A nucleic acid aptamer LWB-1 targeting CNTFR alpha protein and application thereof

Abstract

This invention relates to a nucleic acid aptamer LWB-1 targeting the CNTFRα protein and its applications, belonging to the field of molecular biotechnology. This invention provides a nucleic acid aptamer LWB-1 targeting the CNTFRα protein, the core nucleotide sequence of which is shown in SEQ ID No. 1. This invention utilizes cell-SELEX screening technology to obtain the nucleic acid aptamer LWB-1, which specifically recognizes the CNTFRα protein. It possesses a unique stem-loop structure, and flow cytometry analysis revealed that it exhibits high binding affinity and specificity for the CNTFRα protein. It specifically recognizes CNTFRα-293T cells but not 293T cells. Furthermore, it is easily modified, non-cytotoxic, exhibits strong binding specificity, is non-immunogenic, and highly stable, showing broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a nucleic acid aptamer LWB-1 that targets the CNTFRα protein and its applications. Background Technology

[0002] The biological effects of CNTF (ciliary neurotrophic factor) on target cells are mediated by a three-component receptor complex: CNTFRα, the specific receptor for CNTF, and two signal transduction subunits, LIFRβ and Gp130. CNTFRα was initially identified using epitope labeling techniques and subsequently cloned using a marker-ligand elimination method. CNTFRα is primarily expressed in the nervous system and skeletal muscle. Lacking transmembrane or intracellular domains, CNTFRα cannot directly induce signal transduction; it is linked to the plasma membrane via glycosylated phosphatidylinositol. Genetic ablation of CNTFRα leads to severe motor neuron defects and perinatal death, highlighting its importance in nervous system development. Traumatic optic neuropathy (TON) primarily refers to optic nerve damage caused by sudden blunt force trauma to the frontotemporal region of the orbit, resulting in decreased or lost vision. Loss of regenerative capacity of RGCs (retinal ganglion cells) and their axons makes optic nerve damage irreversible, leading to vision loss. To date, there is no effective treatment. Ciliary neurotrophic factor (CNTF) is currently the most effective growth factor for repairing optic nerve damage. It can both protect the original RGC and promote axon regeneration.

[0003] Recombinant CNTF is currently available, but it suffers from disadvantages such as high production costs, long production cycles, poor batch stability, high immunogenicity, and high price. Studies have shown that continuous administration of CNTF can achieve long-term neuroprotection. The challenge lies in how to effectively and sustainably deliver CNTF to the retina. Due to the presence of the blood-retinal barrier (BRB), large molecules such as CNTF administered systemically have difficulty reaching the retina. Furthermore, when administered intravenously or subcutaneously, CNTF protein is rapidly cleared from the bloodstream. Pharmacokinetic studies in rats showed a two-phase clearance after intravenous injection of CNTF, with an initial plasma half-life of 2.9 minutes and a slower second phase with a half-life of 4 hours. Approximately 75% of CNTF was removed from circulation within 10 minutes. In a human study, plasma CNTF concentrations were monitored after a single subcutaneous injection of recombinant human CNTF. Plasma CNTF concentrations peaked at 180–260 minutes, followed by a decline phase with an elimination half-life of 120–400 minutes. Systemic administration of CNTF may also cause adverse reactions, including fever, cough, weakness, nausea, loss of appetite, weight loss, stomatitis, and increased C-reactive protein.

[0004] Nucleic acid aptamers possess advantages such as small size, high specificity, high stability, low immunogenicity, ease of modification, and ability to be constructed for targeted delivery, making them potential targets for protein recognition and labeling. Nucleic acid aptamers are single-stranded DNA or RNA molecules of 20-100 nucleotides in length. They are obtained through phylogenetic screening of ligands using the SELEX (Sequential Elasticity-Enrichment) method, and can form three-dimensional structures that specifically bind to target molecules. The most significant characteristics of nucleic acid aptamers are as follows: 1) First, aptamer-mediated molecular recognition has high specificity, which can be used to distinguish subtle molecular differences. This ability to accurately distinguish molecular features helps to elucidate the molecular basis of pathogenesis. 2) Cell-SELEX was developed to simulate living cells in a real environment. It can generate aptamers for any cell of interest without relying on prior knowledge of its molecular characteristics. 3) Nucleic acid aptamers are easy to modify, enhancing their in vivo stability. They can also be coupled with other drugs, molecules, or nanoparticles. After binding to receptors on the cell membrane, they can mediate the entry of themselves or coupled particles into the cell, making them ideal targeted molecular tools for drug delivery. However, there are currently no reports of nucleic acid aptamers that can specifically bind to CNTFRα.

