Application of uORF of wheat TaABA2 gene in improving salt tolerance of wheat
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-05-22
- Publication Date
- 2026-08-07
AI Technical Summary
现有技术虽提及了uORF在植物抗逆中的通用调控功能,但尚未有针对小麦A基因组TaABA2基因特有的复杂uORF簇进行系统解析,更未公开通过特定组合方式破坏其中若干uORF的翻译起始功能来提升小麦耐盐性的相关报道
[0015] (1) This invention discovers the wheat A genome TaABA2 A complex regulatory cluster of 14 uORFs exists in the 5' UTR upstream of the gene, and uORF1, uORF3, uORF4, uORF5, and uORF12 were precisely identified as core elements co-regulating salt tolerance. Their function was inactivated by mutating the start codon ATG to ATA in a specific combination of uORFs, thus achieving salt tolerance without altering the gene's structure. TaABA2 At the transcriptional level, precise upregulation of translation efficiency can improve wheat salt tolerance without affecting normal growth and development.
Smart Images

Figure CN122235218B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to wheat. TaABA2 Application of the uORF gene in regulating plant stress tolerance, especially in improving wheat salt tolerance. Background Technology
[0002] wheat( Triticum aestivum Wheat (Triticum aestivum) is an important cultivated crop in the genus Triticum of the Poaceae family, providing approximately 21% of the world's food energy and 20% of its protein for more than one-third of the global population. With the impact of global climate change, water scarcity, and inefficient irrigation methods, soil salinization is becoming increasingly severe, posing a major environmental factor restricting wheat yield and food security. It is estimated that approximately 1 billion hectares of arable land worldwide are threatened by salinization. Salt stress severely inhibits wheat growth and development primarily through a triple mechanism of osmotic imbalance, ion toxicity, and oxidative damage. However, as a salt-sensitive crop, wheat has a relatively narrow genetic basis for salt tolerance, complex salt tolerance regulatory pathways, and limited discovery of key resistance genes, making it difficult to meet the technical needs for genetic improvement of wheat salt tolerance.
[0003] Abscisic acid (ABA) is a core signaling molecule in plant responses to abiotic stress. Under salt stress, plants synthesize endogenous ABA to regulate ion channels, reduce the accumulation of reactive oxygen species (ROS), and alleviate osmotic pressure, thereby maintaining water balance and mitigating salt damage. Therefore, appropriately enhancing ABA biosynthesis through biotechnology is an effective way to confer salt tolerance in plants.
[0004] Currently widely used gene expression regulation methods, such as transgenic overexpression or gene knockout technology, often alter the expression level of target genes to unpredictable degrees, potentially leading to malformed plant development or undesirable agronomic traits. Upstream open reading frames (uORFs) are cis-regulatory elements ubiquitous in the 5'UTR region of eukaryotic mRNA. They can inhibit the translation of downstream major genes (mORFs) without affecting gene transcription, thus enabling precise fine-tuning of gene expression at the translational level.
[0005] Wheat, as a complex allohexaploid crop, typically has three subgenomic copies (A, B, and D) of the same gene, with significant differences in the non-coding region sequences among these subgenomic copies. This invention is the first to discover that wheat… TaABA2 Of the three homologous copies of the gene, only the upstream 5' UTR of the A genome copy contains a complex regulatory cluster consisting of 14 uORFs. While existing techniques mention the general regulatory functions of uORFs in plant stress resistance, there are currently no specific techniques targeting the wheat A genome. TaABA2The complex uORF clusters unique to the gene were systematically analyzed, and there were no published reports on improving wheat salt tolerance by disrupting the translation initiation function of some uORFs through specific combinations. Summary of the Invention
[0006] To address the shortcomings of the existing technologies, this invention provides a method for editing the wheat ABA biosynthesis gene using gene editing technology. TaABA2 A method to regulate wheat salt tolerance using non-coding cis-regulatory elements rather than the gene itself.
