Long-chain non-coding RNA regulating protease degradation, inhibitor and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-28
- Publication Date
- 2026-08-11
AI Technical Summary
然而,目前尚未发现能够特异性结合并调控HK1蛋白稳定性的lncRNA,其在肝癌糖代谢重塑及恶性进展中的潜在功能机制尚属未知
本发明通过雷帕霉素抑制HepG2细胞mTOR通路并结合lncRNA芯片分析筛选到一条功能未知的lncRNA,通过敲低该lncRNA的表达水平可以增强HK1的泛素化修饰,从而加速HK1蛋白的降解,抑制肝癌细胞的增殖能力,结合动物实验再次证实,体内敲低该lncRNA的表达水平后可抑制肝癌肿瘤生长,说明该lncRNA有望作为肝癌的新型治疗靶点,并为开发治疗肝癌的药物提供了新策略。
Smart Images

Figure CN122235142B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cell biology, and in particular to a long non-coding RNA that regulates protease degradation, its inhibitors, and their applications. Background Technology
[0002] Hepatocellular carcinoma (HCC) is a malignant tumor with extremely high incidence and mortality rates. Treatment resistance and recurrence / metastasis pose significant clinical challenges. Metabolic reprogramming, a hallmark of tumors, plays a crucial role in the occurrence and development of HCC, with abnormal activation of glycolysis being particularly prominent. Hexokinase (HK), the first rate-limiting enzyme in the glycolytic pathway, has seen its subtype HK2 become a research hotspot due to its high expression and significant function in various cancers. Numerous studies have shown that various long non-coding RNAs (lncRNAs) can directly bind to and stabilize HK2 protein, inhibiting its ubiquitination and degradation, thereby enhancing glycolytic activity and promoting HCC progression, providing potential directions for molecularly targeted intervention in HCC. However, HK1, an equally important metabolic isomerase, also plays a significant role in some cancer types. Although evidence suggests that HK1 may be involved in regulating tumor cell energy metabolism and survival adaptation, research on the expression patterns, functional mechanisms, and upstream regulators of HK1 in HCC, especially post-transcriptional regulation via lncRNA, remains extremely scarce. It is worth noting that targeting HK1 is quite challenging due to its widespread expression and structural conservation in normal tissues, and traditional inhibitor development strategies are difficult to achieve selective intervention.
[0003] In recent years, lncRNAs, as key regulatory molecules at the epigenetic, transcriptional, and post-transcriptional levels, have played an important role in tumor metabolic regulation. Of particular interest is a class of lncRNAs that can directly interact with target proteins, inhibiting their ubiquitin-proteasome-mediated degradation, thereby enhancing protein stability and functional activity. This mechanism has been validated in various oncogenic proteins. However, no lncRNA has yet been found that can specifically bind to and regulate the stability of the HK1 protein, and its potential functional mechanism in hepatocellular carcinoma glucose remodeling and malignant progression remains unknown.
[0004] Therefore, starting from solving the challenges of clinical liver cancer treatment, this research focuses on the key metabolic enzyme HK1, a research target that has not yet been fully explored. Combining this with the emerging mechanism of lncRNA-mediated protein stability regulation, systematically screening and validating lncRNAs that can target HK1 will not only help deepen the understanding of the molecular network of abnormal metabolism in liver cancer, but also has the potential to provide new diagnostic biomarkers and intervention strategies for liver cancer patients. This has significant scientific research value and clinical translation prospects. Summary of the Invention
[0005] The purpose of this invention is to provide a long non-coding RNA that regulates protease degradation, its inhibitor, and its applications, in order to solve the problems existing in the prior art. This invention enhances the ubiquitination modification of HK1 by knocking down lncHBHK1, thereby accelerating the degradation of HK1 protein and inhibiting the proliferation of liver cancer cells. This suggests that lncHBHK1 holds promise as a novel therapeutic target for liver cancer, providing a new strategy for developing drugs to treat liver cancer.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a long non-coding RNA that regulates protease degradation, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides the application of a reagent for inhibiting the aforementioned long non-coding RNA in the preparation of drugs for treating liver cancer.
[0008] Furthermore, the reagent includes shRNA that knocks down the expression of the long non-coding RNA.
[0009] Furthermore, the nucleotide sequence of the shRNA target sequence is shown in SEQ ID NO.8.
[0010] Furthermore, the shRNA exerts a therapeutic effect by knocking down the expression level of the long non-coding RNA, accelerating the degradation of HK1 protein, and inhibiting the proliferation of liver cancer cells.
[0011] Furthermore, the shRNA enhances the ubiquitination modification of HK1 by knocking down the expression level of the long non-coding RNA, thereby accelerating the degradation of the HK1 protein.