[0005] Based on this, the present invention is proposed. Summary of the Invention

[0006] The purpose of this invention is to provide a nucleic acid aptamer LWB-1 that targets the CNTFRα protein and its application, in order to solve the problem of the lack of nucleic acid aptamers that can specifically bind to CNTFRα in the prior art.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides a nucleic acid aptamer LWB-1 that targets the CNTFRα protein, the core nucleotide sequence of which is shown in SEQ ID No. 1.

[0008] Preferably, the nucleic acid aptamer LWB-1 is prepared at 23~27℃ with 0.5~1.5mM Na + 0.1~10mM Mg 2+ It exhibits a unique stem-ring structure under certain conditions.

[0009] Preferably, the CNTFRα protein is a human-derived CNTFRα protein.

[0010] Preferably, the two ends or one end of the nucleic acid aptamer LWB-1 can be modified by radiolabeling, therapeutic drug conjugation, fluorescent labeling or biotin labeling.

[0011] This invention provides the use of the described nucleic acid aptamer LWB-1 in any of the following aspects: (1) Application in the preparation of CNTFRα protein detection reagent; (2) Application in the preparation of CNTFRα targeting carrier reagents; (3) Application in studying CNTFRα expression levels; (4) Application in the preparation of reagents for detecting in vivo CNTFRα protein; (5) Use in the preparation of a medicament for treating diseases, said diseases including optic nerve injury, retinitis pigmentosa, macular degeneration, glaucoma, amyotrophic lateral sclerosis, retinal light damage model, Parkinson's disease, obesity and type 2 diabetes model, cerebral ischemia, epilepsy and experimental autoimmune encephalomyelitis.

[0012] The present invention has the following technical effects and advantages: This invention utilizes cell-SELEX screening technology to screen and obtain the nucleic acid aptamer LWB-1, which specifically recognizes the CNTFRα protein. This nucleic acid aptamer can be screened at 25°C with 1.0 mM Na. + 0.5mM Mg 2+ The stem-loop structure under the specified conditions was analyzed, and flow cytometry revealed that it possesses high binding affinity and specificity, specifically recognizing CNTFRα-293T cells but not 293T cells. The selected nucleic acid aptamer can be further truncated and optimized to reduce molecular weight, save synthesis costs, and improve affinity. This nucleic acid aptamer is also easily modified, non-cytotoxic, exhibits strong binding specificity, is non-immunogenic, and highly stable. It can serve as a molecular probe for the specific recognition of CNTFRα protein, showing significant potential in the diagnosis and targeted therapy of CNTFRα protein-related diseases. Attached Figure Description

[0013] Figure 1 The nucleic acid aptamer LWB-1 was prepared at 25℃ with 1.0 mM Na. + 0.5mM Mg 2+ Stem-ring structure diagram under the specified conditions; Figure 2 The fluorescence intensity of nucleic acid aptamers in the nucleic acid aptamer library binding to CNTFRα-293T cells and MOCK cells; Figure 3 Figure showing the localization results of nucleic acid aptamer LWB-1 and anti-CNTFRα protein antibody on the cell membrane of CNTFRα-293T cells; Figure 4 Fluorescence curves of different nucleic acid aptamers LWB-1 binding to CNTFRα-293T; Figure 5 The statistical results of observations on retinal ganglion cells (RGCs) in the retinas of mice in different treatment groups. Detailed Implementation

