (e.g., chemiluminescent substances, such as acridinium esters), magnetic beads, calorimetric labels such as colloidal gold or colored glass or plastics (e.g., polystyrene, polypropylene, latex, etc.), and biotin for binding avidin (e.g., streptavidin) modified with the above-mentioned labels. In some embodiments, such labels are suitable for immunological detection (e.g., enzyme-linked immunosorbent assay, radioimmunoassay, fluorescence immunoassay, chemiluminescent immunoassay, etc.).

[0047] In some embodiments, the detectable markers described above can be linked to the nanobodies or antigen-binding fragments of the present invention via linkers of varying lengths to reduce potential steric hindrance.

[0048] In some embodiments, the coupling portion is selected from therapeutic agents, such as anti-inflammatory drugs or immunosuppressants.

[0049] In some embodiments, the coupling portion is selected from other bioactive peptides.

[0050] In another specific embodiment of the invention, a pharmaceutical composition is provided comprising the nanobody, isolated nucleic acid molecule, carrier, host cell, or conjugate described herein, and pharmaceutically acceptable carrier and / or excipient.

[0051] In some embodiments, the pharmaceutical composition may also contain additional pharmaceutically active agents.

[0052] In some embodiments, the nanobody, isolated nucleic acid molecule, carrier, host cell, or conjugate of the present invention, along with the additional pharmaceutically active agent, can be provided as separate components or as mixed components in the pharmaceutical composition. Therefore, the isolated nucleic acid molecule, carrier, host cell, or conjugate of the nanobody of the present invention, along with the additional pharmaceutically active agent, can be administered simultaneously, separately, or sequentially.

[0053] In some embodiments, the pharmaceutically acceptable carrier and / or excipient may comprise a sterile injectable liquid (such as an aqueous or non-aqueous suspension or solution). In some exemplary embodiments, such a sterile injectable liquid is selected from water for injection (WFI), bacteriostatic water for injection (BWFI), sodium chloride solution (e.g., 0.9% (w / v) NaCl), glucose solution (e.g., 5% glucose), solution containing surfactant (e.g., 0.01% polysorbate 20), pH buffer solution (e.g., phosphate buffer solution), Ringer's solution, and any combination thereof.

[0054] The pharmaceutical compositions of the present invention may include, in a “therapeutic effective amount” or “preventative effective amount”, nanobodies, isolated nucleic acid molecules, carriers, host cells, or conjugates described herein. A “preventative effective amount” refers to an amount sufficient to prevent, stop, or delay the onset of a disease. A “therapeutic effective amount” refers to an amount sufficient to cure or at least partially stop the disease and its complications in a patient already suffering from the disease. Therapeutic effective amounts may vary depending on factors such as the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general characteristics such as age, weight, and sex, the method of administration of the drug, and other concurrent treatments, etc.

[0055] In another specific embodiment of the present invention, the use of the nanobodies, isolated nucleic acid molecules, carriers, host cells, or conjugates described herein is provided in any of the following: (c1) Use in the preparation of medicaments for the prevention and / or treatment of diseases related to PSMA; (c2) Application in the preparation of diagnostic reagents for detecting the presence or level of PSMA in a sample or for diagnosing whether a subject has a disease related to PSMA.

[0056] In some embodiments, the PSMA-related disease is characterized by elevated PSMA expression and / or excessive PSMA activity.

[0057] In some implementations, the disease associated with PSMA is a tumor.

[0058] In some embodiments, the tumor is prostate cancer.

[0059] In some implementations, the subject is a mammal, such as a human.

[0060] In some embodiments, the nanobody, isolated nucleic acid molecule, carrier, host cell, or pharmaceutical composition may be used alone or in combination with other pharmaceutically active agents (e.g., anti-inflammatory drugs or immunosuppressants).

[0061] The nanobodies, isolated nucleic acid molecules, carriers, host cells, or conjugates of the present invention, or the pharmaceutical compositions of the present invention, can be formulated into any dosage form known in the medical field, such as tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injection solutions, sterile powders for injection, and concentrated solutions for injection), inhalers, sprays, etc. Preferred dosage forms depend on the intended route of administration and therapeutic use.