[0012] The present invention also provides the application of a lentiviral recombinant vector in the preparation of a drug for treating liver cancer, wherein the lentiviral recombinant vector comprises a nucleotide sequence as shown in SEQ ID NO.8.
[0013] Furthermore, the lentiviral recombinant vector achieves the therapeutic effect of treating liver cancer by knocking down the expression level of long non-coding RNA as shown in SEQ ID NO.1.
[0014] The present invention also provides a drug for treating liver cancer, the drug comprising the shRNA or the lentiviral recombinant vector described above.
[0015] The present invention discloses the following technical effects: This invention screened a lncRNA with unknown function by inhibiting the mTOR pathway in HepG2 cells with rapamycin and combined with lncRNA microarray analysis. Knocking down the expression level of this lncRNA enhanced the ubiquitination modification of HK1, thereby accelerating the degradation of HK1 protein and inhibiting the proliferation of liver cancer cells. Combined with animal experiments, it was further confirmed that knocking down the expression level of this lncRNA in vivo can inhibit the growth of liver cancer tumors, indicating that this lncRNA has the potential to serve as a novel therapeutic target for liver cancer and provides a new strategy for the development of drugs to treat liver cancer. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 The image shows a silver staining plot of RNA-protein. The lanes from left to right are: molecular weight marker group, lncHBHK1 group, lncHBHK1 antisense strand control group, magnetic bead control group, and molecular weight marker group. Figure 2 The image shows the results of the Western blot validation. The lanes from left to right are the magnetic bead control group, the lncHBHK1 antisense strand control group, and the lncHBHK1 group. Figure 3 This is a graph showing the enrichment of HK1 protein for lncHBHK1 by qPCR after RIP experiment. Figure 4 The diagram shows the effect of lncHBHK1 on HK1 protein levels and mRNA. A and B represent Western blot results of HK1 in stable cell lines with lncHBHK1 knockdown and lncHBHK1 overexpression, respectively; C and D represent Western blot quantitative data of HK1 in stable cell lines with lncHBHK1 knockdown and lncHBHK1 overexpression, respectively; E and F represent the mRNA expression levels of HK1 in stable cell lines with lncHBHK1 knockdown and lncHBHK1 overexpression, respectively. Figure 5 Figure 1 shows the mRNA expression level (A) and protein expression level (B) of HK1 in HepG2 and Huh7 cells with HK1 knockdown. Figure 6Western blot was used to detect the expression level of HK1 protein in HepG2 and Huh7 cells transfected with sh-NC and sh-lncHBHK1 after treatment with CHX (20 μM) for different times (0, 2, 4, 6, 8, 10 h). Figure 7 Western blot analysis of HK1 protein expression levels after treatment with MG132 (5 μM, 24h); Figure 8 Western blot analysis of HK1 protein expression levels after CQ (10 μM, 6 h) treatment; Figure 9 Stable cell lines transfected with sh-NC and sh-lncHBHK1 after treatment with MG132 (5 μM, 6h) for HepG2 cells (A) and Huh7 cells (B) were detected by Co-IP assay, showing ubiquitination of HK1 protein. Figure 10 Figure 1 shows the results of CCK-8 experiments in HepG2 cells (A) and Huh7 cells (B) with knockdown of lncHBHK1. Figure 11 Figure (A) shows the results of a plate cloning experiment on HepG2 and Huh7 cells with knockdown of lncHBHK1, and a statistical chart of the number of clones (B). Figure 12 Figure (A) shows the results of the plate cloning experiment of HepG2 and Huh7 cells with HK1 knockdown and the count of clones (B). Figure 13 Figure 1 shows the results of EdU experiments in HepG2 and Huh7 cells to knock down lncHBHK1. Figure 14 Figure (A) and quantification diagram (B) of EdU experiments to knock down HK1 in HepG2 and Huh7 cells; Figure 15 Figure 1 shows the growth of subcutaneous tumors in HepG2 cells (A) and Huh7 cells (B) in nude mice. Figure 16 The tumor size (A) and weight (B) of tumor-bearing mice under different treatments are shown in the figure. Detailed Implementation
[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0023] Example 1: Screening of lncHBHK1 and verification of its binding with HK1 1. Screening of lncHBHK1 By inhibiting the mTOR pathway in HepG2 cells with rapamycin and combining it with lncRNA microarray analysis, unknown functional lncRNAs were screened. One of them was named lncHBHK1 (ENSG00000253361.1, NONCODE database name: RP11-675F6.3), and its sequence is shown in SEQ ID NO.1.