[0014] This invention provides a nucleic acid aptamer LWB-1 that targets the CNTFRα protein, the core nucleotide sequence of which is shown in SEQ ID No. 1; The nucleotide sequence of SEQ ID No. 1 is: CATCTCTTCCCTCTCCACCTATTCTCCTCCCCCTCTCTCTCGGA; Preferred nucleic acid aptamers including the core nucleotide sequence all have the same functional effects as nucleic acid aptamer LWB-1; The preferred nucleotide sequence of the nucleic acid aptamer LWB-1 is shown in SEQ ID No. 5; The nucleotide sequence of SEQ ID No. 5 is: ACCGACCGTGCTGGACTCACATCTCTTCCCTCTCCACCTATTCTCCTCCCCCTCTCTCTCGGAACTATGAGCGAGCCTGGCG.

[0015] In this invention, the nucleic acid aptamer LWB-1 is prepared at 23-27°C with 0.5-1.5 mM Na + 0.1~10mM Mg 2+ It has a unique stem-ring structure under certain conditions; The preferred nucleic acid aptamer LWB-1 is prepared at 25°C with 1.0 mM Na. + 0.5mM Mg 2+ Under certain conditions, it has a unique stem-ring structure, such as Figure 1 As shown.

[0016] In this invention, the CNTFRα protein is a human-derived CNTFRα protein.

[0017] In this invention, the two ends or one end of the nucleic acid aptamer LWB-1 may be modified by radiolabeling, therapeutic drug conjugation, fluorescent labeling or biotin labeling.

[0018] This invention provides the use of the described nucleic acid aptamer LWB-1 in any of the following aspects: (1) Application in the preparation of CNTFRα protein detection reagent; (2) Application in the preparation of CNTFRα targeting carrier reagents; (3) Application in studying CNTFRα expression levels; (4) Application in the preparation of reagents for detecting in vivo CNTFRα protein; (5) Use in the preparation of a medicament for treating diseases, said diseases including optic nerve injury, retinitis pigmentosa, macular degeneration, glaucoma, amyotrophic lateral sclerosis, retinal light damage model, Parkinson's disease, obesity and type 2 diabetes model, cerebral ischemia, epilepsy and experimental autoimmune encephalomyelitis.

[0019] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0020] The primary cells used in the examples were extracted from adipose connective tissue isolated from orbital decompression surgery in patients with thyroid-related diseases; human embryonic kidney cell line (293T) and human neuroblastoma cells (SH-SY5Y) were purchased from Wuhan Pronosei Life Science Technology Co., Ltd.

[0021] Example 1: Screening of nucleic acid aptamer LWB-1

[0022] The nucleic acid aptamer LWB-1 was screened using cell-SELEX technology.

[0023] Experimental materials

[0024] CNTFRα-293T cells: obtained by transfecting 293T cells with CNTFRα plasmid using lentivirus.

[0025] MOCK cells: Obtained by transfecting 293T cells with a lentiviral empty vector plasmid.

