Application of LcIRX14L in improving quality of Leymus chinensis

Abstract

This invention discloses the application of Leymus chinensis xylan glycosyltransferase LcIRX14L in improving the quality of Leymus chinensis, belonging to the field of biotechnology. By downregulating the expression and / or function of LcIRX14L in Leymus chinensis, the utilization rate of Leymus chinensis fiber can be improved without affecting its biomass, which helps to create new high-quality, high-yield and stress-resistant Leymus chinensis varieties.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of Leymus chinensis xylansin LcIRX14L in Leymus chinensis production and breeding, particularly the application of Leymus chinensis xylansin LcIRX14L in improving the quality of Leymus chinensis, and providing a method for improving the fiber utilization rate of Leymus chinensis and a method for cultivating new Leymus chinensis lines that maintain high biomass and increase their sugar release. Background Technology

[0002] According to customs statistics, my country imports a large amount of high-quality forage, such as alfalfa and oats, from countries like the United States, Spain, and Australia every year. Oats are a high-quality gramineous forage, but since 2021, affected by factors such as climate, my country's oat hay imports have been declining continuously, reaching only 72,000 tons in 2023, resulting in a shortage of gramineous forage. At the same time, oat hay prices have continued to rise. By the end of 2022, the import price of oat hay had reached US$457 per ton, a 21% increase compared to the same period last year, setting a new record. Therefore, developing and utilizing my country's superior native grass species and cultivating high-yield, high-quality, and stress-resistant gramineous forage is an important way to alleviate the shortage of high-quality gramineous forage in my country.

[0003] Leymus chinensis (Trin.) Tzvel., also known as alkali grass, is a perennial rhizomatous plant belonging to the genus Leymus in the Poaceae family. It is an important dominant species in meadow steppes and typical steppes in the eastern part of the Eurasian steppe region and is widely distributed in Heilongjiang, Jilin, Liaoning, Inner Mongolia Autonomous Region, Hebei, and Shanxi provinces in my country. However, the feed quality of Leymus chinensis still lags behind that of imported high-quality grasses, resulting in its low utilization rate in livestock production. For example, compared with oats, which are also a Poaceae forage, Leymus chinensis has a higher content of neutral detergent fiber (NDF) and a lower dry matter digestibility (Lin Miao et al. (2015). Degradation characteristics of four commonly used forages in the rumen of Hu sheep. Feed Research No. 410, 35-39). Therefore, it is necessary to reduce the NDF content of Leymus chinensis and increase its NDF digestibility to improve its quality, increase its energy supply, alleviate the shortage of high-quality Poaceae forage in my country, and thus improve animal production performance. Summary of the Invention

[0004] To address one or more problems existing in the prior art, the inventors, through extensive research, discovered that the Leymus chinensis glycosyltransferase LcIRX14L has a significant impact on the quality and yield of Leymus chinensis. Specifically, mutations in LcIRX14L in Leymus chinensis (which result in reduced or absent expression of LcIRX14L, or downregulation (including loss) of its function) can significantly increase the sugar release of Leymus chinensis without affecting its yield. Based on this, the present invention is proposed, which is mainly achieved through the following technical solutions.

[0005] The first aspect of this invention provides the use of the xylan glycosyltransferase LcIRX14L or its encoding gene LcIRX14L from Leymus chinensis as a target in one or more of the following:

[0006] 1) Improve the utilization rate of sheepgrass fiber without affecting sheepgrass yield; and

[0007] 2) Increase the sugar release of sheepgrass without affecting its yield.

[0008] In some embodiments, increasing the sugar release of Leymus chinensis includes one or more of the following:

[0009] 2-1) Increase the sugar release from sheepgrass stems;

[0010] 2-2) Increase the sugar release from Leymus chinensis leaves; and

[0011] 2-3) Increase the sugar release from the leaf sheath of Leymus chinensis;

[0012] Optionally, the sugar includes glucose, xylose, and arabinose, and mixtures thereof.