[0024] SEQ ID NO.1: TTCCAGGCTGTGGATCCGGTCGTGGGAAGCAGGCTGGTCTCCAACTTCTGGCTGCAAGTGATCCTCCCTCCTTGGCCTGGCAAAGTGCTGGGATTACAGGGCCGCACACATACAGAGCTGAACTTGTATCGCCGTGTAGATGAAGACAAACACCTTTAGGAGATGGCCGAGAAACAAAATGGGAAACCCTCAGGTCTCCAAATGACTAC ACCAAGCAGAATTGCCCCACCAGCCTGCACCATTCATTTCTAGACTATGAGCAAGAAGTACACTTCCATCTTATTTAAACAACCATATTTGGGGTTTTTGTTGTTGTTATTGTTGTTGTTATAGGAGCTTAGCTTTTACTCTAAGAAATACAGCTACTCAACTCACTTCATTAGGATCTTAACTATAATATCAAAACCTCCTAAGCAC.
[0025] 2. Magnetic bead method for analyzing RNA-protein pull-down assay The experimental procedures were referenced from Thermo Scientific. TM The reagent kit (No: 20164) is as follows: 2.1 Protein preparation: HepG2 cells were lysed on ice for 15 min with IP lysis buffer (containing 1% PMSF) and centrifuged at 14000g for 15 min at 4°C. The supernatant was collected and concentrated using a 10 kDa ultrafiltration tube (4000g, 4°C, ≥40 min) until the volume was ≤500 μL. Protein was then collected and stored at -80°C.
[0026] 2.2 Pretreatment of magnetic beads Take 50 μL of magnetic beads, separate them magnetically to remove the supernatant, wash them twice with a mixture of 0.1 M NaOH + 50 mM NaCl, and wash them once with 100 mM NaCl. Set aside for later use.
[0027] 2.3 Magnetic beads bind to labeled RNA (25-100 pmol RNA corresponds to 20-50 μL of magnetic beads) The magnetic beads were equilibrated twice with 20 mM Tris (pH 7.5), resuspended in 1×RNA Capture buffer, and approximately 20 μL of biotin-labeled RNA was added (DEPC water was used as a control). The mixture was incubated at room temperature for 15–30 min, with intermittent mixing.
[0028] 2.4 Biotin-labeled RNA and protein reaction and elution of binding proteins Magnetic beads were washed twice with 20 mM Tris, and 100 μL of 1× protein-RNA binding buffer was added. A Master Mix (containing 10× Protein-RNA Binding Buffer, glycerol, salt, protein sample, and water to a final volume of 100 μL) was prepared and incubated with the magnetic beads at 4°C for 60 min by rotation. The supernatant was collected (F1). The magnetic beads were washed with 1× Washing buffer, and the wash buffer was collected (F2). 50 μL of Elution buffer was added, and the mixture was incubated at 37°C for 15–30 min. The eluent was collected (E). Each sample was denatured with 5× Loading buffer and stored at -30°C for subsequent analysis.
[0029] The components of Master Mix reaction solution (Master Mix to RNA-protein binding buffer) are shown in Table 1: Table 1 Master Mix Reaction Solution Note: The protein concentration was very low, so the Thermo Fisher Scientific Qubit Protein Kit was used for detection. For specific steps, please refer to the reagent instructions (Invitrogen, NO: 2057447).
[0030] 2.5 Silver Dye Reference Thermo Scientific TM The kit (No: 24612) and the specific steps are as follows: After SDS-PAGE (12% separating gel), the samples underwent fixation (30% ethanol / 10% acetic acid), washing, sensitization, staining (Stain Working Solution), and development (Developer Working Solution). Gel imaging was performed after stopping with glacial acetic acid. The results are as follows: Figure 1 As shown, there is a distinct band around the 100 kD size.
[0031] 3. Mass spectrometry identification and analysis 3.1 Enzymatic hydrolysis of proteins by gel cutting Cut the target band (approximately 100 kD) into small pieces and wash with water. For Coomassie Brilliant Blue staining, decolorize with 150 mM NH4HCO3 / CH3CN (1:1) until colorless. For silver staining, this step can be omitted or K3Fe(CN)6 / Na2S2O3 can be used for decolorization. After dehydration of CH3CN, reduce and alkylate sequentially with DTT (56℃, 60 min) and IAA (in the dark, 45 min). After washing with NH4HCO3 and acetonitrile, add Trypsin (0.1 μg / μL, diluted 10-20 times) for adsorption at 4℃ for 30 min, and then enzymatically hydrolyze overnight at 37℃. Stop the reaction by adding 0.1% TFA and collect the enzymatic digest for later use.
[0032] 3.2 Mass spectrometry identification The enzymatic digest was mixed with an equal volume of saturated HCCA matrix (prepared with TA30), spotted onto the target and dried, and then analyzed using a Bruker Autoflex Speed TOF / TOF mass spectrometer to identify proteins that bind to lncHBHK1.