[0007] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides wheat TaABA2 Application of uORF genes in improving wheat salt tolerance or breeding salt-tolerant wheat: A1) Improve wheat's salt tolerance; A2) Breed salt-tolerant wheat; Among them, the TaABA2 The gene encodes the protein TaABA2, the amino acid sequence of which is shown in SEQ ID NO: 4. TaABA2 The mRNA sequence of the gene is shown in SEQ ID NO: 1; the uORF element set involves uORF1, uORF3, uORF4, uORF5 and uORF12, and their nucleotide sequences are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively; The inactivation is a mutation of the uORF start codon ATG to ATA, selected from any of the following combinations: (a) The start codons of uORF1, uORF3 and uORF12 mutate simultaneously; (b) The start codons of uORF1 and uORF12 mutate simultaneously; (c) The start codons of uORF1, uORF4, uORF5 and uORF12 mutate simultaneously; (d) The start codons of uORF1, uORF5 and uORF12 mutate simultaneously.
[0008] Furthermore, the deactivation of the function does not change TaABA2 Under the premise of gene transcription level, the uORF element set is deactivated. TaABA2 Gene translation repression, increase TaABA2 The translational expression level of genes enhances the biosynthesis of abscisic acid in wheat.
[0009] Furthermore, the functional inactivation is achieved through a cytosine base editor, which comprises tandemly expressed sgRNAs that target the corresponding uORF start codon regions in the selected combinations.
[0010] Furthermore, the nucleotide sequences of the sgRNA are shown in SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16, respectively.
[0011] Secondly, the present invention provides a method for improving the salt tolerance of wheat, comprising the following steps: [The text abruptly ends here, so the translation stops.] TaABA2 The start codon ATG of the uORF element set of a gene is mutated to ATA in a specific combination to inactivate the function of the uORF element set. The uORF component group includes uORF1, uORF3, uORF4, uORF5, and uORF12. TaABA2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 4. TaABA2 The mRNA sequence of the gene is shown in SEQ ID NO:1, and the nucleotide sequences of uORF1, uORF3, uORF4, uORF5 and uORF12 are shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, respectively. The combination of mutations is selected from any of the following: (a) Simultaneously mutate the start codons of uORF1, uORF3 and uORF12; (b) Simultaneously mutate the start codons of uORF1 and uORF12; (c) Simultaneously mutate the start codons of uORF1, uORF4, uORF5 and uORF12; (d) Simultaneously mutate the start codons of uORF1, uORF5 and uORF12.
[0012] Furthermore, the mutation is achieved using a cytosine base editor (CBE).
[0013] Furthermore, the wheat is preferably a hexaploid common wheat variety, KN199.
[0014] Furthermore, the method for cultivating salt-tolerant wheat also includes: culturing wheat lines obtained through site-directed mutagenesis in a nutrient solution containing 200 mM sodium chloride for 10 days, and selecting plants with root length and plant height that are higher than those of the wild type as the salt-tolerant wheat. Beneficial effects
[0015] (1) This invention discovers the wheat A genome TaABA2 A complex regulatory cluster of 14 uORFs exists in the 5' UTR upstream of the gene, and uORF1, uORF3, uORF4, uORF5, and uORF12 were precisely identified as core elements co-regulating salt tolerance. Their function was inactivated by mutating the start codon ATG to ATA in a specific combination of uORFs, thus achieving salt tolerance without altering the gene's structure. TaABA2 At the transcriptional level, precise upregulation of translation efficiency can improve wheat salt tolerance without affecting normal growth and development.
[0016] (2) This invention provides sgRNA targeting the above 5 uORFs and cytosine base editors containing them, which can efficiently and specifically achieve multi-site combination mutations, providing clear key targets and operable technical solutions for the genetic improvement of wheat salt tolerance. Attached Figure Description
[0017] Picture 1 wheat A genome TaABA2 The structure and editing strategy of the upstream 5'UTR uORF. A is a distribution map of 14 uORFs; B is a mutation sequence map of the 5 selected core sites (g1, g3, g4, g5, g12); C is a schematic diagram of the recombinant vector pMOD_B2103-tRNA.
[0018] Picture 2 for TaABA2 The upstream uORF regulates the expression of downstream genes. A represents different... TaABA2 uORF mutation types have no effect on the transcription level of the gene itself; B represents the effect of different uORF combination mutation types (1&3&12, 1&12, 1&4&5&12, 1&5&12) on the translation efficiency of downstream genes.