[0013] In some embodiments, the xylan glycosyltransferase LcIRX14L in *Leymus chinensis* is selected from LcIRX14L-Ns, LcIRX14L-Xm, or a combination thereof, and the encoding gene for the xylan glycosyltransferase LcIRX14L in *Leymus chinensis* is selected from LcIRX14L-Ns, LcIRX14L-Xm, or a combination thereof; wherein:

[0014] The LcIRX14L-Ns contains or is composed of the amino acid sequence shown in SEQ ID NO:1, and the LcIRX14L-Xm contains or is composed of the amino acid sequence shown in SEQ ID NO:3;

[0015] The LcIRX14L-Ns contains or is composed of the nucleotide sequence shown in SEQ ID NO:2, and the LcIRX14L-Xm contains or is composed of the nucleotide sequence shown in SEQ ID NO:4.

[0016] In some embodiments, the action is achieved by downregulating the expression and / or function of the xylan glycosyltransferase IRX14L in Leymus chinensis; alternatively, by introducing base substitutions, insertions, or deletions into the encoding gene LcIRX14L of the xylan glycosyltransferase LcIRX14L in Leymus chinensis to alter its sequence from the original sequence, or by knocking out the encoding gene LcIRX14L of the xylan glycosyltransferase LcIRX14L in Leymus chinensis; further alternatively, by gene editing of the encoding gene LcIRX14L of the xylan glycosyltransferase LcIRX14L in Leymus chinensis to alter its sequence from the original sequence, wherein the gene editing is performed using a CRISPR / Cas9 gene editing system; even further alternatively, the sgRNA used in the CRISPR / Cas9 gene editing system comprises or is composed of the nucleotide sequence shown in SEQ ID NO:5.

[0017] A second aspect of the present invention provides a method for improving the utilization rate of Leymus chinensis fiber, comprising downregulating the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis.

[0018] A third aspect of the present invention provides a method for increasing the sugar release of Leymus chinensis, comprising downregulating the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis.

[0019] The fourth aspect of the present invention provides a method for cultivating a Leymus chinensis strain with improved fiber utilization, comprising using transgenic, hybridization and / or gene editing technologies to downregulate the expression and / or function of xylan glycosyltransferase LcIRX14L in Leymus chinensis, thereby obtaining the Leymus chinensis strain with improved fiber utilization.

[0020] The fifth aspect of the present invention provides a method for cultivating a Leymus chinensis strain with increased sugar release, comprising using transgenic, hybridization and / or gene editing technologies to downregulate the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis, thereby obtaining the Leymus chinensis strain with increased sugar release.

[0021] In some embodiments, the gene editing technology involves introducing a vector that substitutes, inserts, or deletes bases into the gene encoding the xylan glycosyltransferase LcIRX14L in Leymus chinensis, or transforming a vector that targets and knocks out the gene encoding the xylan glycosyltransferase LcIRX14L in Leymus chinensis into the recipient Leymus chinensis, so as to downregulate the expression and / or function of the xylan glycosyltransferase IRX14L in Leymus chinensis.

[0022] The sixth aspect of the present invention provides a CRISPR / Cas9 gene editing system comprising an sgRNA expression element, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO:5. Attached Figure Description

[0023] Figure 1 This is a phylogenetic tree of IRX homologous genes of Leymus chinensis glycan, which also shows the expression levels of each IRX homologous gene in different tissues.

[0024] Figure 2 The image shows the LcIRX14L gene editing vector of Leymus chinensis constructed in Example 2.

[0025] Figure 3 The mutations of Lc2Ns001383 and Lc2Xm054717 in the *Leymus chinensis* irx14L mutant are shown.

[0026] Figure 4 The results of phenotypic observation (plant height and number of tillers) of the Leymus irx14L mutant are presented in (A) and (B).

[0027] Figure 5 The results show the sugar release from various tissues (stem, leaf, and leaf sheath) in the Leymus chinensis irx14L mutant. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention and are not intended to limit the scope of the present invention.

[0029] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0030] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0031] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials in this invention. In fact, the sources of the biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted according to the instructions in the embodiments. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0032] The nucleotides involved in the following examples can all be synthesized using existing technologies.

[0033] In this article, the term "LcIRX14L" refers to the gene encoding Leymus chinensis glycan glycosyltransferase, the term "LcIRX14L" refers to Leymus chinensis glycan glycosyltransferase, and the term "irx14L" refers to the Leymus chinensis mutant.

