Camellia sinensis gene CsHMT1 and application thereof in selenium-rich tea cultivation and preparation of methylseleno-cysteine

CN122235177BActive Publication Date: 2026-08-21SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610719525.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-25
Publication Date
2026-08-21
Estimated Expiration
2046-05-25

AI Technical Summary

Technical Problem

[0003]目前富硒茶的培育多依赖外源硒肥施加的方式,通过在种植过程中补充硒源,提升茶树的硒吸收量,但该方式受土壤环境、种植条件的影响较大,存在效果不稳定的缺陷,同时茶树自身将无机硒转化为甲基硒代半胱氨酸的能力有限,单纯依靠外源硒肥无法实现茶树有机硒含量的稳定提升,过量施加硒肥还易引发土壤硒污染等环境问题

Benefits of technology

[0017] This invention clarifies the biological function of the CsHMT1 gene in tea trees and verifies that overexpression of this gene can significantly increase the content of methylselenocysteine ​​in tea trees. It provides a clear gene resource for the molecular breeding of selenium-enriched tea, can get rid of dependence on exogenous selenium fertilizer, solves the problem of unstable effects of traditional cultivation methods, and realizes the targeted improvement of the selenium enrichment capacity of tea trees.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122235177B_ABST
    Figure CN122235177B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant molecular genetic engineering, and discloses a tea tree CsHMT1 gene and application of the tea tree CsHMT1 gene in selenium-rich tea cultivation and methylseleno-cysteine preparation. The nucleotide sequence of the gene, the amino acid sequence of homomethylseleno-cysteine methyltransferase coded by the gene, and a specific primer pair for amplifying the gene are disclosed. The application also provides corresponding application schemes. The tea tree with high methylseleno-cysteine content can be cultivated by overexpressing the gene, and methylseleno-cysteine can be synthesized in vitro by using the enzyme as a catalyst. Overexpression of the gene can significantly increase the content of the target product in the tea tree, and the enzyme can efficiently complete in vitro catalysis, thereby providing gene resources and technical support for related industries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetic engineering technology, and relates to a tea tree CsHMT1 gene and its application in the cultivation of selenium-enriched tea and the preparation of methylselenocysteine. Background Technology

[0002] Selenium is an essential trace element for the human body, participating in many physiological metabolic processes. Organic selenium is a form of selenium with a higher absorption and utilization rate by the human body. Among them, methylselenocysteine, as a core organic selenium form, is safer than inorganic selenium and also possesses physiological activities such as antioxidation and immune regulation, making it highly valuable in the fields of food and health products. Tea trees are important economic crops, possessing the ability to absorb inorganic selenium from the environment and convert it into organic selenium. Therefore, selenium-enriched tea has become an important category of selenium-enriched products, and the development of related industries has received widespread attention.

[0003] Currently, the cultivation of selenium-enriched tea largely relies on the application of exogenous selenium fertilizers. This involves supplementing the selenium source during cultivation to increase the selenium absorption of tea trees. However, this method is greatly affected by soil environment and planting conditions, resulting in unstable effects. Furthermore, tea trees have a limited ability to convert inorganic selenium into methylselenocysteine, meaning that relying solely on exogenous selenium fertilizers cannot achieve a stable increase in the organic selenium content of tea trees. Excessive application of selenium fertilizers can also easily lead to environmental problems such as soil selenium pollution. Molecular targeted breeding is an effective way to improve crop traits, but in current technology, the key functional genes regulating the methylselenocysteine ​​synthesis pathway in tea trees have long lacked clear functional verification. The breeding process lacks effective molecular targets, making it impossible to achieve targeted improvement of the selenium-enriching capacity of tea trees. This has become a significant bottleneck restricting the upgrading of the selenium-enriched tea industry.

