Use of a sri lankan cassava mosaic virus bv1 in inhibiting rna silencing

CN122235213BActive Publication Date: 2026-08-11SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-14
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

但是目前尚不明确BV1是否具有沉默抑制功能

Benefits of technology

[0013]本发明研究发现BV1具有沉默抑制功能,可抑制GFP的被降解,提高GFP mRNA表达量,从而提高GFP蛋白表达量。上述研究结果,为阐明BV1功能奠定基础,为深入研究SLCMV的侵染控制机制提供了基础数据,也为培育木薯抗病品种提供新的思路,还为木薯抗病育种提供了新的靶标基因,对于木薯抗病育种具有重要的促进作用。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122235213B_ABST
    Figure CN122235213B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to the application of Sri Lankan cassava mosaic virus BV1 in suppressing RNA silencing. This invention reveals that BV1 possesses silencing and inhibitory functions, suppressing GFP degradation and thereby increasing GFP protein expression. These findings lay the foundation for elucidating BV1 function, provide basic data for in-depth research on the infection control mechanism of SLCMV, offer new ideas for breeding disease-resistant cassava varieties, and provide new target genes for disease-resistant cassava breeding, thus playing a significant role in promoting cassava breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of Sri Lanka cassava mosaic virus BV1 in inhibiting RNA silencing. Background Technology

[0002] Cassava mosaic disease (CMD) is the most serious disease affecting cassava, severely impacting yield and jeopardizing the development of the cassava industry and food security. In my country, CMD caused by geminiviruses is primarily due to infection with the Sri Lankan cassava mosaic virus strain (SLCMV). The virus causes symptoms such as chlorosis, leaf curling, and deformation in cassava leaves. Severely infected plants experience impaired vegetative growth and yield. SLCMV is highly virulent and has a very wide host range, primarily in the Euphorbiaceae and Solanaceae families, and can even extend to Arabidopsis thaliana and Ageratum conyzoides.

[0003] SLCMV is a typical two-component geminivirus, with its genome consisting of two circular components, DNA-A and DNA-B. The DNA-B component encodes BV1 and BC1. Viruses are obligate parasites and must evade or tolerate degradation by host cells to successfully infect. Most plant viruses have co-evolved with plants to produce one or more viral suppressors of RNA silencing (VSRs) to counteract the host's antiviral immune function against PTGS (post-transcriptional gene silencing). However, it is currently unclear whether BV1 possesses a silencing function.

[0004] In the functional identification study of plant RNA silencing repressors, transgenic 16C Nicotiana bungeana (… Nicotiana benthamianaThe combination of line 16C and Agrobacterium infiltration is a widely used classic system. The basic principle of this system is as follows: The green fluorescent protein (GFP) gene is stably integrated into 16C Nicotiana Bunsenifolia plants. Due to the persistent endogenous post-transcriptional gene silencing (PTGS) mechanism, small interfering RNAs (siRNAs) targeting GFP mRNA are produced within the plant, leading to GFP mRNA degradation, low GFP protein accumulation, and a weak overall green fluorescence in the plant. When the GFP expression vector and the expression vector of the protein to be identified are co-infiltrated into 16C Nicotiana Bunsenifolia leaves using Agrobacterium, if the protein to be identified has silencing repressor activity, it can interfere with the host plant's (Nicotiana Bunsenifolia) RNA silencing pathway (e.g., by binding siRNA, inhibiting RISC complex assembly, etc.), thereby protecting GFP mRNA from degradation, increasing GFP transcript stability, leading to a rise in translation levels, and a significant increase in GFP protein accumulation, which manifests as enhanced green fluorescence in the infiltrated area under UV light. It is important to clarify that the changes in GFP fluorescence expression in this system do not originate from direct molecular interactions (such as sequence-specific binding or protein-protein interactions) between the gene sequence to be identified and the GFP gene or GFP protein. Instead, they depend on the inhibitory effect of the protein to be identified on the host plant's endogenous RNA silencing pathway. In other words, GFP in this system serves only as a visual marker reporting the activity of the host RNA silencing pathway; its fluorescence recovery reflects whether the host plant's pathway background has been disturbed. Based on this principle, those skilled in the art can determine whether the protein to be identified has a silencing repressor function by observing fluorescence intensity, detecting GFP transcripts and proteins. Numerous studies in the prior art have successfully used this system to identify various virus-encoded silencing repressors (such as HC-Pro and p19). Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of Sri Lanka cassava mosaic virus BV1 in inhibiting RNA silencing.