[0034] Example 1: Search for homologous genes of Leymus chinensis glycosyltransferase

[0035] Based on the conservation of xylan glycosyltransferases (IRX) across different species, the IRX9 / 10 / 14 protein sequences of Arabidopsis thaliana and rice were used as reference sequences for sequence alignment (BLAST) with the Leymus chinensis protein database in NCBI (https: / / www.ncbi.nlm.nih.gov / ). The IRX9 / 10 / 14 protein sequences of Arabidopsis thaliana were searched on the TAIR website (https: / / www.arabidopsis.org / ), with the following specific IDs: At1g27440, At5g61840, At2g37090, At1g27600, At4g36890, At5g67230. The IRX9 / 10 / 14 homologous gene protein sequences of rice were found using the National Rice Data Center website (https: / / ricedata.cn / ). The specific ID information is as follows: Os01g0926700, Os04g0398600, Os02g0520750, Os01g0926600, Os10g0180000, Os01g092640 0. Os01g0157700, Os03g0287800, Os07g0694400, Os05g0123100, Os01g0675500, Os05g 0559600, Os10g0205300, Os04g0103100, Os06g0687900, Os04g0650300, Os04g0650366. Figure 1 This is a phylogenetic tree of the IRX homologous genes of Leymus chinensis glycan, which shows the degree of phylogenetic relationship between Leymus chinensis IRX9 / 10 / 14 proteins and rice and Arabidopsis thaliana. Based on... Figure 1The protein sequence alignment results show that *Leymus chinensis* Lc2Ns001383 and Lc2Xm054717 are xylanosyltransferases most closely related to rice xylanosyltransferase IRX14L (Os04g0650300 / Os04g0650366). Both can be considered as *Leymus chinensis* xylanosyltransferase IRX14L. In this paper, Lc2Ns001383 and Lc2Xm054717 are collectively referred to as LcIRX14L (their encoding genes are uniformly named LcIRX14L). Among them, Lc2Ns001383 (its amino acid sequence is shown in SEQ ID NO:1) is named LcIRX14L-Ns (its encoding gene is named LcIRX14L-Ns, its nucleotide sequence is shown in SEQ ID NO:2), and Lc2Xm054717 (its amino acid sequence is shown in SEQ ID NO:2) is named LcIRX14L-Ns. The gene encoding LcIRX14L-Xm (as shown in NO:3) is named LcIRX14L-Xm (its nucleotide sequence is shown in SEQ ID NO:4).

[0036] Example 2: Construction of the Leymus chinensis LcIRX14L gene editing vector

[0037] A sgRNA (capable of simultaneously targeting LcIRX14L-Ns and LcIRX14L-Xm) for precise editing of LcIRX14L (LcIRX14L-Ns and LcIRX14L-Xm) was designed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ). The sgRNA was designed on the first exon of LcIRX14L, with the sequence shown below: GAAGCGGAAGCCGACGGCCAUGG (SEQ ID NO: 5). The TaU3 vector (Wang K et al. The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat Plants. 2022 Feb; 8(2):110-117. doi:10.1038 / s41477-021-01085-8. Epub 2022 Jan 13. Erratumin: Nat Plants. 2022 Jun; 8(6):717-720. doi:10.1038 / s41477-022-01173-3. PMID:35027699) was digested with the restriction endonuclease BbsI and annealed using the following primers. The specific procedures are as follows.

[0038] F: agcaGAAGCGGAAGCCGACGGCCA (SEQ ID NO: 6)

[0039] R: aaacTGGCCGTCGGCTTCCGCTTC (SEQ ID NO:7)

[0040] (1) Mix equal amounts of 0.1 μM F and 0.1 μM R and anneal at 95 °C for 5 min, and then slowly lower the temperature to room temperature. Use T4 ligase to ligate the annealed product to the enzyme-digested TaU3 vector.