[0062] A preferred dosage form is an injection. Such injections can be sterile injectable solutions. For example, sterile injectable solutions can be prepared by incorporating the required dose of the antibody or antigen-binding fragment of the present invention into a suitable solvent, and optionally, simultaneously incorporating other desired components (including, but not limited to, pH adjusters, surfactants, adjuvants, ionic strength enhancers, isotonic agents, preservatives, diluents, or any combination thereof), followed by sterile filtration. Alternatively, sterile injectable solutions can be prepared as sterile lyophilized powders (e.g., by vacuum drying or freeze-drying) for easy storage and use. Such sterile lyophilized powders can be dispersed in a suitable carrier before use, such as water for injection (WFI), antibacterial water for injection (BWFI), sodium chloride solution (e.g., 0.9% (w / v) NaCl), glucose solution (e.g., 5% glucose), solution containing surfactant (e.g., 0.01% polysorbate 20), pH buffer solution (e.g., phosphate buffer solution), Ringer's solution, and any combination thereof.

[0063] The nanobodies, isolated nucleic acid molecules, carriers, host cells, or conjugates of the present invention, or the pharmaceutical compositions of the present invention, may be administered by any suitable method known in the art, including but not limited to oral, oral, sublingual, ocular, topical, parenteral, rectal, intrathecal, intracytoplasmic reticulum groove, groin, intrabladder, topical (e.g., powder, ointment, or drops), or nasal routes. However, for many therapeutic uses, the preferred route / method of administration is parenteral administration (e.g., intravenous injection or bolus, subcutaneous injection, intraperitoneal injection, intramuscular injection). Those skilled in the art will understand that the route and / or method of administration will vary depending on the intended purpose. In some embodiments, the nanobodies, isolated nucleic acid molecules, carriers, host cells, conjugates, or pharmaceutical compositions of the present invention are administered by intravenous injection or bolus.

[0064] In some embodiments, the present invention provides a method for detecting the presence or amount of PSMA in a sample, which includes using the nanobody or antigen-binding fragment or conjugate of the present invention.

[0065] In some embodiments, the method is an immunological assay, such as immunoblotting, enzyme immunoassay (e.g., ELISA), chemiluminescent immunoassay, fluorescence immunoassay, or radioimmunoassay.

[0066] In some embodiments, the conjugate used in the method comprises the nanobody of the present invention and a detectable label.

[0067] In some embodiments, the nanobodies used in the method are labeled with detectable tags.

[0068] In some embodiments, the nanobodies or antigen-binding fragments thereof used in the method do not carry a detectable label. Therefore, the method may also include using other reagents (such as a second antibody) carrying a detectable label to detect the nanobodies or antigen-binding fragments thereof of the present invention.

[0069] In some implementations, the method includes the following steps: (1) Contact the sample with the nanobody or its antigen-binding fragment or conjugate of the present invention; (2) Detect the formation of a complex between the nanobody or its antigen-binding fragment or conjugate and PSMA or detect the amount of the complex.

[0070] The formation of the complex indicates the presence of PSMA or cells expressing PSMA.

[0071] The method can be used for non-diagnostic purposes (e.g., the sample is a cell sample, not a sample from a patient).

[0072] In some embodiments, the method is used to diagnose whether a subject has a PSMA-related disease. In such embodiments, the method may further include the step of comparing the amount of PSMA in a sample from the subject with a reference value. The reference value may be the level of PSMA in a sample from a subject known not to have a PSMA-related disease (e.g., a healthy control) (also referred to as a "negative reference value").

[0073] In some implementations, the disease associated with PSMA is a tumor.

[0074] In some embodiments, the tumor is prostate cancer.

[0075] In some embodiments, the sample may be selected from urine, blood, serum, plasma, saliva, ascites, circulating cells, circulating tumor cells, non-tissue-associated cells (i.e., free cells), tissues (e.g., surgically removed tumor tissue, biopsy sections, or fine-needle aspiration tissue), histological preparations, etc.