[0033] 3.3 Western Blot Protein samples were separated by 10% SDS-PAGE (stacking gel 70 V, 40 min; separating gel 110 V, 60 min) and transferred to a PVDF membrane (250 mA, 90 min). After blocking with 5% skim milk for 2 h, the samples were incubated with HK1 primary antibody (4°C overnight) and HRP-labeled secondary antibody (room temperature, 1 h). After washing with TBST, ECL was used for imaging. The results are shown below. Figure 2 As shown, lncHBHK1 combines with HK1.
[0034] 4. Identification by RNA-binding protein immunoprecipitation (RIP) RIP utilizes antibody-protein interactions, using antibodies or epitope markers to capture corresponding proteins in the cell nucleus or cytoplasm. RNA associated with these proteins is also captured. The captured RNA is identified using quantitative RT-qPCR. RIP is currently one of the main methods for verifying protein-lncRNA binding.
[0035] The steps are based on EMD Millipore Corp. (NO: 289118), and the specific process is as follows: 4.1 Cell Collection and Lysis Collect HepG2 cells with 80% confluence, wash with PBS, scrape and centrifuge, resuspend and lyse in 150 μL of RIP Lysis Buffer containing protease inhibitors and RNase inhibitors (on ice for 5 min), aliquot and store at -80℃.
[0036] 4.2 Immunoprecipitation and RNA extraction After equilibration with RIP Wash Buffer, the magnetic beads were incubated with 5 μg of antibody (experimental group anti-HK1, positive control anti-SNRNP70, negative control IgG) at room temperature for 30 min, followed by washing. 100 μL of cell lysis supernatant was mixed with 900 μL of IP Buffer (containing EDTA and RNase inhibitors) and incubated overnight at 4°C. 10 μL (Input) was stored. The complex was washed 6 times with RIP Wash Buffer and digested with buffer containing proteinase K at 55°C for 30 min. After extraction with phenol / chloroform, RNA was precipitated with ethanol overnight (-80°C).
[0037] 4.3 RNA extraction and qPCR analysis The precipitated RNA was washed with 80% ethanol and dissolved in 10 μL of DEPC water. Genomic DNA removal and reverse transcription were performed according to the kit instructions (Nanjing Novizan Kit, NO: R223-01) (42℃ 2 min; 50℃ 15 min; 85℃ 5 sec). qPCR was performed according to the Nanjing Novizan Kit (NO: Q311-02), with the reaction system containing SYBR Green Mix and forward and reverse primers. The program was: 95℃ 3 min; 95℃ 5 sec, 60℃ 30 sec, for a total of 35 cycles. Actin was used as an internal control, and 2... -△△Ct The relative expression level was calculated using the method. The results showed that HK1-enriched lncHBHK1 was 1110 times higher than the control group (…). Figure 3 ).
[0038] The primers used for qPCR reactions are shown in Table 2.
[0039] Table 2 Reaction Primers Example 2: Effect of lncHBHK1-specific binding to HK1 on liver cancer 1. Construction and extraction of recombinant plasmids Lentiviral vectors with knockdown of lncHBHK1 - pLko.1-lncHBHK and HK1 knockdown - pLko.1-HK1 Vector Construction: Target sequences for shRNA-lncHBHK1, shRNA-HK1, and shRNA-NC were synthesized. The target sequences were inserted into the shRNA framework shown below: Forward oligo: 5' CCGG-----21bp sense-----CTCGAG-----21bp antisense-----TTTTTG 3'; Reverse oligo: 5' AATTCAAAAA-----21bp sense-----CTCGAG-----21bp antisense 3'; primers were then synthesized by a primer synthesis company (Qingke Biotechnology Co., Ltd.). Based on the pLKO.1-puro plasmid, lentiviral vectors pLko.1-lncHBHK (knockdown of lncHBHK1) and pLko.1-HK1 (knockdown of HK1) were constructed. Construction of the lentiviral vector pCDH-lncHBHK1 overexpression vector: The pCDH-EF1-MCS-T2A-Puro plasmid was used as the base plasmid, and the full-length fragment of lncHBHK1 (SEQ ID NO.1) was inserted to construct the overexpression vector.
[0040] The target sequences of shRNA-lncHBHK1, shRNA-HK1, and shRNA-NC are as follows: shRNA-lncHBHK1 target sequence: CGCCGTGTAGATGAAGACAAA, SEQ ID NO.8; shRNA-HK1 target sequence: CCGCAACATCTTAATCGAC, SEQ ID NO.9; shRNA-NC target sequence: TTCTCCGAACGTGTCACGTTT, SEQ ID NO.10.
[0041] The lentiviral vectors pCDH-lncHBHK1 (overexpressing lncHBHK1), pLko.1-lncHBHK1 (knockdown of lncHBHK1), and pLko.1-HK1 (knockdown of HK1) were extracted using the OMEGA Endotoxin Removal Plasmid Extraction Kit (D6948-01). The lentiviral packaging plasmids were psPAX and pMD2.G, respectively.