[0026] The nucleic acid aptamer LWB-1 was screened using cell-SELEX technology, and the specific method is as follows: (1) Design of library and primers a. Design of random single-stranded DNA libraries: The random single-stranded DNA library was obtained by sequentially linking 5'-ACCGACCGTGCTGGACTCA-3' (SEQ ID No. 2), 42N (N represents any of the four bases A, T, G, and C, and 42N represents all sequences composed of any of the four bases A, T, G, and C), and 5'-ACTATGAGCGAGCCTGGCG-3' (SEQ ID No. 3), and was synthesized by Sangon Biotech (Shanghai) Co., Ltd. b. Primer design Upstream primer: 5'-fluorescein isothiocyanate-ACCGACCGTGCTGGACTCA-3' (SEQ ID No. 2) Downstream primer: 5'-Biotin-CGCCAGGCTCGCTCATAGT-3' (SEQ ID No. 4) (2) Screening process CNTFRα-293T cells, which highly express CNTFRα protein, were used as positive screening targets, while MOCK cells, which do not express CNTFRα, were used as negative screening targets. 1. Positive screening a. Incubation: Dissolve the random single-stranded DNA library in binding buffer, denature at 95°C for 5 min, anneal on ice for 10 min, and then co-incubate with pretreated CNTFRα-293T cells with a confluence of 90% and a positive screening target at 4°C for 1 h. b. Separation: After incubation, remove the supernatant and wash the cells several times with DPBS solution containing 5 mM MgCl2 and 4.5 mg / mL glucose. Then, scrape the washed cells with sterile water and centrifuge tubes. Denature at 95°C for 10 min, anneal on ice for 10 min, centrifuge at 5500 rpm for 3 min, and collect the supernatant to obtain the first round of screening nucleic acid library for CNTFRα-293T cells. c. PCR amplification library: Using the nucleic acid library screened in the first round as a template, PCR amplification was performed using the designed primers to obtain preliminary amplification products. Then, the amplification products were used as templates to amplify 10 times to obtain a large number of amplification products. The amplification conditions were: 95℃, 30s; 55.9℃, 30s; 72℃, 30s for 8 cycles, followed by 72℃, 5min. The PCR amplification system consisted of: 65.5 μL deionized water, 10 μL 10× Buffer, 6 μL 2.5 mM dNTPs, 1.5 μL 10 μM forward primer, 1.5 μL 10 μM reverse primer, 15 μL template, and 0.5 μL Taq enzyme. d. DNA single-strand preparation: The antisense strand of the biotin-labeled amplification products was separated using streptavidin-modified agarose beads, and then the DNA double strand was denatured with 0.2M NaOH. The positive sense DNA single-strand library labeled with fluorescein isothiocyanate was collected by desalting.

[0027] 2. Reverse screening

[0028] The obtained positive DNA single-stranded library was co-incubated with the reverse screening target MOCK cells at 4°C for 1 hour. After the incubation, the supernatant was collected and then used to perform positive screening with the positive screening target CNTFRα-293T cells. 3. Cyclic screening process: Repeat the screening process of "1. positive screening" and "2. reverse screening" until a nucleic acid aptamer library that binds strongly to the positive screening target CNTFRα-293T cells is selected; 4. High-throughput sequencing: The nucleic acid library with the largest binding in the last round of screening will be subjected to high-throughput sequencing. The binding ability of the obtained sequences to CNTFRα-293T cells will be detected by flow cytometry to determine the nucleic acid aptamers. The flow cytometry detection method is as follows: First, CNTFRα-293T cells and MOCK cells were cultured for 48 hours to achieve a cell density of 90%. Then, the adherent cells were digested from the culture dishes using 0.2% EDTA. 200 μL of pre-synthesized FAM-labeled aptamers from the aptamer library was prepared using 250 nM of binding buffer, denatured at 95°C for 5 min, and annealed on ice for 10 min. These were then co-incubated with 300,000 CNTFRα-293T cells and MOCK cells at 4°C for 45 min. The cells were washed 2-3 times with washing buffer (DPBS buffer containing 5 mM MgCl2 and 4.5 mg / mL glucose), and then resuspended in 300 μL of washing buffer. Fluorescence was detected by flow cytometry, using an initial randomized DNA library as a control. The fluorescence intensity of the aptamers in the aptamer library binding to CNTFRα-293T cells and MOCK cells was measured. The results are shown below. Figure 2 As shown in the figure, the horizontal axis FAM represents the fluorescence signal, and the vertical axis represents the cell number.

[0029] according to Figure 2 It was found that aptamers LWB-1, LWB-2, LWB-4, and LWB-8 in the nucleic acid aptamer library could enhance the fluorescence signal of the positive screening target CNTFRα-293T cells, indicating that they could bind to the positive screening target CNTFRα-293T cells. Further testing with the reverse screening target MOCK cells revealed that aptamer LWB-1 did not significantly enhance the fluorescence signal of the reverse screening target MOCK cells. Finally, aptamer LWB-1 was determined to be the optimal nucleic acid aptamer, with the nucleotide sequence: ACCGACCGTGCTGGACTCACATCTCTTCCCTCTCCACCTATTCTCCTCCCCCTCTCTCTCGGAACTATGAGCGAGCCTGGCG (SEQ ID No. 5), and its core sequence: CATCTCTTCCCTCTCCACCTATTCTCCTCCCCCTCTCTCGGA (SEQ ID No. 1).