[0041] (2) Amplify the correctly ligated vector using the F2 / R2 primers shown below, and simultaneously ligate the TaU3-sgRNA (Wang K et al. The gene TaWOX5 overcomes genotype dependence in wheat genetic transformation. Nat Plants. 2022 Feb; 8(2):110-117. doi:10.1038 / s41477-021-01085-8. Epub 2022 Jan 13. Erratumin: Nat Plants. 2022 Jun; 8(6):717-720. doi:10.1038 / s41477-022-01173-3. PMID:35027699) to the pCXUN-Cas9 vector (He Y et al. Self-cleaving ribozymes enable the production of guide RNAs from unlimited choices of promoters for CRISPR / Cas9 mediated genome editing. J Genet Genomics. 2017 Sep 20; 44(9):469-472. doi:10.1016 / j.jgg.2017.08.003. Epub 2017 Aug 24. PMID:28958488;PMCID:PMC5736383) on, the final vector map is as follows Figure 2 As shown, it is named XF4909 pCXUN-Cas9-TaU3-1383sgRNA. This gene editing vector can simultaneously target and edit LcIRX14L-Ns and LcIRX14L-Xm.

[0042] F2:acgaattcgagctcggtacc GCCAAGCTTGAATTCATCCTCAC(SEQ ID NO:8)

[0043] R2:cccctttcgccaggggtacc CATGATTACGAATTCGAGCTCgg (SEQ ID NO:9)

[0044] The PCR system consisted of: 50 ng plasmid, 0.8 μL of forward primer F2 (10 μM), 0.8 μL of reverse primer R2 (10 μM), 10 μL of 2×Phanta Max Buffer, 0.4 μL of dNTP Mix (10 mM each), 0.4 μL of Phanta Max Super-Fidelity DNA Polymerase (1 U / μL) (Nanjing Novizan Biotechnology Co., Ltd., P505-d1), and ddH2O to a final volume of 50 μL.

[0045] The PCR reaction program was as follows: 94℃ for 2 min; (94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min) × 35 cycles; 72℃ for 10 min, and then held at 16℃.

[0046] Example 3: Construction of the *Leymus chinensis* irx14L mutant

[0047] (3.1) Using the Agrobacterium-mediated callus infection system, the *Leymus chinensis* LcIRX14L gene editing vector constructed in Example 2 was introduced into *Leymus chinensis* callus tissue obtained from young spikelets as explants. After regeneration and seedling emergence, the tissue was transferred to vermiculite nutrient soil for cultivation. After three months of growth, DNA was extracted from the regenerated *Leymus chinensis* seedlings using the CTAB method. The editing status of LcIRX14L in the regenerated plants was detected by PCR and sequenced. The primers used to detect the editing status of LcIRX14L-Ns (Lc2Ns001383) were CP9464+CP9466, and the primers used to detect the editing status of LcIRX14L-Xm (Lc2Xm054717) were CP9465+CP9466.

[0048] Primer sequences are as follows

[0049] CP9464: ggagtgagtacggtgtgcGCACGCGCTCTTCTGCGCGACC (SEQ ID NO: 10)

[0050] CP9465: ggagtgagtacggtgtgcGCACGCGCTCTTCTGCGCGACG (SEQ ID NO: 11)

[0051] CP9466: gagttggatgctggatggACGAGGTGCGCGGAGGGGTTCA (SEQ ID NO: 12)

[0052] The PCR system consisted of: 50 ng genomic DNA, 0.8 μL forward primer (10 μM), 0.8 μL reverse primer (10 μM), 10 μL 2×Phanta Max Buffer, 0.4 μL dNTP Mix (10 mM each), 0.4 μL Phanta Max Super-Fidelity DNA Polymerase (1 U / μL) (Nanjing Novizan Biotechnology Co., Ltd., P505-d1), and ddH2O to a final volume of 20 μL.

[0053] The PCR reaction program was as follows: 94℃ for 2 min; (94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s) × 35 cycles; 72℃ for 10 min, and then held at 16℃.

[0054] (3.2) The sequencing results were compared with the reference genome sequence. The results of the Leymus chinensis LcIRX14L sequence editing detection are as follows: Figure 3 As shown, the irx14L mutant (also referred to as the cr-1 mutant in this paper) has an insertion of a "T" at Lc2Ns001383 and a deletion of two "CG" bases at Lc2Xm054717 compared to the wild-type control line (WT). This result indicates that the LcIRX14L sequence of the irx14L mutant undergoes a frameshift mutation, which leads to a decrease or absence of expression of the xylan glycosyltransferase IRX14L in the irx14L mutant, or downregulation (including loss) of the function of this xylan glycosyltransferase IRX14L.