[0076] In some embodiments, the conjugates used to prepare the detection reagents comprise the nanobodies of the present invention or antigen-binding fragments thereof, and a detectable label.

[0077] In some embodiments, the nanobodies or antigen-binding fragments thereof used to prepare the detection reagents are labeled with detectable tags.

[0078] In some embodiments, the nanobodies or antigen-binding fragments thereof used to prepare the detection reagents do not carry a detectable label. In such embodiments, the detection reagents may further comprise other reagents (such as a second antibody) capable of detecting the nanobodies or antigen-binding fragments thereof of the present invention.

[0079] As used herein, the term "nanobody" has the meaning commonly understood by those skilled in the art as an antibody fragment composed of a single monomeric variable antibody domain (e.g., a single heavy chain variable region), typically derived from the variable region of a heavy chain antibody (e.g., a camel or shark antibody). Typically, a nanobody consists of four framework regions and three complementarity-determining regions, possessing FR1... CDR1 FR2 CDR2 FR3 CDR3 The structure of FR4. Nanobodies can be truncated at the N-terminus or C-terminus to contain only a portion of FR1 and / or FR4, or to lack one or both of those backbone regions, as long as they essentially maintain antigen binding and specificity. Nanobodies are also known as single-domain antibodies. Domain Antibody (sdAb) and the two can be used interchangeably.

[0080] As used herein, the term "complementarity-determining region" or "CDR" refers to the amino acid residue in the variable region of an antibody responsible for antigen binding. The nanobody contains three CDRs, named CDR1, CDR2, and CDR3. The precise boundaries of these CDRs can be defined according to various numbering systems known in the art, such as the Kabat numbering system (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., 1991) and the Chothia numbering system (Chothia & Lesk (1987) J. Mol. Biol. 196:901). 917; Chothia et al. (1989) Nature 342:878 883) or the IMGT numbering system (Lefranc et al., Dev. Comparat. Immunol. 27:55) The definition is found in (77, 2003). For a given nanobody, those skilled in the art will readily identify the CDR defined by each numbering system. Furthermore, the correspondence between different numbering systems is well known to those skilled in the art (e.g., see France et al., Dev. Comparat. Immunol. 27:55). 77, 2003).

[0081] As used herein, the term “frame region” or “FR” residues refer to the amino acid residues in the antibody variable region other than the CDR residues as defined above.

[0082] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0083] Example 1: Construction of Phage Display Library after Immunization 1. Animal immunization PSMA antigen (Syntocin, 15877-H07H) was thoroughly mixed with an equal volume of Freund's adjuvant (Sigma) and injected subcutaneously at two points on the alpaca's neck for immunization. Each immunization dose was 200 μg, with two weeks between each immunization. Approximately 5 mL of peripheral blood was collected before each immunization as a pre-immunization plasma titer control. To obtain better immunization efficacy, a total of four immunizations were administered, and the immunization effect was monitored in real time.

[0084] 2. Obtaining total RNA and cDNA from alpaca peripheral blood mononuclear cells (PBMCs) Collect 30 mL of whole blood from immunized alpacas. After purifying lymphocytes using lymphocyte separation medium and density gradient centrifugation, wash the cells two to three times with PBS. Add 1 mL of TRIzol and mix thoroughly to lyse the cells. Add 0.2 volume of chloroform, mix vigorously for 15 seconds, incubate at 4°C for 10 minutes, then centrifuge at 12000 rpm, 4°C for 15 minutes. Transfer the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, and incubate at -20°C for 30 minutes. Centrifuge at 12000 rpm, 4°C for 10 minutes, discard the supernatant, add 75% ethanol, centrifuge at 12000 rpm, 4°C for 2 minutes, and discard the supernatant. Add 75% ethanol again, centrifuge at 12000 rpm, 4°C for 2 minutes, and discard the supernatant. Dry the inner wall of the tube by inverting it on paper. 50 μL LEPC water was added to dissolve the RNA precipitate, yielding total RNA from alpaca peripheral blood mononuclear cells (PBMCs). The total RNA concentration was determined using Nanodrop 2000, and the purity of the total RNA was identified by agarose gel electrophoresis.