[0030] Example 2: Localization of nucleic acid aptamer LWB-1 and anti-CNTFRα protein antibody on the cell membrane of CNTFRα-293T cells

[0031] The nucleic acid aptamer LWB-1 was co-stained with anti-CNTFRα protein antibody on CNTFRα-293T cells for localization, as follows: Cell preparation: CNTFRα-293T cells were seeded in laser confocal microscopy dishes (Φ35mm) and the density was adjusted to achieve 90-95% confluence (logarithmic growth phase) after 24 hours. After removing the culture medium, two gentle washes (2mL / wash) were performed using pre-cooled (4℃) washing buffer (DPBS, pH 7.4), and the washing process was completed using the three-dimensional tilting method.

[0032] Fixation: Add 4% paraformaldehyde (PFA) fixative (1 mL / plate) and perform chemical cross-linking for 20 min at room temperature. This step effectively maintains the integrity of the cell's ultrastructure while preserving the membrane surface antigen epitopes.

[0033] Blocking: Use DNA blocking solution, add it to a glass slide, and incubate at 4°C for 1 hour.

[0034] Incubate with primary antibody: After removing the blocking solution, add anti-CNTFRα antibody working solution (1:200 diluted in the blocking solution, 100 μL / sample) to ensure complete coverage of the detection area. Transfer to a humidified chamber at 4°C and incubate for 12–16 h.

[0035] Secondary antibody incubation: After equilibration at room temperature, the samples were washed three times (5 min each time) with PBST (0.05% Tween-20). Alexa Fluor 594-labeled secondary antibody complex (1:400 dilution, 100 μL / sample) was added, and the samples were incubated at room temperature in the dark for 60 min. The samples were then washed three more times with PBS buffer, 5 min each time, to obtain the final sample.

[0036] Aptamer preparation: First, prepare a 250 nM concentration of nucleic acid aptamer LWB-1, heat it in a constant temperature metal bath at 95℃ for 10 minutes, and then immediately place it on ice and let it stand for 10 minutes.

[0037] Aptamer incubation: Add the pretreated aptamer solution to the sample system (final volume 500 μL) and incubate at 4°C on a horizontal shaker (80 rpm) for 30 min. Remove unbound aptamers using a washing buffe (3 × 500 μL), centrifuging at 1000 rpm for 3 min after each wash. Counterstain cell nuclei with DAPI and wash again.

[0038] Confocal laser microscopy imaging: Select the appropriate laser channel and objective lens, take a picture, and save the data. The localization results of nucleic acid aptamer LWB-1 and anti-CNTFRα protein antibody on the cell membrane of CNTFRα-293T cells are as follows: Figure 3As shown in the figure, DAPI represents the staining pattern of the cell nucleus in CNTFRα-293T cells, CNTFR represents the staining pattern of the anti-CNTFRα protein antibody in CNTFRα-293T cells, LWB-1 represents the staining pattern of the nucleic acid aptamer LWB-1 in CNTFRα-293T cells, bright field represents the bright field pattern of CNTFRα-293T cells, and merge represents the mixed staining pattern of CNTFRα-293T cells.

[0039] according to Figure 3 It can be seen that the anti-CNTFRα protein antibody and the nucleic acid aptamer LWB-1 co-stained the same protein, namely the CNTFR protein, which is located on the cell membrane.

[0040] according to Figure 3 It can be seen that the nucleic acid aptamer LWB-1 and the anti-CNTFRα protein antibody co-localize on the cell membrane of CNTFRα-293T cells.