[0055] Example 4: Phenotypic identification of the *Leymus chinensis* irx14L mutant

[0056] Seedlings of wild-type and irx14L mutant of Leymus chinensis with similar growth status were cultured in vermiculite nutrient soil, and the tillering and plant height phenotypes of the plants were observed after two months of growth.

[0057] The results are as follows Figure 4 As shown, the LcIRX14L knockout mutant of Leymus chinensis exhibits similar plant height and tiller number to the wild-type material, indicating that the LcIRX14L mutation did not significantly affect its growth phenotype.

[0058] Example 5: Determination of sugar release

[0059] (5.1) Take different tissues from the stems, leaves, and leaf sheaths of Leymus chinensis (wild type and irx14L mutant), dry them, and then crush them into powder using a cell disruptor and pass them through a 100-mesh sieve. Weigh 500 mg of powder and add it to a 50 mL centrifuge tube. Wash the powder repeatedly with 75% ethanol until the supernatant is colorless. Resuspend the sample using a chloroform:methanol = 1:1 mixture, centrifuge at 3000 rpm for 5 min, repeat several times until the supernatant is colorless; add 20 mL of acetone to the tube, cap it, and resuspend the sample. Centrifuge at 3000 rpm for 5 min, discard the supernatant to remove some organic impurities, repeat this step 3 times, and place the sample in a 55℃ oven or fume hood to dry; add 5 mL of MES / Tris buffer (1.952 g MES, 1.42 g Tris, add water to make up to 200 mL, adjust the pH to 8.1-8.3) to the tube to wash the precipitate, centrifuge at 3000 rpm for 5 min, discard the supernatant; add 30 mL of acetone... In a MES / Tris buffer solution, 30 μL of amylase (α-Amylase, K-TDFR-100A, Megazyme) was reacted in a 97°C water bath for 35 min, then transferred to a 60°C water bath for 1 h. After the sample cooled to room temperature, it was centrifuged at 2500 rpm for 10 min, and the supernatant was discarded. The precipitate was washed three times with ddH2O. 100 μL of the resuspended sample was transferred to a new tube, and KI was added to the tube to check for any remaining starch. If the solution did not turn blue, there was no starch residue in the sample. The sample was centrifuged, the supernatant was removed, and 5 mL of acetone was added to wash the precipitate. The supernatant was then centrifuged again. This step was repeated three times. The sample was then dried in a 55°C oven or in a fume hood to remove the acetone. The remaining powder was the alcohol-insoluble matter (AIR).

[0060] (5.2) Weigh approximately 2 mL of AIR powder into a 2 mL threaded tube and set up 5 replicates. Dilute Cellic CTec2 enzyme digest (SAE0020, Novozymes) with ammonium acetate buffer (pH 5.0) at a ratio of 1:20, and add 20 μL of 20 mg / mL inositol as an internal control. Incubate at 37°C with shaking for 48 h, and inactivate the enzyme at 100°C for 10 min. After the sample cools to room temperature, centrifuge and transfer 200 μL of supernatant to a new threaded tube, then dry. Add 250 μL of 2M TFA (trifluoroacetic acid), heat at 121°C for 90 min, centrifuge at 10000 rpm for 10 min, and transfer 200 μL of supernatant to a glass tube, then dry. Add 300 μL of isopropanol, dry, and repeat twice; add 200 μL of sodium borohydride (dissolved in 10 mg / mL ammonia water) and react at room temperature for 1.5 h, then add 150 μL of glacial acetic acid to neutralize; add 250 μL of methanol:acetic acid 9:1 and dry, repeat this step 3 times; add 1 mL of ethyl acetate and 4 mL of water, centrifuge at 2000 rpm for 2 min, take 100 μL of sample and add 200 μL of acetone for GC-MS analysis.

[0061] The results are as follows Figure 5 As shown, compared to the wild-type WT, the irx14L mutant (cr-1) exhibits significantly increased glucose, xylose, and arabinose release from its stems, leaves, and leaf sheaths. Therefore, this invention provides an important basis for research on the efficient utilization of nutrients in Leymus chinensis and rapid germplasm improvement.