[0004] Meanwhile, existing methods for preparing methylselenocysteine ​​are mostly based on chemical synthesis. This method has harsh reaction conditions, high production costs, and is prone to generating byproducts, resulting in low product purity and insufficient safety, failing to meet the application needs of the food and health product industries. Biosynthesis, with its advantages of low cost and high safety, has become a potential development direction for methylselenocysteine ​​preparation. However, current technologies lack specific enzymes that can efficiently catalyze the synthesis of methylselenocysteine, and there are no mature biosynthetic technical solutions. The lack of related supporting tools also hinders the practical application of this technology. While some studies have mentioned that the homocysteine ​​methyltransferase family may be involved in methylation metabolism, the specific biological function of the CsHMT1 gene derived from tea, especially its regulatory role in the synthesis and accumulation of methylselenocysteine, has not been clearly verified, and no related application schemes have been disclosed, failing to address the aforementioned deficiencies in existing technologies. Summary of the Invention

[0005] The technical problem this invention aims to solve is that, in existing technologies, tea plants have a limited ability to convert inorganic selenium into organic selenium, the content of the core organic selenium form methylselenocysteine ​​is low, and the key functional genes regulating this synthesis process in tea plants have long lacked clear functional verification. This results in a lack of effective targets for the molecular cultivation of selenium-enriched tea, and traditional cultivation methods relying on exogenous selenium fertilizers suffer from unstable effects. Furthermore, existing methods for preparing methylselenocysteine ​​mostly employ chemical synthesis, which suffers from high costs and insufficient safety, lacks efficient biosynthetic pathways, and is deficient in supporting tools, hindering the practical application of related technologies.

[0006] The present invention aims to address the above-mentioned deficiencies by providing CsHMT1-related genes and proteins from tea plants, as well as their application in the cultivation of selenium-enriched tea and the preparation of methylselenocysteine, so as to effectively increase the methylselenocysteine ​​content of tea plants and provide an efficient biological preparation scheme for methylselenocysteine.

[0007] In a first aspect, the present invention provides a polynucleotide, wherein the polynucleotide is the CsHMT1 gene of tea plant, and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention provides a protein encoded by the aforementioned polynucleotide, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] Thirdly, the present invention provides a primer pair for amplifying the above-mentioned polynucleotides, wherein the upstream primer nucleotide sequence is shown in SEQ ID NO.3 and the downstream primer nucleotide sequence is shown in SEQ ID NO.4.

[0010] Based on this, the present invention also provides the application of the CsHMT1 gene in the cultivation of selenium-enriched tea, and the application of the protein in the preparation of methylselenocysteine.

[0011] Furthermore, for the cultivation of selenium-enriched tea, the polynucleotide is linked to an expression vector to construct a recombinant expression vector, and the recombinant expression vector is introduced into tea trees to overexpress the polynucleotide in the tea trees, thereby increasing the content of methylselenocysteine ​​in the tea trees.

[0012] Preferably, in the application of selenium-enriched tea cultivation, the expression vector is pCAMBIA2300, and the recombinant expression vector is introduced into the tea plant via Agrobacterium-mediated transformation.

[0013] Preferably, in the application of selenium-enriched tea cultivation, the Agrobacterium is strain GV3101.

[0014] Furthermore, for the preparation of methylselenocysteine, S-adenosylmethionine is used as the methyl donor, selenocysteine ​​as the methyl acceptor, and the protein is used as the catalytic enzyme to carry out an enzymatic reaction to synthesize methylselenocysteine; the reaction system of the enzymatic reaction also includes: 40-60mM sodium citrate, 8-12mM magnesium acetate and 3-7mM dithiothreitol.

[0015] Preferably, in the application of methylselenocysteine ​​preparation, the protein is prepared by the following method: the above-mentioned polynucleotide is ligated into a prokaryotic expression vector that has been double-digested with BamH I and Hind III to construct a recombinant prokaryotic expression vector; the recombinant prokaryotic expression vector is introduced into *E. coli* for induced expression; the induced bacterial cells are ultrasonically disrupted, and the supernatant is collected by centrifugation and purified to obtain the protein. This protein is selenocysteine ​​methyltransferase CsHMT1, encoded by the polynucleotide described in this invention, with the amino acid sequence shown in SEQ ID NO.2, and acts as a catalytic enzyme in the enzymatic reaction for the preparation of methylselenocysteine.

[0016] Compared with the prior art, the present invention has significant beneficial effects:

[0017] This invention clarifies the biological function of the CsHMT1 gene in tea trees and verifies that overexpression of this gene can significantly increase the content of methylselenocysteine ​​in tea trees. It provides a clear gene resource for the molecular breeding of selenium-enriched tea, can get rid of dependence on exogenous selenium fertilizer, solves the problem of unstable effects of traditional cultivation methods, and realizes the targeted improvement of the selenium enrichment capacity of tea trees.

