An engineered butyri vibrio pathogenicum and a fermentation process and application thereof

Abstract

This invention discloses an engineered strain of *Pathogenic Bacillus budapestans*, its fermentation process, and its applications. Starting with *Pathogenic Bacillus budapestans* XBD101, this invention obtains *Pathogenic Bacillus budapestans* strain FH1 by sequentially replacing the original fclC promoter with P1; strain FH2 by replacing the original gene2204 promoter of strain FH1 with P1; strain FH3 by replacing the original fclI promoter of strain FH2 with P19; and strain FH4 by replacing the original fclK promoter of strain FH3 with P6. The yield of the fcl-8 peptide derivative from strains FH1 through FH4 is significantly increased sequentially. Further fermentation optimization further increases the yield to 943.39 mg / L, a 13.56-fold increase compared to XBD101, which significantly promotes the industrialization of this type of natural product.

Description

Technical Field

[0001] This invention belongs to the field of microbial and biological pesticide technology, specifically relating to an engineered Budapest pathogenic bacillus, its fermentation process, and its application. Background Technology

[0002] Fabclavines are a class of hybrid nonribosomal peptides (NRPs)-polyketides (PKs)-polyamine acids (PAs) natural products. In 2013, Professor Helge B. Bode's team first identified Fabclavines from Xenorhabdus and found that they exhibited broad-spectrum antibacterial activity against a variety of pathogens, including Bacillus subtilis and Micrococcus luteus, and have the potential to be developed into antibiotics. Li Guangyue and Yin Changyan conducted research on the Fcl-8 derivative of Fulei peptide and its producing strain (patent CN121064284A). Fcl-8 has good inhibitory activity against a variety of plant pathogenic bacteria, including but not limited to Xanthomonas oryzae, Erwinia amyloliquefaciens, and radish black rot fungus. At the same time, it has good biological activity against a variety of plant pathogenic fungi, including but not limited to potato black scurf, Fusarium oxysporum, Alternaria alternata, sunflower sclerotinia, Fusarium graminearum, cucumber anthracnose, Fusarium pseudocaryophyllum, wheat sheath blight fungus, and Verticillium dahliae.

[0003] Currently, based on the elucidated biosynthesis mechanism of Fcl-8, its biosynthesis can be divided into three steps ( Figure 1 The biosynthesis of tail-chain PAs, head NRPs, and the complete Fabclavine linking tail-chain PKs with head NRPs are all involved. PKs ​​synthesis is handled by four genes, fclC–fclF, while head NRP biosynthesis is handled by three genes, fclI–fclK. The linking of tail-chain PKs with head NRPs is handled by fclL. Additionally, Wang Yule et al. found that gene2204 also participates in Fabclavine biosynthesis (Wang Yule et al. A strategy combining genome simplification and promoter engineering to improve Fabclavine peptide production [J / OL]. Chinese Journal of Biological Control. doi:10.16409 / j.cnki.2095-039x.2026.02.003.).

[0004] The existing types of fulva peptide derivatives are limited and the yield is low, which cannot meet the market demand. Therefore, the development of fulva peptide derivatives and the improvement of their yield have potential huge application value and social significance for the prevention and control of plant diseases. Summary of the Invention

[0005] To address the aforementioned technical issues, enrich the product range of Fulei peptides, and fully explore the efficacy of Budapest pathogenic bacilli, this invention provides the following technical solutions.

[0006] In a first aspect, the present invention provides an engineered Budapest pathogenic bacterium (Xenorhabdus budapestensis), which is derived from Xenorhabdus budapestensis XBD101. The XBD101 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 22056; the engineered Budapest pathogenic bacterium is an FH1, FH2, FH3, or FH4 strain.

[0007] The FH1 strain is the Budapest pathogenic bacillus obtained by replacing the original fclC promoter of the XBD101 strain with P1.

[0008] The FH2 strain is the Budapest pathogenic bacillus obtained by replacing the original gene2204 promoter of the FH1 strain with P1.

[0009] The FH3 strain is the Budapest pathogenic bacillus obtained by replacing the original fclI promoter of the FH2 strain with P19.

[0010] The FH4 strain is the Budapest pathogenic bacillus obtained by replacing the original fclK promoter of the FH3 strain with P6.