[0006] The first aspect of the present invention is to provide the use of the BV1 gene, or the protein encoded by the BV1 gene, or a recombinant vector or host bacterium containing the coding region of the BV1 gene in plants to inhibit GFP silencing and / or increase GFP expression, wherein the nucleotide sequence of the BV1 gene is shown in SEQ ID NO:1.

[0007] Furthermore, the plant in question is a genetically modified 16C Nicotiana bungeana.

[0008] A second aspect of the present invention is to provide the use of a BV1 gene, or a protein encoded by the BV1 gene, or a recombinant vector or host bacterium containing the coding region of the BV1 gene in inhibiting the degradation of GFP mRNA in plants and / or increasing the accumulation of GFP protein levels in plants; wherein the nucleotide sequence of the BV1 gene is shown in SEQ ID NO:1.

[0009] Furthermore, the plant in question is a genetically modified 16C Nicotiana bungeana.

[0010] A third aspect of the present invention is to provide a method for inhibiting the degradation of plant GFP mRNA, increasing the expression level of plant GFP, and / or increasing the accumulation level of GFP protein in plants, comprising the following steps: Plants are transformed using the BV1 gene, or the protein encoded by the BV1 gene, or a recombinant vector or host bacterium containing the coding region of the BV1 gene.

[0011] Furthermore, the plant in question is a genetically modified 16C Nicotiana bungeana.

[0012] Furthermore, the BV1 gene, or the protein encoded by the BV1 gene, or a recombinant vector or host bacterium containing the coding region of the BV1 gene, can increase the expression level of GFP mRNA. Beneficial effects

[0013] This invention reveals that BV1 possesses a silencing and inhibitory function, suppressing GFP degradation, increasing GFP mRNA expression, and consequently, increasing GFP protein expression. These findings lay the foundation for elucidating BV1 function, provide basic data for in-depth research on the infection control mechanism of SLCMV, offer new insights for breeding disease-resistant cassava varieties, and provide new target genes for cassava disease-resistant breeding, thus playing a significant role in promoting cassava disease-resistant breeding. Attached Figure Description

[0014] Figure 1 The fluorescence expression of single-chain green fluorescent protein (pG1300) and BV1 expression vector Agrobacterium tumefaciens co-infiltrates transgenic 16C Nitralophora Bunsenium. Among them, pG1300: plant expression vector expressing GFP; pCP-StHA: plant expression vector expressing CP-StHA; pBV1-StHA: plant expression vector expressing BV1-StHA; p1300-StHA: plant expression vector expressing St and HA tags.

[0015] Figure 2Western blotting was used to detect the GFP protein accumulation level in *Nicotiana benthamiana* leaves after soaking pG1300 with CP-StHA, empty vector StHA, and BV1-StHA for 5 dpa. pG1300: a plant expression vector expressing GFP; CP-StHA: a plant expression vector pCP-StHA expressing CP-StHA; BV1-StHA: a plant expression vector pBV1-StHA expressing BV1-StHA; StHA: a plant expression vector pStHA with only St and HA tags; GFP: GFP antibody; PS: Ponceau S staining.

[0016] Figure 3 To detect the effect of BV1 on GFP mRNA expression by RT-qPCR, where GFP: GFP mRNA; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; BV1-StHA: plant expression vector pBV1-StHA expressing BV1-StHA; StHA: plant expression vector pStHA with only St and HA tags. Detailed Implementation

[0017] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0018] Example 1

[0019] 1 plant material This invention uses transgenic 16C Nicotiana Bunseni as an indicator plant and identifies silencing repressors by observing GFP fluorescence changes using the Agrobacterium tumefaciens infiltration method.

[0020] The transgenic 16C Nicotiana benthamiana line 16C used in this invention is a reporter plant that stably expresses green fluorescent protein (GFP). The original construction of this material was completed by Professor Baulcombe's team, and the construction method is disclosed in the reference (Voinnet, O., & Baulcombe, DC, 1997. Systemicsignalling in gene silencing. Nature, 389(6651), 553). The main content of this method is as follows: The GFP gene driven by the 35S promoter was introduced into the Nicotiana benthamiana genome via Agrobacterium-mediated genetic transformation. After screening and self-pollination purification, homozygous transgenic lines stably expressing GFP were obtained.