[0062] The irx14L mutant strain constructed in the above embodiments is an irx14L mutant strain in which both LcIRX14L-Ns and LcIRX14L-Xm are mutated. Compared with wild-type WT, it can improve the fiber utilization rate and / or sugar release of Leymus chinensis without affecting the yield of Leymus chinensis, for example, by increasing the release of sugars (including glucose, xylose, and arabinose, and mixtures thereof) from the stems and / or leaves and / or leaf sheaths of Leymus chinensis. However, when gene editing is performed on only one of LcIRX14L-Ns and LcIRX14L-Xm to mutate it (this mutation leads to a decrease or absence of expression of xylan glycosyltransferase IRX14L in Leymus chinensis, or downregulation (including loss) of the function of xylan glycosyltransferase IRX14L) to obtain the irx14L mutant strain, it can also improve the fiber utilization rate and / or sugar release of Leymus chinensis without affecting the yield of Leymus chinensis.

[0063] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of the xylan glycosyltransferase LcIRX14L or its encoding gene LcIRX14L from Leymus chinensis as a target in one or more of the following: 1) Improve the utilization rate of sheepgrass fiber without affecting sheepgrass yield; and 2) Increase the sugar release of sheepgrass without affecting its yield.

2. The application according to claim 1, wherein the increase in sugar release from *Leymus chinensis* comprises one or more of the following: 2-1) Increase the sugar release from sheepgrass stems; 2-2) Increase the sugar release from Leymus chinensis leaves; and 2-3) Increase the sugar release from the leaf sheath of Leymus chinensis; Optionally, the sugar includes glucose, xylose, and arabinose, and mixtures thereof.

3. The application according to claim 1 or 2, wherein the xylan glycosyltransferase LcIRX14L in Leymus chinensis is selected from LcIRX14L-Ns, LcIRX14L-Xm, or a combination thereof, and the encoding gene of the xylan glycosyltransferase LcIRX14L in Leymus chinensis is selected from LcIRX14L-Ns, LcIRX14L-Xm, or a combination thereof; wherein: The LcIRX14L-Ns contains or is composed of the amino acid sequence shown in SEQ ID NO:1, and the LcIRX14L-Xm contains or is composed of the amino acid sequence shown in SEQ ID NO:3; The LcIRX14L-Ns contains or is composed of the nucleotide sequence shown in SEQ ID NO:2, and the LcIRX14L-Xm contains or is composed of the nucleotide sequence shown in SEQ ID NO:

4.

4. The application according to any one of claims 1-3, wherein it works by downregulating the expression and / or function of xylan glycosyltransferase IRX14L in Leymus chinensis; Optionally, the sequence of the gene encoding the xylan glycosyltransferase LcIRX14L in Leymus chinensis can be altered to be different from the original sequence by introducing base substitutions, insertions or deletions, or by knocking out the gene encoding the xylan glycosyltransferase LcIRX14L in Leymus chinensis. Further optionally, the sequence of the gene encoding the xylan glycosyltransferase LcIRX14L in Leymus chinensis is altered to be different from the original sequence by gene editing, wherein the gene editing is performed by a CRISPR / Cas9 gene editing system; even further optionally, the sgRNA used in the CRISPR / Cas9 gene editing system contains or is composed of the nucleotide sequence shown in SEQ ID NO:

5.

5. A method for improving the utilization of Leymus chinensis fiber, comprising downregulating the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis.

6. A method for increasing sugar release from Leymus chinensis, comprising downregulating the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis.

7. A method for breeding a Leymus chinensis strain with improved fiber utilization, comprising using transgenic, hybridization and / or gene editing technologies to downregulate the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis, thereby obtaining the Leymus chinensis strain with improved fiber utilization.

8. A method for breeding a Leymus chinensis strain with increased sugar release, comprising using transgenic, hybridization and / or gene editing technologies to downregulate the expression and / or function of the xylan glycosyltransferase LcIRX14L in Leymus chinensis, thereby obtaining the Leymus chinensis strain with increased sugar release.

9. The method according to claim 7 or 8, wherein the gene editing technique comprises introducing a vector encoding the xylan glycosyltransferase LcIRX14L from Leymus chinensis with base substitution, insertion, or deletion, or transforming a vector that targets and knocks out the xylan glycosyltransferase LcIRX14L from Leymus chinensis into the recipient Leymus chinensis, so as to downregulate the expression and / or function of xylan glycosyltransferase IRX14L in Leymus chinensis.

10. A CRISPR / Cas9 gene editing system comprising an sgRNA expression element, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO:5.

Images