[0085] cDNA reverse transcription: The total RNA obtained from alpaca peripheral blood mononuclear cells (PBMCs) above was used to synthesize cDNA from alpaca peripheral blood mononuclear cells according to the instructions of the HisyGo All-in-One RT Red SuperMix for qPCR (+gDNA Wiper) (Vazyme, RT333-01) kit.

[0086] 3. Phage library construction The target fragment was obtained by performing two-step PCR amplification.

[0087] (1) First round of PCR Gene template amplification was performed using a cDNA library obtained by reverse transcription. The amplification primers are shown in Table 1, the amplification system is shown in Table 2, and the amplification conditions are shown in Table 3.

[0088] Table 1 Primer Sequences

[0089] Table 2 First-round amplification system

[0090] Table 3. Conditions for the first round of amplification

[0091] First-round PCR product recovery: The results of electrophoresis and gel electrophoresis of the first-round PCR products are as follows: Figure 1As shown, the target DNA band (700 bp) was cut from the agarose gel and the first round of PCR product recovery was performed. The recovered DNA was stored at -20℃.

[0092] (2) Second round of PCR The recovered PCR products from the first round were used as templates for secondary amplification. The amplification system is shown in Table 4, and the amplification conditions are shown in Table 5.

[0093] Table 4 Second-round amplification system

[0094] Table 5. Second-round amplification conditions

[0095] Second-round PCR product recovery: The results of electrophoresis and gel electrophoresis of the second-round PCR products are as follows: Figure 2 As shown, the target DNA band (400 bp) was cut from the agarose gel and the second round of PCR product recovery was performed. The recovered DNA was stored at -20℃.

[0096] (3) The target fragment and the vector were digested with enzymes, ligated and electroporated to obtain a phage library. The enzyme digestion system is shown in Table 6.

[0097] Table 6 Enzyme digestion system

[0098] The PCR products recovered in the second round were double-digested with Pst-I-HF and Not-I-HF according to the above system at 37℃ for 16 h. The results of gel electrophoresis of the digested products are as follows. Figure 3 As shown, the double enzyme digestion products were then purified and recovered, and the recovered DNA was stored at -20°C.

[0099] (4) The T4 DNA ligation system is shown in Table 7.

[0100] Table 7 Connection System

[0101] The VHH fragment was ligated to the phage display vector using T4 DNA ligase, incubated at 16°C for 18 h, the ligation product was purified, eluted with sterile ultrapure water, and the concentration was determined for subsequent experiments.

[0102] (5) Electro-rotation After purifying the ligation product using a PCR Purification Kit (QIAGEN), 10 μL of the purified product was electroporated into 100 μL of TG1 competent cells. The following day, the number of clones at different bacterial dilution gradients was counted. Evaluation showed that the constructed phage library reached 10... 7For CFU / mL and above, 30 clones were randomly selected for bacterial culture PCR. The primers used for bacterial culture PCR were MP57 (sequence: TTATGCTTCCGGCTCGTATG (SEQ ID NO:41)) and GIII (sequence: CCACAGACAGCCCTCATAG (SEQ ID NO:42)). The program was: 95℃, 5 min; followed by 22 cycles of amplification (94℃, 30 s; 58℃, 45 s; 72℃, 45 s); 72℃, 5 min. The amplified products were confirmed by 1% agarose gel electrophoresis to have an insertion rate of 100%. Additionally, 20 clones were randomly selected for sequencing, showing a 100% positive rate, suitable for nanobody development.

[0103] Example 2: Development of PSMA Nanobodies 1. Phage Library Rescue (1) Take 100 μL of phage display vector library and inoculate it into 100 mL of 2×YT / AMP-GLU medium. Incubate at 37℃ and 200 r / min until the logarithmic growth phase (OD50). 600 The value is 0.6~0.8).