[0021] The 16C transgenic tobacco seeds used in this invention were developed by Professor Qu Feng (Reference: Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology The first author of 77(1): 511-522) kindly provided this information. In this invention, the experimental system and method disclosed in Qu et al., 2003 (i.e., using transgenic 16C Nicotiana Bunsenata as an indicator plant and observing GFP fluorescence changes by Agrobacterium tumefaciens infiltration method to identify silencing repressors) are mainly referenced for the functional study of the protein to be identified.

[0022] 2 Experimental Methods and Results

[0023] 2.1 Construction of plant expression vectors (1) The method for constructing the empty vector p1300-StHA is as follows: The target fragment StHA-XbaI&SacI (SEQ ID NO:3, specific sequence is shown in Table 1) was synthesized, and double digested with XbaI and SacI and ligated with the pG1300 large fragment that had been double digested with the same enzymes. The positive clone was identified by sequencing and named p1300-StHA.

[0024] The pG1300 vector is a plant binary expression vector containing a 35S promoter driving the GFP gene. Its construction method and complete sequence can be found in Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.

[0025] (2) The construction method of the plant expression vector pCP-StHA is as follows: Using AD-CP as a template, the known silencing repressor TCV CP was amplified using primers CP-1F Xba and CP-1053RBamHI (SEQ ID NO:5 and SEQ ID NO:6, specific sequences are shown in Table 2). Its nucleotide sequence is shown in SEQ ID NO:2 (this sequence is referenced from Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiation step.). Journal of virology , 77 (1), 511–522.).

[0026] The AD-CP plasmid is a cloning vector containing the turnip shrunken virus (TCV) coat protein (CP) gene. Its construction method can be found in [link to documentation]. Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166. The complete nucleotide sequence of TCV CP is shown in SEQ ID NO:2.

[0027] The reaction system is as follows:

[0028] The reaction procedure is as follows:

[0029] The amplified product was double-digested with XbaI and BamHI and ligated with the p1300-StHA fragment that had been double-digested with the same enzymes. The positive clone was identified by sequencing and named pCP-StHA.

[0030] (3) The construction method of the plant expression vector pBV1-StHA is as follows: The target fragment BV1-XbaI&BamHI (SEQ ID NO:4, specific sequence shown in Table 1) was artificially synthesized with restriction endonucleases XbaI and BamHI added to both ends. After double digestion with XbaI and BamHI, the target fragment was ligated to a large fragment of p1300-StHA that had been double-digested with the same enzymes. Positive clones were identified by sequencing and named pBV1-StHA.

[0031] Table 1 Target Fragment Sequence StHA-XbaI&SacI <![CDATA[ TCTAGA TGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTATTAA G AGCT C <!-- 4 -->]]> BV1-XbaI&BamHI <![CDATA[ TCTAGA ATGAGAAGAGGTGCCTATACCCCCCGTTCTACTCCATTCTCTCGTGACCGGAGATCGTATAATGCCGGTAAGGGTAGATCATTTCGTTCTTACCGTCGTCGTGGACCTGTTCGTCCATTAGTTCGTCGGAACCTGTTTGGTGATGACCATGCACGTGCATTTACGTATAAGACCGTATCGGAGGATCAATTTGGACCGGATTTTACCATACATAATAATAATTATAAGTCATCGTATATATCTATGCCTGCCAAAACACGTGCCCTTAGCGATAACAGGGTAGGTGATTATATCAAACTTGTAAATATATCATTTACAGGTACAGTGTGTATTAAAAACAGCCAGATGGAATCTGACGGAAGCCCAATGTTGGGCCTGCATGGGCTGTTTACTTGTGTATTGGTCCGGGATAAGACCCCTCGTATATATTCTGCCACTGAGCCTTTGATACCTTTCCCACAGTTGTTTGGGTCCATAAACGCGAGCTATGCGGATTTGTCTATACAAGACCCATATAAGGATCGGTTCACAGTTATCCGTCAGGTGTCTTACCCAGTTAATACGGAGAAGGGTGATCATATGTGTCGTTTCAAAGGCACTCGACGTTTTGTTGGTAGATACCCTATCTGGACTAGTTTTAAAGATGATGGTGGCATTGGAGATTCATCGGGATTATATAGTAATACGTATAAAAATGCCATACTTGTATATTATGTATGGCTCAGCGACGTATCGTCACAATTGGAAATGTATTGTAAATATGTAACTCGATATATTGGT GGATCC ]]> Table 2 Primers used CP-1F Xba <![CDATA[ TCTAGA ATGGAAAATGATCCTAGAGTC]]> CP-1053RBamHI <![CDATA[ GGATCC CCCGGGAATTCTGAGTGCTTGCCATTTAC]]> qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT

[0032] 2.2 Observation of BV1 silencing and inhibition function The single-chain green fluorescent protein expression vector pG1300 (Liu et al., 2023) is preserved in our laboratory.

[0033] (1) Recombinant plasmid was transformed into Agrobacterium (GV3101) competent cells Following the instructions for use of GV3101 Chemically Competent Cell, plant expression vectors pG1300, p1300-StHA, pCP-StHA, and pBV1-StHA were transformed into Agrobacterium GV3101 competent cells. After transformation, the resuspended bacterial blocks were evenly spread onto LB agar plates containing Kan and Rif, and incubated upside down at 28°C for 72-90 h. After 2-3 days, when Agrobacterium colonies reached 2-3 mm in size, single colonies were selected for PCR identification.

[0034] (2) Infiltration of transgenic 16C tobacco The Agrobacterium resuspension of the recombinant vector was mixed and injected into the transgenic 16C tobacco leaves. The operation steps are as follows: (a) Use a pipette tip to pick up a single colony that has been identified as positive by colony PCR and put it into 5 ml of LB liquid medium containing the corresponding antibiotic. Incubate overnight at 28°C with shaking on a constant temperature shaker at 200 r / min.

[0035] (b) Centrifuge the bacterial culture at 7000 rpm for 15 min and discard the supernatant.

[0036] (c) Prepare injection buffer: Take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES and 200 μL of 100 mg / mL AS respectively, and finally make up to 200 mL with ultrapure water.

[0037] (d) Resuspend the bacterial suspension pellet in 5 mL of injection buffer, vortex thoroughly until homogeneous, and then measure the OD of the bacterial suspension.600 The bacterial culture concentration was adjusted to the OD value by diluting the bacterial culture to the appropriate level. 600 It is 0.5.

[0038] (e) After the diluted bacterial solution is left at room temperature for 2-3 hours, it is mixed with the solution at a 1:1 volume ratio according to the required mixing system (see Table 3 for specific combinations).

[0039] (f) Take vigorous, 5-7 leaf stage transgenic 16C Nicotiana benthamiana and inject it into the best-growing leaves using a 1 mL syringe, injecting about 2 cm of the leaf. 2 Within the specified range, all combinations were injected onto the same leaf, 10 leaves were injected, and the injected Nicotiana bungeanum was treated in the dark overnight, and then cultured under normal conditions.

[0040] (g) On day 5 post-injection, using a handheld fluorescent protein observation lamp (LUYOR-3415RG) and wearing LUV-30A yellow glasses, the expression of GFP fluorescence in each combination was observed under blue excitation light (495 nm), and photographs were taken. After taking the photos, the tobacco infection area was circled with a marker.

[0041] Table 3 Combinations of Agrobacterium plasmids injected with 16C-Nicotiana Bunsenium Combination 1 p1300-StHA + pG1300 Combination 2 pCP-StHA + pG1300 Combination 3 pBV1-StHA + pG1300 It should be noted that this embodiment relies on the background of the host plant's (Nicotiana Bunsenata) endogenous RNA silencing pathway, using GFP fluorescence changes to determine whether BV1 has a silencing repressor function. Specifically, the GFP gene stably integrated in transgenic 16C Nicotiana Bunsenata plants undergoes continuous mRNA degradation under the action of endogenous posttranscriptional gene silencing (PTGS) mechanism, resulting in low GFP protein accumulation and only weak fluorescence. When a candidate protein is introduced through Agrobacterium co-infiltration, if the protein has silencing repressor activity, it can interfere with the host plant's RNA silencing pathway (e.g., binding siRNA, inhibiting RISC complex assembly), thereby protecting GFP mRNA from degradation, increasing GFP transcript stability, translation level, and significantly increasing protein accumulation, ultimately showing enhanced green fluorescence in the infiltrated area under UV light. Conversely, if there is no repressor activity, GFP mRNA remains degraded, and fluorescence does not recover. Therefore, in this system, GFP only serves as a visual marker reporting the activity of the host RNA silencing pathway; whether fluorescence recovers reflects whether the host plant pathway background is interfered with by the candidate protein, rather than the direct interaction between the candidate protein and GFP. Based on the above principles, this embodiment observes... Figure 1 The fluorescence enhancement results shown indicate that BV1 has a silencing and inhibitory function.