[0018] The CsHMT1 enzyme provided by this invention can efficiently catalyze the in vitro synthesis of methylselenocysteine. Compared with chemical synthesis methods, this biosynthetic route has lower cost, higher product specificity, and higher safety, and can meet the preparation requirements of related products.

[0019] Furthermore, the specific primers, recombinant vectors, engineered strains, and other tools provided by this invention can ensure the high efficiency of gene cloning, expression, and transformation. The entire technical solution is highly feasible and can provide reliable technical support for the selenium-rich tea industry and related industries such as methylselenocysteine. Attached Figure Description

[0020] Figure 1 The image shows the 1% agarose gel electrophoresis detection of the CsHMT1 gene band, where M is the DNA Marker.

[0021] Figure 2The image shows the purified CsHMT1 protein detected by SDS-PAGE electrophoresis. In the image, M is the protein marker, U is the total bacterial protein before induction, I is the total bacterial protein after induction, S is the supernatant after cell lysis, P is the precipitate after cell lysis, W is the washing eluent for affinity chromatography, and E1-E3 are the elution fractions for affinity chromatography. The labeled bands represent the purified CsHMT1 target protein.

[0022] Figure 3 The image shows the LC-MS spectra of the in vitro enzymatic activity of CsHMT1 protein. The horizontal axis represents retention time, and the vertical axis represents ionic intensity. The red curve represents the reaction group with CsHMT1 protein added, and the black curve represents the blank control group without CsHMT1 protein added. The characteristic peak in the red curve is the product peak of methylselenocysteine ​​generated by the enzymatic reaction.

[0023] Figure 4 The graph shows the CsHMT1 gene expression levels in tea plants overexpressing CsHMT1 and the control group. The horizontal axis represents the sample grouping, with EV representing the control group transfected with the empty vector and OE-CsHMT1 representing the experimental group overexpressing CsHMT1. The vertical axis represents the relative expression level of the CsHMT1 gene. This indicates that the difference between the two groups is extremely significant, p<0.01.

[0024] Figure 5 The graph shows the results of detecting methylselenocysteine ​​content in tea plants overexpressing CsHMT1 and the control group. The horizontal axis represents the sample grouping, and the vertical axis represents the methylselenocysteine ​​content. Detailed Implementation

[0025] The present invention will now be described in conjunction with embodiments, providing a clear and complete description of the technical solutions in these embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0026] Example 1: Cloning of the CsHMT1 gene.

[0027] This embodiment describes the cloning of the CsHMT1 gene from tea plants. The specific steps are as follows: Fresh leaves from healthy one-year-old tea trees were harvested and rapidly frozen in liquid nitrogen. The leaves were then ground into a fine powder under liquid nitrogen conditions. Using a plant RNA extraction kit, total RNA was extracted from the powdered leaves according to the kit's instructions. The concentration and integrity of the total RNA were measured using a Nanodrop 2000 UV-Vis spectrophotometer to ensure that the RNA was undegraded and of sufficient purity for subsequent experiments.

[0028] Using the extracted total RNA as a template, the first strand of cDNA was synthesized using a reverse transcription kit according to the kit's instructions. The resulting cDNA product was stored at -20°C for later use.

[0029] Based on the predicted CsHMT1 gene sequence, specific amplification primer pairs were designed, with the nucleotide sequence of the upstream primer shown in SEQ ID NO.3 and the nucleotide sequence of the downstream primer shown in SEQ ID NO.4. SEQ ID NO.3: CCGTCGAAGCTAATGACTGATTTCATC; SEQ ID NO. 4: AGTTCTAGGACTGACTTTGTGACAGAG.

[0030] Using the synthesized cDNA as a template, 2× ApexHF PCR amplification was performed using FS PCR Master Mix enzyme. The PCR reaction mixture consisted of 25 μL enzyme, 1 μL upstream primer, 1 μL downstream primer, 200 ng template, and double-distilled water to a final volume of 50 μL. The reaction program was as follows: pre-denaturation at 94℃ for 30 s, followed by 35 cycles: denaturation at 98℃ for 10 s, annealing at 55℃ for 5 s, extension at 72℃ for 10 s, and a final extension at 72℃ for 5 min.