[0011] In a second aspect, the present invention provides a bacterial composition comprising the engineered Budapest pathogenic bacillus described in the first aspect.

[0012] Thirdly, the present invention provides a microbial agent comprising the engineered Budapest pathogenic bacillus described in the first aspect.

[0013] Preferably, the bacterial agent further comprises a formazan peptide derivative, Fcl-8.

[0014] Furthermore, the Fcl-8 content is ≥98 mg / L, for example: 98 mg / L, 98.95 mg / L, 141.22 mg / L, 178.42 mg / L, 187.81 mg / L.

[0015] Fourthly, the present invention provides a fermentation method for the engineered Budapest pathogenic bacillus described in the first aspect, the fermentation method comprising the following steps:

[0016] (1) After activating the Budapest pathogenic bacillus modified by the first aspect, pick a single colony and inoculate it into LB liquid medium, and ferment it to obtain a primary seed liquid;

[0017] (2) The primary seed culture was inoculated into LB liquid medium and fermented to obtain the secondary seed culture;

[0018] (3) The secondary seed liquid is inoculated into the fermentation medium and fermented, with sugar added during the fermentation process;

[0019] (4) After fermentation is completed, the fermentation product of the modified Budapest pathogenic bacillus is obtained.

[0020] Preferably, the culture temperature in step (1) is 25~30℃, for example: 25℃, 26℃, 27℃, 28℃, 29℃, 30℃.

[0021] Preferably, the culture rotation speed in step (1) is 150~250 rpm, for example: 150 rpm, 180 rpm, 200 rpm, 220 rpm, 250 rpm.

[0022] Preferably, the culture time in step (1) is 16 to 24 hours, for example: 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours.

[0023] Preferably, the inoculation amount in steps (2) and (3) is 0.5-5% (v / v), for example: 0.5%, 1%, 2%, 3%, 4%, 5%.

[0024] Preferably, the fermentation time in step (3) is 40-50 h, for example: 40 h, 42 h, 45 h, 48 h, 50 h.

[0025] Preferably, in step (3), the sugar supplementation time is 12 h, 16 h, 20 h, and 24 h, respectively.

[0026] Preferably, the pH during the fermentation process in step (3) is around 6.5 and the dissolved oxygen concentration is ≥30%.

[0027] Preferably, the fermentation medium in step (3) is formulated as follows: yeast extract FM903, 20 g / L; ammonium sulfate, 10 g / L; potassium dihydrogen phosphate, 3 g / L; dipotassium hydrogen phosphate, 2 g / L; sodium chloride, 5 g / L; magnesium sulfate, 1.0 g / L; glucose, 20 g / L.

[0028] Fifthly, the present invention provides a method for preparing the Fcl-8 peptide derivative, which includes the step of inoculating the engineered Budapest pathogenic bacillus into a fermentation medium for fermentation.

[0029] Preferably, the culture medium is formulated as follows: yeast extract FM903, 20 g / L; ammonium sulfate, 10 g / L; potassium dihydrogen phosphate, 3 g / L; dipotassium hydrogen phosphate, 2 g / L; sodium chloride, 5 g / L; magnesium sulfate, 1.0 g / L; glucose, 20 g / L.

[0030] Preferably, the preparation method includes the following steps:

[0031] (1) After activating the Budapest pathogenic bacillus modified by the first aspect, pick a single colony and inoculate it into LB liquid medium, and ferment it to obtain a primary seed liquid;

[0032] (2) The primary seed culture was inoculated into LB liquid medium and fermented to obtain the secondary seed culture;

[0033] (3) The secondary seed liquid is inoculated into the fermentation medium and fermented, with sugar added during the fermentation process;

[0034] (4) After fermentation, the fermentation broth was separated and purified to obtain the Fcl-8 derivative of Fulei peptide.

[0035] Preferably, the culture temperature in step (1) is 25~30℃, for example: 25℃, 26℃, 27℃, 28℃, 29℃, 30℃.

[0036] Preferably, the culture rotation speed in step (1) is 150~250 rpm, for example: 150 rpm, 180 rpm, 200 rpm, 220 rpm, 250 rpm.

[0037] Preferably, the culture time in step (1) is 16 to 24 hours, for example: 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours.