[0042] Before starting the plasmid extraction experiment, the ultraviolet lamp in the clean bench was turned on for 30 minutes to ensure a sterile environment. Then, under sterile conditions, 50 mL EP tubes were taken, and 30 mL of LB liquid culture medium and 30 μL of ampicillin (Amp) were added. +Diluted 1:1000 (v / v) and 30-50 μL of the above different bacterial solutions, cultured at 37℃ and 250 rpm for 16 hours with shaking. After culture, centrifuged the bacterial solution at 10000 g for 1 min at 4℃, discarded the supernatant, and collected the bacterial precipitate. Added 600 μL of Solution I to the precipitate, resuspended by pipetting, and transferred to a 2 mL EP tube. Vortexed vigorously for 1 min to mix thoroughly. Then added 600 μL of Solution II, gently inverted to mix 6 times, and incubated at room temperature for 2 min to allow the bacterial cells to fully lyse. Added 300 μL of pre-chilled N3 Buffer, gently inverted until a white flocculent precipitate formed, incubated at room temperature for 2 min, centrifuged at 12000 g for 5 min, and transferred the supernatant to a new tube.
[0043] Add 1 / 10 volume of ETR Solution to the supernatant, invert to mix, and incubate on ice for 10 min, inverting 3 times every 2 min to remove endotoxins. Incubate at 42°C for 1 min, then centrifuge at 12000 g for 5 min. Collect the supernatant, add 1 / 2 volume of anhydrous ethanol, mix, and incubate at room temperature for 2 min to precipitate nucleic acids. Add the mixture in 700 μL portions to a Hiband® DNA Mini Column purification column, centrifuge at 12000 g for 1 min, and repeat until all samples have passed through the column. Discard the waste liquid, add 500 μL of HBC Buffer to the column, and centrifuge at 12000 g for 1 min to wash. Transfer the purification column to a new 1.5 mL EP tube and incubate at room temperature for 3 min to allow ethanol to evaporate completely. Finally, add 50 μL of DEPC water, incubate at room temperature for 3 min, and centrifuge at 12000 g for 1 min to elute plasmid DNA. Discard the purification column, collect the eluent, and use a NanoDrop micro spectrophotometer to detect the plasmid concentration and purity. Label the plasmid and store it at -20℃ for later use.
[0044] 2. Lentiviral packaging To perform lentiviral packaging, cultured HEK-293T cells were first packaged at 1.0 × 10⁶ cells per dish. 4Cells were seeded at a density of 1,000 cells / mL in 6 cm culture dishes, gently agitated using a cross-hatching method to ensure even distribution, and then placed in an incubator to allow them to adhere and grow. Transfection was performed when the cell density reached approximately 70%. Two 1.5 mL EP tubes were prepared, labeled A and B, and 500 μL of Opti-MEM medium was added to each tube. In tube A, 10 μL of Lipofectamine 3000 was added, gently mixed by pipetting, and incubated at room temperature for 1 min. In tube B, 10 μL of P3000, 4 μg of pCDH-lncHBHK1 plasmid (the control group used an equal amount of pCDH-GFP plasmid) or pLko.1-lncHBHK1 / pLko.1-HK1 (the control group used an equal amount of pLko.1-NC plasmid), 3 μg of psPAX2 plasmid, and 1 μg of pMD2.G plasmid were added, mixed by pipetting, and incubated at room temperature for 1 min. The liquid in tube B was then transferred entirely to tube A, gently mixed by pipetting, and allowed to stand at room temperature for 15 minutes to form the transfection complex. This mixture was then added dropwise to HEK-293T cells, and the cells were incubated for 12 hours. The culture medium was then replaced with DMEM complete medium, and viral supernatant was collected at 24 and 48 hours post-transfection. Finally, the viral solution was filtered through a 0.45 μm filter and aliquoted into 1.5 mL EP tubes (1 mL per tube), and stored at -80°C for later use.
[0045] 3. Screening of lethal puromycin concentrations in HepG2 / Huh7 cells and construction of HepG2 / Huh7 cell lines with lncHBHK1 knockout, HK1 knockout, and lncHBHK1 overexpression. To screen the optimal puromycin concentration required for the construction of stable HepG2 / Huh7 cell lines, cells were first cultured at 25 × 10⁶ cells per well. 4 Cells were seeded at a density of [number] cells per well in 6-well plates. When cell confluence reached 50%, the medium was replaced with DMEM containing a series of gradient concentrations of puromycin (0, 0.2, 0.4, 0.6, 0.8, 1.0, 2.0, 3.0, 4.0, and 5.0 μg / mL), with replicates for each concentration. After culturing for another 72 h, cell survival and death were observed and compared under a microscope. The lowest puromycin concentration that caused complete cell death was used as the working concentration for subsequent stable cell line selection. The optimal lethal puromycin concentration for HepG2 and Huh7 cells was ultimately determined to be 2.5 μg / mL.