[0031] After the amplification reaction was completed, the PCR products were detected by 1% agarose gel electrophoresis to verify the position of the amplified bands. The results are as follows: Figure 1 As shown, the electrophoresis results revealed a target gene band of the expected size at the 1005 bp position, indicating successful amplification of the CsHMT1 gene fragment. The target band was then purified using a gel extraction kit to obtain the purified PCR product.

[0032] The recovered PCR product was ligated into the cloning vector pCE2-TA-Blunt-Zero. The ligation system consisted of 1 μL of 5×TA / Blunt-Zero Cloning Mix and 4 μL of PCR product. The ligation conditions were 25℃ for 10 min.

[0033] After ligation, the ligation product (i.e., pCE2-TA-Blunt-Zero-CsHMT1 recombinant plasmid) was transformed into E. coli DH5α competent cells by heat shock. The ligation system was 50 μL competent cells plus 5 μL ligation product. The transformation conditions were: ice bath for 30 min, followed by heat shock at 42℃ for 45 s, ice bath for 2 min, and finally LB liquid medium was added and the cells were recovered at 37℃ for 60 min.

[0034] After resuscitation, the bacterial culture was centrifuged at 5000 rpm for 2 min and most of the supernatant was discarded. The remaining bacterial culture was aspirated, mixed, and spread onto LB solid medium containing 50 mg / L kanamycin sulfate. The culture was incubated upside down at 37°C for 12-14 h. Single colonies were picked for bacterial PCR verification. The positive bacterial cultures that were verified were sent to a sequencing company (Yangling Aoke Company) for sequencing. The sequencing results showed that the nucleotide sequence of the CsHMT1 gene is shown in SEQ ID NO.1.

[0035] Existing research has mentioned that this family of genes may be involved in the methylation metabolism process, but its specific function in the synthesis of methylselenocysteine ​​has not been clarified. The gene cloned in this embodiment can be used to prepare the CsHMT1 recombinant protein through prokaryotic expression. This protein can act as a catalytic enzyme to participate in the synthesis of methylselenocysteine, providing a basis for the in vivo and in vitro application of this gene.

[0036] Example 2: Prokaryotic expression and protein purification of CsHMT1.

[0037] This embodiment describes the preparation of catalytically active recombinant CsHMT1 protein. The specific steps are as follows: 1. Construction of recombinant prokaryotic expression vectors Using the pCE2-TA-Blunt-Zero-CsHMT1 recombinant plasmid, which was correctly sequenced and verified in Example 1, as a template, PCR amplification was performed using the designed specific primers. The upstream primer nucleotide sequence is shown in SEQ ID NO.5, and the downstream primer nucleotide sequence is shown in SEQ ID NO.6. SEQ ID NO.5:cagcaaatgggtcgcGGATCCATGACTGATTTCATCGGCCAG; SEQ ID NO. 6: gagtgcggccgcaagcttgAACTCCAGAGTGGTAACAGAAGA.

[0038] The PCR reaction system is: 25 μL 2× ApexHFFS PCR Master Mix enzyme, 1 μL upstream primer, 1 μL downstream primer, 200 ng template, and double-distilled water to make up to 50 μL. The reaction program was as follows: 94℃ pre-denaturation for 30 s, followed by 35 cycles: 98℃ denaturation for 10 s, 55℃ annealing for 5 s, 72℃ extension for 10 s, and finally 72℃ final extension for 5 min.

[0039] After amplification, the PCR product was recovered, and the prokaryotic expression vector pET28a was subjected to double digestion with BamH I and Hind III. The digestion system was: 1 μL BamH I restriction endonuclease, 1 μL Hind III restriction endonuclease, 2 μL 10×QuickCut Green Buffer, and double-distilled water was added to a final volume of 20 μL. The digestion conditions were 37℃ for 0.5 h.

[0040] After enzyme digestion, the vector fragment was recovered, and the recovered PCR product was ligated with the digested vector fragment. The ligation system was: 4 μL 2.5×OK Clon Master Mix, 4 μL linearized pET28a vector, and 2 μL PCR product. The ligation conditions were 50℃ for 10 min.