[0038] Preferably, the inoculation amount in steps (2) and (3) is 0.5-5% (v / v), for example: 0.5%, 1%, 2%, 3%, 4%, 5%.

[0039] Preferably, the fermentation time in step (3) is 40-50 h, for example: 40 h, 42 h, 45 h, 48 h, 50 h.

[0040] Preferably, in step (3), the sugar supplementation time is 12 h, 16 h, 20 h, and 24 h, respectively.

[0041] Preferably, the pH during the fermentation process in step (3) is around 6.5 and the dissolved oxygen concentration is ≥30%.

[0042] In a sixth aspect, the present invention provides the use of the engineered Budapest pathogenic bacillus described in the first aspect or the strain composition described in the second aspect in the preparation of biopesticides.

[0043] Preferably, the biological pesticide is used to control Xanthomonas alopecuroides, Erwinia amyloliquefaciens, black rot fungus of radish, black scurvy fungus of potato, Fusarium scutellarioides, Alternaria alternata, sclerotinia sclerotium of sunflower, Fusarium graminearum, anthracnose of cucumber, Fusarium pseudocaryophyllum, wheat sheath blight fungus, or Verticillium dahliae.

[0044] Preferably, the biopesticide contains the flebotrieptide derivative Fcl-8.

[0045] The beneficial effects of this invention are:

[0046] This invention uses *Xenorhabdus budapestensis* XBD101 as the starting strain. By successively replacing the original fclC promoter, gene2204 promoter, fclI promoter, and fclK promoter with P1, P1, P9, and P6, four strains of *Flevax* peptide derivative Fcl-8 (C) were obtained. 57 H 102 N 14 O 12 The yields of Budapest pathogenic bacilli FH1, FH2, FH3, and FH4 were 98.95 mg / L, 141.22 mg / L, 178.22 mg / L, and 187.81 mg / L, respectively. Based on strain FH4, the Fcl-8 yield was increased to 943.39 mg / L through fermentation optimization, which is 13.56 times higher than that of strain XBD101, laying the foundation for the industrialization development of Fcl-8. Attached Figure Description

[0047] Figure 1 The diagram shows the Fcl-8 biosynthetic gene cluster and its functions.

[0048] Figure 2 The figure shows the Fcl-8 yield of strains FH1-4. This indicates that the difference in Fcl-8 yield between adjacent strains reached a highly significant level (p < 0.001).

[0049] Figure 3 The figure shows the Fcl-8 yield of strain FH4 after fermentation for 12-48 h; Detailed Implementation

[0050] The technical solution of the present invention will be further described below with reference to embodiments and accompanying drawings. The advantages and features of the present invention will become clearer as the description unfolds. However, it should be understood that the embodiments are merely exemplary and do not constitute a limitation on the scope of the present invention.

[0051] It should be noted that, unless otherwise specified, the experimental methods used in the following embodiments are conventional methods in the art. Unless otherwise defined, all scientific and technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art.

[0052] Example 1: Construction of a high-yield strain of Fcl-8, a peptide derivative of Fulei bacteria.

[0053] Using wild-type strain XBD101 as the starting strain and Fcl-8 yield as the evaluation index, promoter engineering was employed to modify XBD101. The original fclC promoter was replaced with P1 to obtain *Pathogenic Bacillus Budapestus* strain FH1; the original gene2204 promoter of FH1 strain was replaced with P1 to obtain *Pathogenic Bacillus Budapestus* strain FH2; the original fclI promoter of FH2 strain was replaced with P19 to obtain *Pathogenic Bacillus Budapestus* strain FH3; and the original fclK promoter of FH3 strain was replaced with P6 to obtain *Pathogenic Bacillus Budapestus* strain FH4. The sequences of promoters P1, P6, and P19 are as follows:

[0054] P1:

[0055] (SEQ ID NO.1)

[0056] P6:

[0057] CAGCGTACTAAGACCAATGCACGTACCCGTAAGGGTCCGCGTAAGCCGATCAAGAAATAATCGGGGTATTGAATAATGGCAAAAGCACCTATTCGTGCACGTAAGCGTGTAAGAAAACAAGTCTCTGACGGTGTGGCTCATATCCATGCTTCTTTCAACAACACCATCGTTACTATTACTGATCGTCAGGGTAACGCGCTGGGTTGGGCAACTGCTGGTGGTTCCGGTTTCCGTGGTTCTCGTAAATCTACTCCGTTCGCGGCTCAGGTTGCAGCAGAGCGCTGCGCTGAAGCAGTAAAAGAATACGGAATCAAGAACCTGGAAGTTATGGTTAAAGGACCTGGTCCTGGCCGTGAGTCAACTATCCGCGCATTGAACGCGGCTGGTTTCCGCATCACTAATATTACTGATGTGACTCCGATCCCTCATAACGGTTGTCGCCCACCGAAAAAACGTCGCGTTTAATACGTTTTCGTTTTTAGGATTGTTGGAGAAAGAAAATGGCAAGATATTTGGGTCCTAAGCTCAAGCTGAGCCGTCGCGAGGGTACAGACCTTTTCCTGAAGTCTGGTGTTCGCGCGATTGACACCAAGTGTAAATTAAGTAGGTGATCACTAGTAATTAAAGAGGAGAAATTAAGC(SEQ ID NO.2)

[0058] P19:

[0059] CCTGACACTTGAGCACTACCCGGGCATGACAGAAAAAATGTTGCAGAAGATTGCGGATGAAGCGCGCCAGCGTTGGCCTGTGCAAAGGATCACCATTATTCATCGGATTGGAGAACTGTATCCGGGAGATGAAATTGTATTTGTTGGTGTCACAAGCTCTCACCGCAATATGGCTTTTACAGCAGCAGAATTCATGATGGACTATCTGAAAACCAAGGCGCCATTCTGGAAAAAAGAATCTCTTGCAGAAGGTGAACGCTGGGTTGAGATAAAACAGCATGATCAGGAAGCAGCAAATCGCTGGCAATCAATCACGGGTAATGAAAGCGCTGAAACAATAGAGTGACGGATTATTTTGTGAGCCATCATGAAAACCGGGCAGATAAATAATCTGTCACTAAAATTACCATTAATTGGCGGATGGTTTTGTTAATGTTCTATGCTAATGTATAACTTTTGAATAGATTGTTTATTTTTAAATAATCTTAATCCCTAAACATTGTCATGAAAAGGTAATCGTCATGGACCGATATCAACGTTCTAATGGTTCGATTGTCCAGAAAACGGGTTCTGGTATACAAACTTATATGGCACAAGTCTACGGCTGGATGACTTGTGGCTTGTTAAGTAGGTGATCACTAGTAATTAAAGAGGAGAAATTAAGC (SEQ ID NO.3).

[0060] The specific process is as follows:

[0061] 1.1 Construction of recombinant plasmid

[0062] 1.1.1 1000 bp upstream and downstream of the ATG of the promoter substitution genes (fclC, gene2204, fclI, fclK) were selected as upstream and downstream homologous arms, respectively. The upstream and downstream homologous arms were amplified using the primers in Table 1. Specifically, fclC-UF / R was used to amplify the upstream homologous arm of fclC, and fclC-DF / R was used to amplify the downstream homologous arm of fclC; gene2204-UF / R was used to amplify the upstream homologous arm of gene2204, and gene2204-DF / R was used to amplify the downstream homologous arm of gene2204; fclI-UF / R was used to amplify the upstream homologous arm of fclI, and fclI-DF / R was used to amplify the downstream homologous arm of fclI; fclK-UF / R was used to amplify the upstream homologous arm of fclK, and fclK-DF / R was used to amplify the downstream homologous arm of fclK.

[0063] 1.1.2 Amplify the promoter sequences using the primers in Table 1, where P1-fclC-F / R is used to amplify the P1-fclC promoter; P1-gene2204-F / R is used to amplify the P1-gene2204 promoter; P19-fclI-F / R is used to amplify the P9-fclI promoter; and P6-fclK-F / R is used to amplify the P6-fclK promoter.

[0064] 1.1.3 Using the SE Seamless Cloning and Assembly Kit (Catalog No.: ZC231-2) from Zhuangmeng Biotechnology, the upstream and downstream homologous arms were ligated to the sticky ends of the linearized pJQ200SK vector. After ligation, the vector was transformed into E. coli DH5α competent cells to verify whether the vector was successfully constructed.