[0046] After determining the optimal puromycin selection concentration, HepG2 / Huh7 cells were cultured at 2.5 × 10⁶ cells per well. 4Cells were seeded at a density of [number] cells / well in 6-well plates and cultured for 12 h until fully adherent. Then, 300 μL of the corresponding viral solution was added to each well to infect the cells. After 12 h, the medium was replaced with fresh DMEM complete medium, and the cells were cultured for another 72 h to allow the target gene carried by the virus to integrate into the cell genome. Stable cell lines were then selected: the DMEM medium containing 2.5 μg / mL puromycin was changed daily for 7 consecutive days to effectively eliminate untransfected cells. Cells surviving after 7 days of selection were identified as stable cell lines with knockdown or overexpression of the target gene, and named sh-lncHBHK1, oe-lncHBHK1, and sh-HK1, respectively.
[0047] To verify the efficiency of the cell model, Western blotting was used to detect HK1 protein levels in cells. The results showed that, compared with the control group, HK1 protein expression was inhibited in the sh-lncHBHK1 group, while its expression was significantly increased in the oe-lncHBHK1 group. Figure 4 (A and B). However, qPCR detection showed that the mRNA level of HK1 in cells of each group did not change significantly (A and B). Figure 4 (C and D). The results indicate that lncHBHK1 regulates HK1 expression at the protein level, but does not affect its transcriptional level.
[0048] Analysis of HK1 expression levels in sh-HK1 cells using qPCR and Western blotting revealed that both HK1 mRNA and protein levels were significantly inhibited. Figure 5 This indicates that the HK1 stably knocked-down cells were successfully constructed.
[0049] 4. Cycloheximide (CHX) treatment of cells was followed by Western blotting to detect intracellular HK1 protein expression levels. To investigate the effect of lncHBHK1 on HK1 protein stability, stably transfected cell lines with lncHBHK1 knockdown were seeded in 6-well plates and cultured for 24 h, after which the original culture medium was discarded. 1 mL of complete DMEM medium containing 20 μM CHX (cyclohexylimide) was added to each well, and treatment was terminated at 0, 2, 4, 6, 8, and 10 h. The culture medium was discarded, and the cells were washed once with 1× PBS. Then, 100 μL of IP lysis buffer was added to each well to collect the cells. After total protein extraction, the intracellular HK1 protein expression level was detected by Western blotting. The results showed that HK1 protein expression gradually decreased with prolonged CHX treatment time; the decrease in HK1 protein was more significant in cells with lncHBHK1 knockdown. Figure 6 This result indicates that the loss of lncHBHK1 accelerates the degradation of the HK1 protein, suggesting that lncHBHK1 plays an important role in maintaining the stability of the HK1 protein.
[0050] 5. Cell treatment with MG132 To investigate the effect of lncHBHK1 on the stability of HK1 protein and its role in the proteasome degradation pathway, stable cell lines with lncHBHK1 knockdown were seeded in 6-well plates and cultured for 24 h. The original culture medium was then discarded. 1 mL of complete DMEM medium containing 5 μM proteasome inhibitor MG132 was added to each well, and treatment continued for another 24 h. After treatment, the culture medium was discarded, and cells were washed once with 1× PBS in each well. Cells were then lysed with 100 μL of IP lysis buffer, and samples were collected. Total protein was extracted, and the expression level of HK1 protein in the cells was detected by Western blotting. The results showed that MG132 treatment significantly increased HK1 protein expression compared to the control group; and the increase in HK1 protein expression was even more significant in cells with lncHBHK1 knockdown. Figure 7 The above results indicate that inhibiting the proteasome pathway can restore the stability of HK1 protein, and the absence of lncHBHK1 enhances this effect, further demonstrating that lncHBHK1 participates in maintaining the stability of HK1 protein by regulating the proteasome-dependent degradation pathway.
[0051] 6. Chloroquine (CQ) treatment of cells To investigate whether the autophagy pathway is involved in the regulation of HK1 protein expression by lncHBHK1, cell lines with knocked-down lncHBHK1 were seeded in 6-well plates and cultured for 24 h, after which the original culture medium was discarded. 1 mL of complete DMEM medium containing 10 μM autophagy inhibitor chloroquine (CQ) was added to each well, and the cells were treated for 6 h. After treatment, the culture medium was discarded, and each well was washed once with 1× PBS. Cells were lysed with 100 μL of IP lysis buffer, and samples were collected. Total protein was extracted, and the intracellular HK1 protein expression level was detected by Western blotting. Results are as follows: Figure 8 As shown, CQ treatment did not significantly alter the expression level of HK1 protein in knocked-down lncHBHK1 cells compared to the control group. This result indicates that inhibiting the autophagy pathway does not affect HK1 protein expression, and that the regulation of HK1 stability by lncHBHK1 is independent of the autophagy pathway.