[0041] After ligation, the ligation product was heat-shocked and transformed into Escherichia coli DH5α competent cells. After heat shock, the cells were plated on LB solid medium containing 50 mg / L kanamycin sulfate and incubated upside down at 37°C for 12-14 h. Single clones were picked for bacterial PCR and sequencing verification. After verification, the plasmid was extracted to obtain the recombinant pET28a-CsHMT1 prokaryotic expression vector.

[0042] 2. Induced expression of recombinant proteins The constructed pET28a-CsHMT1 recombinant vector was chemically transformed into Escherichia coli Rosetta(DE3) pLysS competent cells. The cells were plated on LB solid medium containing kanamycin sulfate and chloramphenicol and incubated upside down at 37°C for 10-12 hours. Single colonies were picked and subjected to bacterial PCR verification. Positive bacterial cultures that were verified were selected and 500 μL of LB liquid medium containing the same antibiotic were added. The cultures were incubated overnight at 37°C and 200 rpm. Then, 500 μL of 50% sterile glycerol was added, and the cultures were stored at -80°C for later use.

[0043] Select verified positive single clones and inoculate them into 3 mL of LB liquid medium containing the same antibiotic. Incubate at 37°C and 200-220 rpm for 10-12 h using a shaker. Then, inoculate the bacterial culture at a ratio of 1:100 into 50 mL of LB liquid medium containing the same antibiotic for expansion culture. Incubate at 37°C and 200-220 rpm until the OD of the bacterial culture reaches the target value. 600 It reaches 0.4~0.6.

[0044] Take 1 mL of bacterial culture as a sample before induction. Add IPTG, the inducer, to the remaining culture medium to a final concentration of 0.4 mM. Then, induce the culture at 16℃ and 110 rpm for 20 h. After induction, take 1 mL of bacterial culture as a sample after induction. Centrifuge the remaining bacterial culture at 4℃ and 6000 rpm for 10 min, collect the bacterial cells, discard the supernatant, add 20-25 mL of PBS buffer to the bacterial cell pellet to resuspend the bacterial cells, centrifuge again at 4℃ and 6000 rpm for 10 min, discard the supernatant, and add 10-15 mL of PBS buffer to the bacterial cell pellet to resuspend the bacterial cells.

[0045] 3. Protein purification and detection The resuspended bacterial cells were ultrasonically disrupted. The ultrasonic disruption parameters were: power 30W, working for 2 seconds and resting for 5 seconds, disruption time 10 minutes. After disruption, the cells were centrifuged at 4℃ and 5000rpm for 15 minutes, and the supernatant was collected, which was the crude enzyme solution containing recombinant CsHMT1 protein.

[0046] Take 1 mL of 50% BeyoGold TM His-tag Purification Resin: Centrifuge at 1000g for 15 seconds at 4℃ and discard the stock solution. Then add 0.5mL of non-denaturing lysis buffer and mix well. Repeat 2-3 times to equilibrate the gel. Add the collected crude enzyme solution to the equilibrated gel and incubate slowly on a side-shaking incubator at 4℃ for 60min. After incubation, transfer the mixture to a pre-cooled affinity chromatography empty column tube. Allow the liquid to flow out naturally and collect the flow-through. Then wash the column 5 times with non-denaturing wash buffer, adding 1mL of wash buffer each time, and collect the wash effluent. Finally, elute the target protein 6 times with non-denaturing elution buffer, adding 500μL of elution buffer each time, and collect the elution fraction.

[0047] The collected components were analyzed by SDS-PAGE electrophoresis, and the results are as follows: Figure 2 As shown in the figure, M is the protein marker, U is the total bacterial protein before induction, I is the total bacterial protein after induction, S is the supernatant after bacterial cell lysis, P is the precipitate after bacterial cell lysis, W is the washing eluent for affinity chromatography, and E1-E3 are the elution fractions for affinity chromatography. The labeled bands represent the purified CsHMT1 target protein, with a molecular weight of approximately 36.32 kDa. Electrophoresis results showed that the target protein with high purity was obtained from the elution fractions, indicating successful expression and purification of the CsHMT1 recombinant protein. This protein is a selenocysteine ​​methyltransferase, and its amino acid sequence is shown in SEQ ID NO.2, which can be used for subsequent in vitro experiments.