[0104] (2) Add 90 μL of M13KO7 helper phage (1.7 × 10⁻⁶) 13 (pfu / mL), approximately equivalent to 20 MOIs (about 20 phages per bacterial infection on average), mix gently and incubate at 37°C for 30 min.

[0105] (3) Centrifuge at 2800 g at room temperature for 10 min, discard the supernatant, resuspend the bacterial cells in 200 mL of 2×YT / AMP-KAN medium, and incubate at 37℃ and 200 r / min for 12 h.

[0106] (4) Dispense the culture medium into 50 mL centrifuge tubes, centrifuge at 3800 g and 4 °C for 30 min, carefully collect the supernatant with a pipette (avoid aspirating the precipitate) and discard it. Add 1 / 5 volume of pre-cooled PEG / NaCl solution (20%) to the precipitate, invert and mix well, let stand on ice for 2 h, centrifuge at 3800 g and 4 °C for 30 min, discard the supernatant, add 0.5 mL of PBS to each tube, and resuspend the phage precipitate.

[0107] (5) Centrifuge at 12000 g and 4℃ for 15 min, collect the supernatant, add 1 / 5 volume of pre-cooled PEG / NaCl solution, mix by inverting, and let stand on ice for 2 h.

[0108] (6) Centrifuge at 10000 g and 4℃ for 10 min, discard the supernatant, resuspend the phage pellet in 1 mL PBS, and incubate overnight in a shaker at 4℃ to fully suspend the phage particles.

[0109] 2. Detection of recombinant phage titers (1) Take 10 μL of the rescued phage solution and serially dilute it 10-fold with 2×YT medium to obtain a dilution of 10. -8 10 -9 10 -10 Take 100 μL of each sample, add 100 μL of TG1 cells in the logarithmic growth phase, mix well, and incubate at 37°C for 15 min for infection.

[0110] (2) TG1 cells infected with different dilutions of phage were evenly spread on LB / AMP-GLU plates and cultured at 37°C for 8 h.

[0111] (3) Count the colonies on the plate and calculate the titer of recombinant phage.

[0112] 3. Selection of Nanobody Phage Library The titer of the phage library after rescue was determined to be 5 × 10⁻⁶. 14 pfu / mL. Remove the overnight PSMA recombinant protein-coated ELISA plate, block it, and add the phage display library (decreasing the amount each time). Incubate at 37°C for 1 h (binding time decreasing to 30 min each time) for enrichment and panning. Add 100 μL of Gly-HCl solution (pH 2.2) to each well of the plate, and elute by shaking in a horizontal shaker at 37°C for about 10 min. Transfer the elution to a sterile centrifuge tube. Neutralize with 100 μL of pH 7.4 TrisHCl. The collected phages are the PSMA nanobody phage library obtained through affinity panning. Infect logarithmic-phase TG1 cells with 10 μL of phage and plate them. Count the number of clones after panning the next day. Continue amplification of the remaining phages (repeat 4 times).

[0113] Phage ELISA test results are as follows Figure 4 As shown in the figure, after four rounds of phage screening, PSMA-specific phages were enriched at 10... 6 .

[0114] 4. Identification of target antigen-specific clones using ELISA To obtain PSMA nanobody monoclonal strains, 96 monoclonal strains were randomly selected from the phage clone plate enriched in the fourth round and inoculated into 1 mL of culture medium. The culture was incubated at 37°C until the logarithmic growth phase, and then induced overnight with 1 mM IPTG. Simultaneously, 100 ng of PSMA protein was coated onto an ELISA plate and incubated overnight at 4°C. The next day, the bacterial sediment was collected by centrifugation, lysed, and centrifuged at 700 g for 15 min to collect the supernatant. The ELISA plate was then blocked with 2% BSA at room temperature for 1 h. The experimental group received monoclonal supernatant in each well, while the control group received supernatant from blank TG1 bacterial suspension. The plates were incubated at room temperature for 1 h. After washing 5 times with PBST, secondary antibody was added, and the plates were incubated at room temperature for 1 h. After washing 5 times with PBST, substrate was added, and absorbance was read on a microplate reader. A positive clone was defined as one whose absorbance was greater than 2 compared to the control well. Results are as follows: Figure 5 As shown, 65 positive clones were obtained, with a positive rate of 89.58%. Sanger sequencing was performed on the positive clones, yielding four candidate nanobody sequences, named 6B10-1, 1A12-1, 4B2-1, and 3H8-1. Their sequences are shown in Table 8.