[0042] The results are as follows Figure 1As shown, leaves co-infiltrated with pG1300 and pCP-StHA or pBV1-StHA exhibited strong GFP fluorescence, while tobacco leaves co-injected with the empty vector p1300-StHA showed only weak fluorescence. It is preliminarily judged that BV1, like the known silencing repressor CP, inhibits GFP from being silenced and has a silencing and repressing function.

[0043] 2.3 Detection of BV1 silencing and inhibition function Total protein and RNA were extracted from tobacco leaves of different injection combinations on day 5, and Western blotting and RT-qPCR were performed to verify the fluorescence observation results. The specific methods are as follows: Plant total protein extraction and Western Blot (WB) reference (Liu Linyu's master's thesis "Cassava mosaic virus silencing repressor AC4 hijacks UPF1 to promote viral infection").

[0044] This experiment further verified the fluorescence observation results by detecting the GFP protein accumulation level using Western blotting. The judgment basis is consistent with the aforementioned principle: in transgenic 16C Nicotiana Bunsenii, the homeostatic level of GFP protein is negatively regulated by the host RNA silencing pathway. If BV1 has silencing repressor activity, it can interfere with the host plant's RNA silencing pathway (such as binding siRNA or inhibiting the RISC complex), thereby protecting GFP mRNA from degradation, increasing GFP translation efficiency, and significantly increasing protein accumulation. Therefore, the strength of the GFP signal band in the Western blotting results directly reflects whether the host RNA silencing pathway is inhibited. If there is no repressor activity, GFP mRNA continues to be degraded, the protein cannot accumulate effectively, and the signal band is weak. Based on the above principle, Figure 2 As shown, both BV1 and the known repressor CP significantly enhanced the GFP protein band, while the empty vector control band was weak, further confirming that BV1 increases the accumulation level of GFP protein by inhibiting the host RNA silencing pathway, thus possessing a silencing and inhibitory function.

[0045] The results are as follows Figure 2 As shown in the figure above, samples co-infiltrated with pG1300 and either pCP-StHA or pBV1-StHA exhibited high levels of GFP protein accumulation, while samples co-infiltrated with the empty vector p1300-StHA showed weaker GFP signal bands. Rubiso Ponceau S (PS) staining showed that the sample loading amounts were basically consistent. Figure 2 (See the figure below). The Western blot results confirmed the fluorescence observations, indicating that BV1, like the known viral silencing repressor CP, has a silencing and repressive function, which can inhibit GFP degradation and increase GFP expression.

[0046] 2.4 Total RNA extraction from plant leaves and detection of relative GFP mRNA expression levels by real-time quantitative PCR (RT-qPCR) Total RNA was extracted from tobacco according to the instructions of TRNzol Universal Total RNA Extraction Reagent from Tiangen Biotech. Then, the RNA sample was reverse transcribed using a two-step method according to the instructions of the reverse transcription kit. Using the obtained cDNA sample as a template, qNbActin-128F and qNbActin-256R were used as internal control primers (SEQ ID NO:7 and SEQ ID NO:8), and qsGFP-306F and qsGFP-519R were used as GFP detection primers (SEQ ID NO:9 and SEQ ID NO:10) for real-time quantitative PCR detection.