[0048] Example 3: In vitro enzyme activity detection of CsHMT1 protein and in vitro synthesis of methylselenocysteine ​​(MeSeCys).

[0049] This embodiment describes the in vitro catalytic activity of the CsHMT1 protein to achieve the in vitro biosynthesis of methylselenocysteine. The specific operation steps are as follows: 1. Construction of the enzyme-catalyzed reaction system The CsHMT1 recombinant protein purified in Example 2 was used to construct an in vitro enzymatic reaction system with a total volume of 100 μL. The components of the system are shown in Table 1. A blank control group was also set up. In the reaction system of the blank control group, the CsHMT1 recombinant protein was treated with boiling water for 15 min to inactivate the protein. An equal amount of inactivated CsHMT1 recombinant protein was used to replace the CsHMT1 recombinant protein. The remaining components were completely consistent with those of the experimental group.

[0050] Table 1: Enzyme-catalyzed reaction system

[0051] 2. Reaction and Product Detection After mixing the reaction systems of each group separately, they were placed in a constant temperature incubator at 25℃ and incubated in the dark for 30 min. After the reaction was completed, an equal volume of 20% trichloroacetic acid was added to terminate the reaction and precipitate the protein. The reaction product was centrifuged at 12000 rpm for 15 min at 4℃, and 200 μL of the supernatant was collected for analysis using liquid chromatography-mass spectrometry (LC-MS). The chromatographic conditions were: Shimadzu Intertsil OSD-3 C18 column (150 mm × 3.0 mm, 3.5 µm), flow rate 0.4 mL / min. -1The column oven was set at 25°C. Mobile phase A consisted of 0.1% formic acid in water; mobile phase B consisted of acetonitrile. Mass spectrometry conditions were as follows: electrospray ionization (ESI) was used in positive ion mode with an ionization voltage of 5.5 kV; the ion source was a TurboIonSpray probe with a heater gas temperature of 600°C, spray gas (GS1) and auxiliary heating gas (GS2) set to 60 psi, and curtain gas set to 35 psi. Under these conditions, the analyte was electrospray ionized to form charged ions, which were then detected by the mass spectrometry system. Mass spectrometry acquisition employed multiple reaction monitoring (MRM) scanning mode. Ions with a mass-to-charge ratio of 184 were used as precursor ions, which, after collision-induced dissociation, produced product ions with mass-to-charge ratios of 167, 95, and 128, thus forming MRM ion pairs: 184→167, 184→95, and 184→128, respectively. Ion pairs with a mass-to-charge ratio of 184→167 were used for quantitative analysis, while ion pairs with mass-to-charge ratios of 184→95 and 184→128 were used for qualitative confirmation. The residence time for each ion pair was set to 120 ms, and the declustering voltage was 30 V. The collision energies for the corresponding mass-to-charge ratio ion pairs of 184→167, 184→95, and 184→128 were 10.02 V, 31.02 V, and 11.76 V, respectively.

[0052] Test results as follows Figure 3 As shown in the figure, the horizontal axis represents retention time, and the vertical axis represents ionic intensity. The red curve represents the experimental group with CsHMT1 protein, and the black curve represents the blank control group with inactivated CsHMT1 protein. The results show that the red curve in the experimental group exhibits a clear characteristic peak of methylselenocysteine ​​at a retention time of 2.8 min, while this characteristic peak was not detected in the black curve of the blank control group. This indicates that CsHMT1 protein can efficiently catalyze the methyltransfer reaction between selenocysteine ​​and S-adenosylmethionine, specifically synthesizing methylselenocysteine. This verifies the in vitro catalytic activity of the protein and proves that this enzyme can be used for the in vitro biosynthesis of methylselenocysteine. Compared with traditional chemical synthesis methods, this biosynthetic pathway has milder reaction conditions, higher product specificity, and greater safety.

[0053] Example 4: Overexpression and functional verification of CsHMT1 gene in tea plants.

[0054] This embodiment verifies the function of CsHMT1 gene transiently overexpression in tea plants in regulating the accumulation of methylselenocysteine. The specific operation steps are as follows: 1. Construction of recombinant plant expression vectors and Agrobacterium-mediated transformation Using the pCE2-TA-Blunt-Zero-CsHMT1 plasmid constructed in Example 1 as a template, the complete open reading frame of the CsHMT1 gene was amplified using specific primers. The upstream primer nucleotide sequence is shown in SEQ ID NO.7, and the downstream primer nucleotide sequence is shown in SEQ ID NO.8. SEQ ID NO.7: atttggagaggacagGGTACCATGACTGATTTCATCGGCCA; SEQ ID NO. 8: tcctcctcctctagaGGATCCGAACTCCAGAGTGGTAACAG.