[0065] The experimental procedure for the transformation of competent cells is as follows:

[0066] (1) Take out E. coli DH5α competent cells from the -80℃ freezer and place them on ice to thaw. Then add 10 μL of ligation product to 100 mL of competent cells and incubate on ice for 30 mins.

[0067] (2) Heat shock in a 42℃ metal bath for 90 s, then place on ice again for 3 mins.

[0068] (3) Add 600 μL of LB liquid medium to revive competent cells and culture them in a shaker at 37°C and 200 rpm for 60 mins.

[0069] (4) Centrifuge the culture medium at 5,000 rpm for 3 mins, remove the supernatant, resuspend and spread evenly on LB plates containing Gm, incubate at 37℃ for 12-16 h, then pick single colonies on the plate for colony PCR (universal primers M13F / R), and sequence the samples with band size that meets the expectations. The strain with the correct sequencing result is the positive strain.

[0070] Table 1 Primers for Recombinant Plasmid Construction

[0071]

[0072] 1.2 Construction of high-yielding Fcl-8 strain

[0073] 1.2.1 Construction of FH1 strain

[0074] 1.2.1.1 The plasmid carrying the P1-fclC promoter in the positive strain was extracted using the Easypure PlasmidMiniPrep Kit (N-EM101-02) from TransGen Biotech Ltd. The extracted plasmid was transformed into E. coli S17λpir according to the transformation method in 1.1.3.

[0075] 1.2.1.2 S17 and XBD101 were cultured separately in LB liquid medium (yeast extract: 5 g / L, tryptone: 10 g / L, sodium chloride: 10 g / L) until OD. 600 When the value is 0.6-0.8, take 1 mL of bacterial culture and centrifuge at 5,000 rpm for 3 mins. Discard the supernatant and resuspend the bacterial cells in 1 mL of LB liquid medium. After washing the bacterial cells twice, mix the two and centrifuge. Reserve 50 μL of LB solution to resuspend the bacterial cells and add it to the center of LB solid medium. Then, incubate in a constant temperature incubator at 28℃ for 24 h.

[0076] 1.2.1.3 Resuspend the conjugated cells in 1 mL of LB liquid medium. Spread 100 μL of the resuspended cells evenly onto an LB solid plate containing Amp (100 mg / L) and Gm (50 mg / L). Incubate upside down in a 28°C incubator for 36 h. Pick a single colony from the plate and inoculate it into an EP tube containing 600 μL of LBN (LB without NaCl) liquid medium. Relax and incubate at 28°C and 200 rpm for 12-24 h.

[0077] 1.2.1.4 Centrifuge 600 μL of bacterial culture at 5,000 rpm for 3 mins, discard the supernatant, resuspend in 100 μL of sterile water and spread evenly on LB agar plates containing Amp (100 mg / L) and 5% (w / v) sucrose to screen for double-exchange mutants. Pick single colonies from the plates and perform colony PCR using the primers fclC-TF / TR in Table 2. Sequencing is performed on samples with band sizes that meet expectations. The strain with correct sequencing results is the high-yielding strain FH1.

[0078] 1.2.2 Construction of FH2 strain

[0079] The specific process is the same as in 1.2.1, except that the P1-fclC promoter in 1.2.1.1 is replaced with the P1-gene2204 promoter; XBD101 in 1.2.1.2 is replaced with FH1; and the primer fclC-TF / TR in 1.2.1.4 is replaced with gene2204-TF / TR.

[0080] 1.2.3 Construction of FH3 strain

[0081] The specific process is the same as in 1.2.1, except that the P1-fclC promoter in 1.2.1.1 is replaced with the P9-fclI promoter; XBD101 in 1.2.1.2 is replaced with FH2; and the primer fclC-TF / TR in 1.2.1.4 is replaced with fclI-TF / TR.

[0082] 1.2.4 Construction of FH4 strain

[0083] The specific process is the same as in 1.2.1, except that the P1-fclC promoter in 1.2.1.1 is replaced with the P6-fclK promoter; XBD101 in 1.2.1.2 is replaced with FH3; and the primer fclC-TF / TR in 1.2.1.4 is replaced with fclK-TF / TR.