[0052] 7. IP To investigate the regulatory role of lncHBHK1 in ubiquitination modification of HK1 protein, stable cell lines were seeded in 15 cm culture dishes. After the cells reached a suitable density, they were treated with 5 μM proteasome inhibitor MG132 for 24 h or left untreated. After discarding the culture medium, each dish was washed twice with 4 mL of 1× PBS, followed by scraping cells with 1 mL of pre-chilled 1× PBS and transferring them to 1.5 mL centrifuge tubes. The cell pellet was collected by centrifugation at 1000 rpm for 5 min at 4 °C. 800 μL of RIP lysis buffer and 4 μL of protease inhibitor were added to each cell pellet, vortexed, and lysed on ice for 5 min, followed by freezing at -80 °C for 10 min. After thawing, the cells were centrifuged at 14000 rpm for 10 min at 4 °C. The supernatant was aliquoted and stored at -80 °C, with 100 μL reserved as the Input sample.
[0053] For immunoprecipitation, 50 μL of magnetic beads were mixed with 100 μL of wash buffer and 5 μg of Anti-HK1 antibody, and incubated at room temperature for 30 min to prepare an antibody-magnetic bead complex. After washing with 500 μL of wash buffer, the complex was resuspended in 100 μL of wash buffer, thawed cell lysis buffer was added, and the mixture was incubated overnight at 4°C. The next day, the magnetic bead-antibody-antigen complex was washed 6 times with 500 μL of wash buffer, and finally 30 μL of 1× protein loading buffer was added. The mixture was heated in a 100°C metal bath for 10 min to denature and elute the protein. The BCA protein concentration in the input group samples was simultaneously determined for subsequent quantitative analysis.
[0054] Western blotting analysis of HK1 protein ubiquitination levels showed that overexpression of lncHBHK1 significantly reduced HK1 protein ubiquitination levels compared to the control group (sh-NC / Vector), while knockdown of lncHBHK1 significantly enhanced HK1 ubiquitination modification. Figure 9 The results showed that lncHBHK1 can effectively inhibit ubiquitination of HK1 protein, thereby maintaining its protein stability.
[0055] 8. CCK-8 Experiment To evaluate the effect of lncHBHK1 on the proliferation of liver cancer cells, the viability of HepG2 and Huh7 cells in the control and experimental groups (lncHBHK1 knockdown) was detected using the CCK-8 assay. First, the old culture medium in the cell culture plate was discarded, and each well was gently washed twice with 500 μL PBS. Then, 500 μL of trypsin was added to each well, and the cells were digested at room temperature for 5 min. After the cells began to detach, the trypsin was discarded, and an equal volume of complete culture medium was added to stop the digestion. The cells were then resuspended and centrifuged at 800 rpm for 5 min to collect the cell pellet. The cells were resuspended in 800 μL of complete culture medium, and after single-cell resuscitation, they were counted. The cell concentration was adjusted, and the cells were seeded at 3000 cells per well into 96-well plates and placed in an incubator to allow cell adhesion. Detection was performed at 0, 24, 48, 72, and 96 h: the culture medium in each well was discarded, and 100 μL of DMEM containing 10% CCK-8 reagent was added to each well for incubation in the dark for 2 h. Finally, the absorbance (OD value) of each well was measured using a microplate reader at a wavelength of 450 nm. The results are as follows: Figure 10 As shown, knocking down lncHBHK1 can significantly inhibit the proliferation of liver cancer cells.
[0056] 9. Plate cloning experiment To evaluate the effect of lncHBHK1 on the clonogenic ability of hepatocellular carcinoma cells, a plate colony formation assay was used. HepG2 and Huh7 cells from the control and experimental groups (lncHBHK1 knocked down) were collected after treatment. The old culture medium was discarded, and the cells were washed twice with PBS. 500 μL of trypsin was added to each well for 5 min of digestion, followed by stopping the digestion with complete culture medium. Cells were collected by centrifugation and resuspended to prepare a single-cell suspension. After counting, 3000 cells were seeded into each well of a 6-well plate, and complete culture medium was added to 2 mL. The cells were gently mixed to ensure even distribution and then incubated at 37°C with 5% CO2 for 7 days. Cell growth was observed regularly during this period. After 7 days, the old culture medium was discarded, and the cells were washed twice with PBS. 1 mL of 4% paraformaldehyde was added to each well for fixation at room temperature for 30 min. After discarding the fixative, 500 μL of crystal violet staining solution was added for staining for 30 min. Excess stain was removed by washing with ddH2O, and the cells were air-dried upside down at room temperature. Finally, the cells were observed under a microscope, and ImageJ software was used for cell colony counting and analysis. The results showed that knocking down lncHBHK1 significantly inhibited the clonogenic ability of liver cancer cells. Figure 11 Inhibition of proliferation was also observed in cells with knocked-down HK1. Figure 12 ).