[0055] After PCR amplification, the PCR product was recovered, and the plant expression vector pCAMBIA2300 was subjected to double digestion with Kpn I and BamH I. The digestion system was: 1 μL Kpn I enzyme, 1 μL BamH I enzyme, 2 μL 10×QuickCut Green Buffer, and double-distilled water was added to bring the volume to 20 μL. The digestion conditions were 37℃ for 0.5 h. After digestion, the vector fragment was recovered.

[0056] The recovered PCR product was ligated with the enzyme-digested vector fragment. The ligation system consisted of 4 μL 2.5× OK ClonMaster Mix, 4 μL linearized pCAMBIA2300 vector, and 2 μL PCR product. The ligation conditions were 50℃ for 10 min, yielding the recombinant vector pCAMBIA2300-CsHMT1. An empty pCAMBIA2300 vector was used as a control for subsequent experiments.

[0057] Take 1 μg of recombinant plasmid and pCAMBIA2300 empty vector plasmid respectively, add them to 50 μL of GV3101 Agrobacterium competent cells, slowly aspirate and mix well, and perform transformation treatments in sequence: stand on ice for 5 min, freeze in liquid nitrogen for 5 min, heat shock in a water bath at 37℃ for 5 min, and incubate on ice for 5 min. After treatment, add LB liquid medium and culture in a shaker at 28℃ for 2 h.

[0058] After cultivation, the bacterial culture was spread on LB solid medium containing 50 mg / L kanamycin + 20 mg / L rifampin and incubated at 28°C for 48-72 h. Single clones were picked for colony PCR verification. Positive Agrobacterium strains with correct bands were screened and stored at -80°C after adding 50% sterile glycerol.

[0059] 2. Preparation of Agrobacterium infection solution Take 20 μL of the preserved Agrobacterium positive culture and inoculate it into 3 mL of liquid LB medium containing kanamycin and rifampin. Incubate overnight at 28°C in a shaker. The next day, inoculate the culture into fresh LB liquid medium at a ratio of 1:100 for expansion culture. Incubate at 28°C and 200-220 rpm until the bacterial growth rate reaches OD. 600 It reaches 0.8~1.2.

[0060] After culturing, centrifuge at 6000 rpm for 10 min to collect the bacterial cells, discard the supernatant, resuspend the bacterial cells in infection resuspension, and adjust the OD of the bacterial culture. 600 The concentration was increased to 0.8 to obtain the Agrobacterium infection solution; the specific composition of the infection resuspension is shown in Table 2.

[0061] Table 2: Infection Resuspension

[0062] 3. Instantaneous transformation treatment of tea trees One-year-old tea seedlings with good growth and uniform growth were selected as experimental materials. A 1mL syringe with the needle removed was used to draw up the infection solution and inject it into the back of the tea leaves to ensure that the infection solution fully soaked the leaf tissue.

[0063] After injection, the tea seedlings were treated with sodium selenite. The specific treatment parameters were as follows: the tea seedlings were sprayed with 10 μM sodium selenite, and then the tea seedlings were placed in a culture room at 25℃ with a light / dark cycle of 16h / 8h for 3 days. The GFP fluorescence of the leaves was then observed using a phase contrast microscope. The successfully transformed leaves with fluorescence were taken, flash-frozen in liquid nitrogen, ground, and placed in a -80℃ freezer for later use.

[0064] 4. Functional verification of transient overexpression Total RNA was extracted from the successfully transformed leaves, and the relative expression level of the CsHMT1 gene was detected using qRT-PCR. The primers used for the detection are as follows: qRT-PCR primers for the tea plant internal reference gene CsActin: upstream primer as shown in SEQ ID NO. 9, downstream primer as shown in SEQ ID NO. 10; qRT-PCR primers for the CsHMT1 gene: upstream primer as shown in SEQ ID NO. 11, downstream primer as shown in SEQ ID NO. 12. SEQ ID NO.9: GTCGTACAACCGGTATTGTGCT; SEQ ID NO.10: TGTCTCTTACAATTTCCCGCTCT; SEQ ID NO.11: CAGAAGGGCTACACTTCAGGGA; SEQ ID NO. 12: AGCTCCATAACTTCCCACAGAA.