[0041] Example 3: Flow cytometry determination of the dissociation constant of nucleic acid aptamer LWB-1 for CNTFRα-293T

[0042] The dissociation constant (Kd) was determined using nucleic acid aptamer LWB-1 and target cells CNTFRα-293T at concentration gradients of 0 nM, 25 nM, 50 nM, 75 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 400 nM, and 800 nM. The Kd value represents the affinity between the aptamer and the cell; the smaller the Kd value, the higher the affinity.

[0043] CNTFRα-293T cells were cultured for 24 hours to achieve a cell density of 90%, and then the adherent cells were digested from the culture dishes using 0.2% EDTA. The synthesized FAM-labeled aptamer LWB-1 at various concentrations were prepared using 200 μL of binding buffer, denatured at 95°C for 5 min, and annealed on ice for 10 min. The cells were then co-incubated with 300,000 CNTFRα-293T cells at 4°C for 1 h. The cells were washed 2-3 times with washing buffer (DPBS buffer containing 5 mM MgCl2 and 4.5 mg / mL glucose), and then resuspended in 300 μL of washing buffer. Fluorescence was detected by flow cytometry, with an initial randomized DNA library of the same concentration gradient serving as a control. The fluorescence curves of different LWB-1 binding to CNTFRα-293T cells were plotted using Grahpad Prism 8 software. The results are shown below. Figure 4 As shown in the figure, the horizontal axis represents the concentration of nucleic acid aptamers, and the vertical axis represents the average fluorescence intensity of cells.

[0044] according to Figure 4It can be seen that the dissociation constant of nucleic acid aptamer LWB-1 for CNTFRα-293T is 195.7±51nM, indicating that nucleic acid aptamer LWB-1 has a high affinity for CNTFRα-293T.

[0045] Example 4: Functions and effects of nucleic acid aptamer LWB-1

[0046] Mice were anesthetized using an isoflurane inhalation anesthesia system (Harvard Apparatus) (1.5% isoflurane mixed with 95% O2 / 5% CO2), and the anesthesia status was confirmed by the loss of toe reflexes. The experimental eyes were treated sequentially: after air anesthesia, mydriasis was first treated with compound tropicamide ophthalmic preparation (0.5% tropicamide), followed by 3-5 minutes of surface anesthesia with promecaine hydrochloride eye drops, disinfection, and finally, mydriasis and corneal moisture were maintained with atropine ophthalmic gel (1%) to fully expose the visual field of the left eye. The optic nerve was then grasped 2 mm posterior to the eyeball with reverse forceps for 10 seconds. The right eye was left uninjured as a control. Immediately after injury, 2 μL of fluid was injected into the vitreous humor of the left eye, divided into three groups: PBS (blank control group), LWB-1 (4.8 μg) (low-dose group), and LWB-1 (12 μg) (high-dose group). The right eye was not injected. The procedure was repeated on the fourth day after injury, and retinal sampling was performed on the seventh day after injury.

[0047] The specific method is as follows: After eyeball fixation, the fixed sample was rinsed three times with phosphate-buffered saline (PBS, pH 7.4) and placed on a stereomicroscopic manipulation platform. A 30G needle was used to puncture the corneal stroma to release aqueous humor and lower intraocular pressure to below 5 mmHg. A 360° circumferential incision was made 1.5 mm posterior to the limbus using microscissors to remove the cornea-iris-lens complex. A blunt microdissector was used to gently separate the retinal neuroepithelial layer from the choroid, forming a tetralobed retina.

[0048] Retinal permeability and blocking: retinal samples were transferred to 24-well cell culture plates (Costar, 3524), and 1 mL of permeability / blocking mixture (PBS containing 0.5% Triton X-100 and 10% donkey serum) was added. The plates were then placed on a horizontal shaker (50 rpm) at room temperature for 7 h.

[0049] Add primary antibody: Remove blocking solution, add 500 μL of rabbit anti-RBPMS polyclonal antibody (Abcam, ab194213) working solution (1:300 diluted in blocking solution), and incubate at 4°C with a horizontal shaker (30 rpm) for 24 h.