[0115] Table 8 Nanobody Sequences

[0116] The four monoclonal strains of nanobodies were cultured overnight by shaking, and plasmids (Tiangen, DP103-03) were extracted. 1 μL each of NotI and Pst I high-fidelity enzymes, 1 μg of plasmid, and 2 μL of loading buffer were added. ddH2O was added to a 20 μL system, and the mixture was digested at 37℃ for 20 min. The digested products were then run on a gel and recovered. The products were re-ligated into a linearized PGEX6P-1 vector (Miaoling Biotechnology, P0005). After ligation, BL21 competent cells (Nuoweizan, C504-02) were transformed. Single clones were then picked and sequenced for identification. Large numbers of clones with correct sequences were cultured overnight by shaking, and expression was induced by adding 1 mM IPTG. The next day, the cells were collected and sonicated. The supernatant was purified using a GST-tagged protein purification kit (Beyotime: P2262). After purification, the mixture was concentrated using ultrafiltration to obtain the purified GST-tagged nanobodies.

[0117] Example 3: Verification of PSMA Nanobody Affinity The experimental group was coated with 100 ng of PSMA protein onto an ELISA plate, while the control group was coated with coating buffer. Both were incubated overnight at 4°C. The next day, 2% BSA was added for blocking at room temperature for 2 hours. After washing five times with PBST and patting dry, the purified nanobodies were serially diluted five times to a maximum concentration of 20 nM. These were added to both the control and experimental groups, and incubated at room temperature for 1 hour. After washing five times with PBST and patting dry, anti-GST (HRP-labeled) antibody was added, and incubated at room temperature for 1 hour. After washing five times with PBST and patting dry, substrate was added, and after reacting for 5 minutes, stop solution was added. The absorbance was then read on an ELISA reader. The results are as follows: Figure 6 As shown in the figure, the affinities of the four PSMA nanobodies are 0.2968 nM, 0.07130 nM, 0.04756 nM, and 0.1852 nM, respectively.

[0118] Example 4: Specific Detection of PSMA Nanobodies To further verify the specificity of the nanobody, a PE-Cy7 fluorescently labeled GST antibody was used as a secondary antibody, and flow cytometry analysis was performed on LNCap cells (a prostate cancer cell line that highly expresses PSMA). The results are as follows: Figure 7 A and B in Figure 8 A and B in Figure 9 A and B in Figure 10 As shown in A and B, the four PSMA nanobody sequences all showed good specificity for PSMA protein in LNCap cells: 6B10-1 had a positive rate of 98.1%, 1A12-1 had a positive rate of 92.2%, 4B2-1 had a positive rate of 97.9%, and 3H8-1 had a positive rate of 90.2%.

[0119] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nanobody targeting PSMA, characterized in that, The amino acid sequence of the nanobody is shown in SEQ ID NO:

17.

2. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the nanobody of claim 1.

3. A carrier, characterized in that, It includes the nucleic acid molecule as described in claim 2.

4. A host cell, characterized in that, It comprises the nucleic acid molecule of claim 2 or the vector of claim 3.

5. The method for preparing nanobodies according to claim 1, characterized in that, include: The host cells of claim 4 are cultured under conditions that allow protein expression, and the nanobody is recovered from the cultured host cell culture.

6. A pharmaceutical composition, characterized in that, It comprises the nanobody of claim 1, and a pharmaceutically acceptable carrier and / or excipient.

7. The use of the nanobody of claim 1, the nucleic acid molecule of claim 2, the carrier of claim 3, the host cell of claim 4, or the pharmaceutical composition of claim 6 in the preparation of a reagent for detecting the presence or level of PSMA in a sample.

Images