[0057] 10. EdU detection To evaluate the effect of lncHBHK1 on the DNA replication activity of hepatocellular carcinoma cells, the EdU assay was used for analysis. HepG2 and Huh7 cells from the control and experimental groups were used to prepare single-cell suspensions, and then 1.0 × 10⁶ cells were added to each well. 4 Cells were seeded at a density of [number] cells per well in 24-well plates containing climbing slides and cultured overnight. Once the cells were stable, they were mixed with an equal volume of culture medium using freshly prepared 20 μM EdU working solution (obtained by diluting 10 mM EdU stock solution 1:500 with DMEM) to a final concentration of 10 μM, and incubated at 37°C for 2 h. After discarding the culture medium, 500 μL of cell fixative was added to each well for fixation at room temperature for 15 min, followed by washing three times (5 min each) with washing buffer. Then, 500 μL of permeabilization buffer was added to each well for treatment at room temperature for 15 min, followed by washing twice (5 min each) with washing buffer.
[0058] During EdU assay, a Click reaction mixture (containing 86 μL Click Reaction Buffer, 4 μL CuSO4, 0.2 μL 488 Azide, and 10 μL Click Additive Solution) was prepared fresh before use. 100 μL of Click reaction solution was added to each well, and the cells were incubated at room temperature in the dark for 30 min, followed by washing three times with washing buffer (5 min each time). For nuclear staining, Hoechst 33342 was diluted 1:1000 with 1× PBS, and 500 μL was added to each well for staining in the dark for 10 min, followed by washing three times with PBS (5 min each time). Finally, the cells were observed and detected using a laser confocal microscope with an excitation wavelength of 495 nm and an emission wavelength of 519 nm.
[0059] Experimental results are as follows Figure 13 and Figure 14 As shown, knocking down lncHBHK1 or HK1 can significantly inhibit the DNA replication activity of liver cancer cells.
[0060] 11. Subcutaneous tumor formation experiment in nude mice To evaluate the effect of lncHBHK1 on liver cancer growth in vivo, this invention conducted a subcutaneous tumorigenesis experiment in nude mice. HepG2 / Huh7 cells in logarithmic growth phase were collected, including a control group (sh-NC) and an experimental group (sh-lncHBHK1 stable cell line). After trypsin digestion, single-cell suspensions were prepared by resuspending the cells in pre-chilled PBS. Each suspension was divided into 7 × 10⁻⁶ cells. 6One cell line was resuspended in 200 μL PBS and subcutaneously injected into the upper right back of 5-6 week old nude mice. All mice were housed in an SPF-grade environment. The health status and tumor formation of the mice were observed every other day after inoculation. Once the tumor was visible to the naked eye, the longest diameter (L) and shortest diameter (W) of the tumor were measured weekly and calculated using the formula V = π / 6 × L × W. 2 Tumor volume was calculated. At the end of the experiment, nude mice were anesthetized with an overdose of sodium pentobarbital, and the tumor tissue was completely dissected, weighed, and photographed. The results showed that, compared with the control group, knockdown of lncHBHK1 significantly inhibited tumor growth, resulting in a reduction in tumor volume. Figure 15 ) and weight loss ( Figure 16 ).
[0061] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of a reagent that inhibits the degradation of long non-coding RNA by proteases in the preparation of drugs for treating liver cancer, characterized in that, The nucleotide sequence of the long non-coding RNA is shown in SEQ ID NO.1; The reagent includes shRNA that knocks out the expression of the long non-coding RNA; The nucleotide sequence of the shRNA target sequence is shown in SEQ ID NO.
8.
2. The application according to claim 1, characterized in that, The shRNA exerts a therapeutic effect by knocking down the expression level of the long non-coding RNA, accelerating the degradation of HK1 protein, and inhibiting the proliferation of liver cancer cells.
3. The application according to claim 2, characterized in that, The shRNA enhances the ubiquitination modification of HK1 by knocking down the expression level of the long non-coding RNA, thereby accelerating the degradation of the HK1 protein.
4. The use of a lentiviral recombinant vector in the preparation of a drug for treating liver cancer, characterized in that the lentiviral recombinant vector comprises a nucleotide sequence as shown in SEQ ID NO.
8.
5. The application according to claim 4, characterized in that, The lentiviral recombinant vector achieves the therapeutic effect of treating liver cancer by knocking down the expression level of long non-coding RNAs as shown in SEQ ID NO. 1.