[0050] Secondary antibody addition: After washing three times with PBS (5 min each time), Alexa Fluor 488 (1:500) was added and incubated in the dark for 12 h. To enhance signal specificity, the routine nuclear staining step was omitted. After final washing with PBS buffer (3 times, 5 min each time), the retina was transferred to a positively charged slide (Thermo, J1800AMNZ) using a fine brush (00 size). The orientation of the ganglion cell layer was adjusted under a stereomicroscope, and after slight drying, anti-fluorescence quenching mounting medium was added for mounting and observation. The observation and statistical results of retinal ganglion cells (RGCs) in the retinas of mice in different treatment groups are as follows: Figure 5 As shown in the figure, Figure A represents the observation results of retinal ganglion cells (RGCs) in the retinas of mice in different treatment groups, and Figure B represents the number of retinal ganglion cell (RGC) specific markers RBPMS in the retinas of mice in different treatment groups. The horizontal axis represents different treatment groups, and the vertical axis represents the number of retinal ganglion cell (RGC) specific markers RBPMS in the retinas (cells / mm²). 2 ).

[0051] according to Figure 5 The results showed that the number of retinal rhabdomyocardial cells (RGCs) in the blank control group was significantly reduced, while the low-dose and high-dose LWB-1 groups significantly protected the survival of RGCs. However, the efficacy of LWB-1 did not show a significant dose-dependent effect at either dosage. This indicates that LWB-1 has a good in vivo protective effect against traumatic optic nerve injury without dose dependence.

[0052] As can be seen from the above embodiments, the present invention provides a nucleic acid aptamer LWB-1 targeting the CNTFRα protein and its application. The present invention utilizes cell-SELEX screening technology to screen and obtain the nucleic acid aptamer LWB-1 that specifically recognizes the CNTFRα protein. This nucleic acid aptamer can be screened at 25°C with 1.0 mM Na... + 0.5mM Mg 2+ The stem-loop structure under the specified conditions was analyzed, and flow cytometry revealed that it possesses high binding affinity and specificity, specifically recognizing CNTFRα-293T cells but not 293T cells. The selected nucleic acid aptamer can be further truncated and optimized to reduce molecular weight, save synthesis costs, and improve affinity. This nucleic acid aptamer is also easily modified, non-cytotoxic, exhibits strong binding specificity, is non-immunogenic, and highly stable. It can serve as a molecular probe for the specific recognition of CNTFRα protein, showing significant potential in the diagnosis and targeted therapy of CNTFRα protein-related diseases.

[0053] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid aptamer LWB-1 targeting the CNTFRα protein, characterized in that, The core nucleotide sequence of the nucleic acid aptamer LWB-1 is shown in SEQ ID No.

1.

2. The nucleic acid aptamer LWB-1 according to claim 1, characterized in that, The nucleic acid aptamer LWB-1 was stored at 23-27°C in 0.5-1.5 mM Na... + 0.1~10mM Mg 2+ It exhibits a unique stem-ring structure under certain conditions.

3. The nucleic acid aptamer LWB-1 according to claim 1, characterized in that, The CNTFRα protein is a human-derived CNTFRα protein.

4. The nucleic acid aptamer LWB-1 according to claim 1, characterized in that, The nucleic acid aptamer LWB-1 can be modified by radiolabeling, therapeutic drug conjugation, fluorescent labeling or biotin labeling at both ends or one end.

5. The use of the nucleic acid aptamer LWB-1 according to any one of claims 1 to 4 in any of the following aspects: (1) Application in the preparation of CNTFRα protein detection reagent; (2) Application in the preparation of CNTFRα targeting carrier reagents; (3) Application in studying CNTFRα expression levels; (4) Application in the preparation of reagents for detecting in vivo CNTFRα protein; (5) Use in the preparation of a medicament for treating diseases, said diseases including optic nerve injury, retinitis pigmentosa, macular degeneration, glaucoma, amyotrophic lateral sclerosis, retinal light damage model, Parkinson's disease, obesity and type 2 diabetes model, cerebral ischemia, epilepsy and experimental autoimmune encephalomyelitis.

Images