[0084] Table 2. Primers for mutant validation

[0085]

[0086] 1.3 Determination of Fcl-8 yield in strains FH1-4

[0087] 1.3.1 The preserved strains FH1, FH2, FH3, and FH4 were removed from the -80℃ freezer and streaked onto LB agar plates (containing 100 μg / mL Amp) and incubated at 28℃ for 48 h. Single colonies were picked and inoculated into 3 mL of LB liquid medium (containing 100 μg / mL Amp) and incubated at 28℃ and 200 r / min for 18 h to obtain the primary seed culture.

[0088] 1.3.2 Transfer the primary seed culture to a shake flask containing 100 mL of LB liquid medium and incubate at 28℃ and 200 r / min for 18 h to prepare the secondary seed culture.

[0089] 1.3.3 The secondary seed culture was inoculated at a rate of 1% (v / v) into shake flasks with a volume of 1000 mL / 2000 mL. The flasks were fermented at 28℃ and 200 r / min for 48 h to obtain the fermentation broths of strains FH1 to 4.

[0090] 1.3.4 Fermentation broth samples of strains FH1-4 were taken respectively, and the Fcl-8 yield in the fermentation broth of each strain was determined according to the method for determining Fcl-8 yield in the literature (Wang Yule et al. Strategy of combining genome simplification and promoter engineering to improve Fcl-8 yield [J / OL]. Chinese Journal of Biological Control. doi:10.16409 / j.cnki.2095-039x.2026.02.003.).

[0091] like Figure 2 As shown, the Fcl-8 yield of wild-type strain XBD101 was 69.53 mg / L, that of strain FH1 was 98.95 mg / L, that of strain FH2 was 141.22 mg / L, that of strain FH3 was 178.22 mg / L, and that of strain FH4 was 187.81 mg / L. The differences in Fcl-8 yield between strains XBD101 and FH1, FH1 and FH2, FH2 and FH3, and FH3 and FH4 were all highly significant.

[0092] Example 2: FH4 strain Fcl-8 fermentation production test

[0093] 2.1 The preserved FH4 strain was removed from the -80℃ freezer and streaked onto LB agar plates (containing 100 μg / mL Amp) and incubated at 28℃ for 48 h. A single colony was picked and inoculated into 3 mL of LB liquid medium (containing 100 μg / mL Amp) and incubated at 28℃ and 200 r / min for 18 h to obtain the primary seed culture.

[0094] 2.2 Transfer the primary seed culture to a shake flask containing 100 mL of LB liquid medium and incubate at 28℃ and 200 r / min for 18 h to prepare the secondary seed culture.

[0095] 2.3 Prepare the culture medium required for a 5 L bioreactor (concentrate 3 L of material in 2 L of water) (1 L culture medium formula: yeast extract FM903, 20 g; ammonium sulfate, 10 g; potassium dihydrogen phosphate, 3 g; dipotassium hydrogen phosphate, 2 g; sodium chloride, 5 g; magnesium sulfate, 1.0 g; glucose, 20 g).

[0096] 2.4 Inoculate 100 mL of secondary seed culture into the bioreactor via flame to start fermentation, and precisely control the pH value (around 6.5) and dissolved oxygen concentration (DO≥30%) throughout the fermentation process.

[0097] 2.5 Prepare the fed culture medium; dissolve 100 g of glucose in 800 mL of water as a supplementary sugar. Add 200 mL of glucose at 12 h, 16 h, 20 h, and 24 h of fermentation, respectively.

[0098] 2.6 Fermentation broth samples were taken at 12 h, 24 h, 36 h and 48 h, respectively, and the yield of Fcl-8 was determined according to the method in 1.3.

[0099] like Figure 3 As shown, in a 5 L fermenter, the Fcl-8 yield of strain FH4 reached 943.39 mg / L after 48 h of fermentation, which is 13.56 times higher than the Fcl-8 yield of strain XBD101 (69.53 mg / L).