[0047] This experiment used RT-qPCR to detect the relative expression level of GFP mRNA, verifying the silencing and repressive function of BV1 at the transcriptional level. The principle is based on the fact that under the continuous action of the endogenous RNA silencing pathway in the host plant (16C Nicotiana benzi), GFP mRNA is targeted for degradation, resulting in a low basal expression level. If BV1 possesses silencing repressor activity, it can interfere with different stages of the host RNA silencing pathway (e.g., binding to mature siRNA, preventing RISC cleavage of mRNA, etc.), thereby directly increasing the stability of GFP mRNA and significantly restoring its transcript accumulation. Therefore, the relative expression level of GFP mRNA is a key indicator for determining whether the host RNA silencing pathway is suppressed. Without repressor activity, GFP mRNA remains efficiently degraded by the silencing mechanism, and its expression level remains low. Based on the above principle, Figure 3 Both BV1 and the known repressor CP significantly increased GFP mRNA expression levels compared to the empty vector control, indicating that BV1 indeed protects the stability of GFP mRNA by inhibiting the host RNA silencing pathway, thus confirming its silencing and repressive function at the transcriptional level.

[0048] The results are as follows Figure 3 As shown, the GFP expression level co-expressed with BV1 was significantly higher than that co-expressed with the empty vector (StHA), and was close to the GFP expression level co-expressed with the known silencing suppressor CP, further demonstrating that BV1 can suppress GFP silencing and has a silencing function.

[0049] RNA silencing, a phenomenon found in eukaryotes, refers to the suppression of target gene expression in a sequence-specific manner mediated by small RNAs (21-30 nt). In plants, besides regulating growth and development, RNA silencing also plays a crucial role in resisting viral invasion. Because viruses are obligate parasites, they have co-evolved with plants over a long period, developing viral silencing repressors to interfere with and disrupt different stages of the RNA silencing pathway. When breeding transgenic virus-resistant crops, a key gene sequence of a viral silencing repressor can be transferred into the plant, allowing the plant to continuously produce siRNA targeting the virus. This enables the plant to proactively activate the RNAi mechanism to eliminate the virus once it invades. Furthermore, gene editing or transgenic technology can be used to modify host proteins in plants that interact with viral silencing repressors, enhancing the affinity between host proteins and viral silencing repressors. This allows host proteins to more efficiently "capture" a wider variety of viral silencing repressors; therefore, even if the virus mutates, its repressors are easily recognized, thus broadly activating the disease resistance response. Alternatively, it can alter the function of host proteins, optimizing the combination of the parts of host proteins responsible for "disease-resistant signal transduction" with the parts responsible for "binding repressors" to create new disease-resistant genes. Once the viral repressor enters the cell, it acts like an "alarm switch," immediately triggering a strong defensive response.

[0050] This invention reveals that BV1 possesses a silencing and inhibitory function, suppressing the degradation of GFP mRNA and the expression level of GFP mRNA, thereby increasing the expression level of GFP protein. Therefore, this invention not only lays the foundation for elucidating the function of BV1 but also provides a new target gene for cassava disease resistance breeding.

[0051] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of a BV1 gene, or a protein encoded by said BV1 gene, or a recombinant vector or host bacterium containing the coding region of said BV1 gene, in plants to inhibit GFP silencing and / or increase GFP expression, wherein, The plant was transformed using the BV1 gene or a recombinant vector or host bacterium containing the coding region of the BV1 gene, wherein the nucleotide sequence of the BV1 gene is shown in SEQ ID NO:1, and the plant is a transgenic 16C Nicotiana spp.

2. The application of a BV1 gene, or the protein encoded by said BV1 gene, or a recombinant vector or host bacterium containing the coding region of said BV1 gene, in inhibiting the degradation of GFP mRNA and / or increasing the accumulation of GFP protein levels in plants, wherein, The plant was transformed using the BV1 gene or a recombinant vector or host bacterium containing the coding region of the BV1 gene, wherein the nucleotide sequence of the BV1 gene is shown in SEQ ID NO:1, and the plant is a transgenic 16C Nicotiana spp.

3. A method for inhibiting the degradation of plant GFP mRNA and / or increasing the expression level of plant GFP, characterized in that, Includes the following steps: Plants are transformed using the BV1 gene or a recombinant vector or host bacterium containing the coding region of the BV1 gene, wherein the nucleotide sequence of the BV1 gene is shown in SEQ ID NO:1, and the plant is a transgenic 16C Nicotiana spp.

Citation Information

Patent Citations

  • Application of cassava mosaic virus AC2 in inhibiting degradation of mRNA decay substrate

    CN120060355A

  • Cassava mosaic disease resistant cassava MeRBCS1 gene and application thereof

    CN121294465A