[0065] The qRT-PCR reaction system was: 25 μL 2×SYBR. Green Pro Tag HSPremix, 0.4 μL upstream primer, 0.4 μL downstream primer, 100 ng template, and enzyme-free water to make up to 20 μL. The reaction program was: 95 °C pre-denaturation for 30 s, followed by 40 cycles: 95 °C denaturation for 5 s, 60 °C annealing and extension for 30 s.

[0066] Test results as follows Figure 4 As shown in the figure, the horizontal axis represents the sample groups, with EV being the control group transfected with the empty vector and OE-CsHMT1 being the experimental group overexpressing the CsHMT1 gene. The vertical axis represents the relative expression level of the CsHMT1 gene. The result indicates that the difference between the two groups was highly significant (p < 0.01). The results show that, compared with the control group, the relative expression level of the CsHMT1 gene in the overexpression group was significantly upregulated, indicating that the CsHMT1 gene was successfully transiently overexpressed in tea leaves.

[0067] Simultaneously, methylselenocysteine ​​was extracted from the leaves of both groups, and its content was detected by LC-MS. The sample extraction method was as follows: the leaves were freeze-dried and ground, and 0.1 g of sample was weighed and mixed with 0.01 g of streptomycin E. Then, 10 mL of 20 mM pH 7.5 Tris-HCl buffer was added, and the mixture was ultrasonically extracted at 37°C for 1 h. The LC-MS detection conditions were the same as those described in Example 2.

[0068] Test results as follows Figure 5 As shown in the figure, the horizontal axis represents the sample group, with EV being the control group transfected with the empty vector and OE-CsHMT1 being the experimental group overexpressing the CsHMT1 gene. The vertical axis represents the content of methylselenocysteine. The result indicates that the difference between the two groups was extremely significant (p < 0.01). The results showed that the content of methylselenocysteine ​​was significantly higher in the experimental group overexpressing the CsHMT1 gene compared to the control group, verifying that the CsHMT1 gene can positively regulate the accumulation of methylselenocysteine ​​in tea plants. Overexpression of this gene can effectively enhance the selenium enrichment capacity of tea plants, and this gene can be used for molecular breeding and other related applications of selenium-enriched tea.

[0069] The embodiments described above are only some, not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.

Claims

1. The application of a polynucleotide in the cultivation of selenium-enriched tea, characterized in that, The polynucleotide was ligated into an expression vector to construct a recombinant expression vector, which was then introduced into tea plants to overexpress the polynucleotide, thereby increasing the content of methylselenocysteine ​​in the tea plants. The polynucleotide is derived from tea plants. CsHMT1 The gene, whose nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The expression vector is pCAMBIA2300, and the recombinant expression vector is introduced into tea plants via Agrobacterium-mediated transformation.

3. The application according to claim 2, characterized in that, The Agrobacterium is strain GV3101.

4. The application of a protein in the preparation of methylselenocysteine, characterized in that, The protein in question is the tea plant CsHMT1 protein, and its amino acid sequence is shown in SEQ ID NO.

2.

5. The application according to claim 4, characterized in that, Using S-adenosylmethionine as a methyl donor, selenocysteine ​​as a methyl acceptor, and the protein as a catalytic enzyme, an enzymatic reaction is carried out to synthesize methylselenocysteine. The reaction system for the enzymatic reaction also includes: 40-60 mM sodium citrate, 8-12 mM magnesium acetate and 3-7 mM dithiothreitol.

6. The application according to claim 5, characterized in that, The protein was prepared by the following method: a polynucleotide with a nucleotide sequence as shown in SEQ ID NO.1 was ligated into a prokaryotic expression vector that had been double-digested with BamH I and Hind III to construct a recombinant prokaryotic expression vector; the recombinant prokaryotic expression vector was introduced into Escherichia coli for induced expression; the induced bacterial cells were sonicated and the supernatant was collected by centrifugation and purified to obtain the protein.