[0100] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. An engineered Budapest pathogenic bacillus (Xenorhabdus budapestensis), characterized in that, The Budapest pathogenic bacillus was modified from Xenorhabdus budapestensis XBD101, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 22056; the engineered Budapest pathogenic bacillus is strain FH2, FH3, or FH4. The FH1 strain is a Budapest pathogenic bacillus obtained by replacing the original fclC promoter of the XBD101 strain with P1. The FH2 strain is the Budapest pathogenic bacillus obtained by replacing the original gene2204 promoter of the FH1 strain with P1. The FH3 strain is the Budapest pathogenic bacillus obtained by replacing the original fclI promoter of the FH2 strain with P19. The FH4 strain is the Budapest pathogenic bacillus obtained by replacing the original fclK promoter of the FH3 strain with P6. The upstream homologous arm amplification primer of fclC is fclC-UF / R, and the downstream homologous arm amplification primer of fclC is fclC-DF / R. The sequence of fclC-UF is shown in SEQ ID NO.4, the sequence of fclC-UR is shown in SEQ ID NO.5, the sequence of fclC-DF is shown in SEQ ID NO.6, the sequence of fclC-DR is shown in SEQ ID NO.7, and the sequence of P1 is shown in SEQ ID NO.

1. The upstream homologous arm amplification primer of gene2204 is gene2204-UF / R, and the downstream homologous arm amplification primer of gene2204 is gene2204-DF / R. The sequence of gene2204-UF is shown in SEQ ID NO.10, the sequence of gene2204-UR is shown in SEQ ID NO.11, the sequence of gene2204-DF is shown in SEQ ID NO.12, and the sequence of gene2204-DR is shown in SEQ ID NO.

13. The upstream homologous arm amplification primer of fclI is fclI-UF / R, and the downstream homologous arm amplification primer of fclI is fclI-DF / R. The sequence of fclI-UF is shown in SEQ ID NO.16, the sequence of fclI-UR is shown in SEQ ID NO.17, the sequence of fclI-DF is shown in SEQ ID NO.18, the sequence of fclI-DR is shown in SEQ ID NO.19, and the sequence of P19 is shown in SEQ ID NO.

2. The upstream homologous arm amplification primer of fclK is fclK-UF / R, the downstream homologous arm amplification primer of fclK is fclK-DF / R, the sequence of fclk-UF is shown in SEQ ID NO.22, the sequence of fclk-UR is shown in SEQ ID NO.23, the sequence of fclk-DF is shown in SEQ ID NO.24, the sequence of fclk-DR is shown in SEQ ID NO.25, and the sequence of P6 is shown in SEQ ID NO.

3.

2. A microbial composition, characterized in that, The bacterial composition includes the engineered Budapest pathogenic bacillus as described in claim 1.

3. A microbial agent, characterized in that, The bacterial agent includes the engineered Budapest pathogenic bacillus as described in claim 1.

4. The microbial agent according to claim 3, characterized in that, The bacterial agent also contains a formazan peptide derivative, Fcl-8, with a content of ≥98 mg / L.

5. The fermentation method for the modified Budapest pathogenic bacillus as described in claim 1, characterized in that, The fermentation method includes the step of inoculating the engineered Budapest pathogenic bacillus of claim 1 into a fermentation medium for fermentation.

6. The fermentation method according to claim 5, characterized in that, The fermentation medium is formulated as follows: yeast extract FM903, 20 g / L; ammonium sulfate, 10 g / L; potassium dihydrogen phosphate, 3 g / L; dipotassium hydrogen phosphate, 2 g / L; sodium chloride, 5 g / L; magnesium sulfate, 1.0 g / L; glucose, 20 g / L.

7. The fermentation method according to claim 5, characterized in that, The fermentation method further includes a step of supplementing sugar during the fermentation process, wherein the sugar supplementation time is 12 h, 16 h, 20 h, and 24 h respectively.

8. The fermentation method according to claim 5, characterized in that, The fermentation process was carried out at a pH of 6.5 and a dissolved oxygen concentration of ≥30%.

9. The application of the engineered Budapest pathogenic bacillus of claim 1 or the bacterial composition of claim 2 in the preparation of biopesticides, characterized in that, The biological pesticides are used to control Xanthomonas alopecuroides, Erwinia amyloliquefaciens, black rot fungus of radish, black scurvy fungus of potato, Fusarium scutellaria, Alternaria alternata, sclerotinia sclerotium of sunflower, Fusarium graminearum, anthracnose of cucumber, Fusarium pseudocaryophyllum, wheat sheath blight fungus, or Verticillium dahliae.

10. The application according to claim 9, characterized in that, The biopesticide contains the Fcl-8 derivative of Fulei peptide.

Images