[0019] Picture 3 for TaABA2 Upstream uORF mutations do not affect wheat growth and development. A is... TaABA2 Upstream uORF mutations do not affect wheat growth; B is TaABA2 The upstream uORF mutation does not affect the normal grain filling of wheat.
[0020] Picture 4 for TaABA2 Upstream 5'UTR uORFs participate in regulating wheat salt tolerance. A is... TaABA2 Phenotypes of uORF mutants after 10 days of treatment with wild-type wheat KN199 at 200 mM NaCl; B represents the phenotype after 10 days of treatment with 200 mM NaCl. TaABA2Statistical and significance analysis of root length and plant height of uORF mutant and wild-type wheat KN199. Detailed Implementation
[0021] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the scope of protection of the present invention. Experimental methods in the embodiments that do not specify specific conditions are all carried out according to conventional conditions known in the art or conditions recommended by the manufacturer. Unless otherwise specified, the experimental materials used in the embodiments are all purchased from conventional biochemical reagent stores.
[0022] Example 1: Wheat A Genome TaABA2 Prediction and analysis of upstream 5'UTR uORF 1.1 Sequence Acquisition and Homology Alignment Wheat obtained from the wheat genome database (Ensmbl Plants) TaABA2 Gene sequences. Among them, the wheat A genome. TaABA2 ( TraesCS5A02G465100 The mRNA sequence of wheat B genome is shown in SEQ ID NO: 1, and the amino acid sequence of its encoded protein is shown in SEQ ID NO: 4; TaABA2 ( TraesCS5B02G476900 The mRNA sequence of wheat D genome is shown in SEQ ID NO: 2. TaABA2 ( TraesCS5D02G477700 The mRNA sequence of ) is shown in SEQ ID NO:3.
[0023] Homology comparison revealed that wheat... TaABA2 The homologous gene has a total of 3 copies as mentioned above. Further analysis revealed that only the upstream 5' UTR of the A genome homolog contains the predicted 14 uORFs.
[0024] 1.2 uORF Prediction and Editing Target Screening The A genome was analyzed based on the following criteria: the presence of an ATG start codon, the presence of a co-located stop codon, and a base count between the start and stop codons that is a multiple of 3 and a length greater than 3 bp. TaABA2 uORF prediction of the 5'UTR of the gene confirmed that it contains 14 uORFs ( Picture 1 A).
[0025] Further analysis revealed that 7 out of the 14 uORFs contained PAM sequences near their start codons. Based on gene editing accessibility, uORF1, uORF3, uORF4, uORF5, and uORF12 were ultimately identified as the core editing targets, forming a core element set for synergistic regulation of salt tolerance. The nucleotide sequences of uORF1, uORF3, uORF4, uORF5, and uORF12 are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively.
[0026] Example 2 Construction of a multi-target base editor vector 2.1 Design and Synthesis of sgRNA Based on the five uORF target sites identified in Example 1, sgRNAs were designed targeting the ATG region of the start codon for each uORF. The targeting sequences of the sgRNAs are as follows: (1) sgRNA1 targeting uORF1: 5'-CCGGTTTCGCCATGATCTGTCAC -3' (SEQ ID NO: 12); (2) sgRNA3 targeting uORF3: 5'-CCTCTCCAATGGCGCCGGTCGCG -3' (SEQ ID NO: 13); (3) sgRNA4 targeting uORF4: 5'-CCGGTCGCGTGATGCGAGAGGTC-3' (SEQ ID NO: 14); (4) sgRNA targeting uORF5: 5'- CCTAGATTCGAAAACATCATGCT -3' (SEQ ID NO: 15); (5) sgRNA12 targeting uORF12: 5'- CCACATGTAGCTGGGATGAGCAC-3' (SEQ ID NO:16).
[0027] A commercial gene synthesis company was commissioned to synthesize tandem repeat sequences containing gRNA, tRNA-Gly, and gRNA-scaffold.
[0028] 2.2 Construction of Recombinant Vectors The vector pMOD_B2103-tRNA is a publicly available plant genome engineering vector. The synthesized tandem repeat sequence fragment and the vector were double-digested with restriction endonucleases Hind III and Sac I, respectively. After purification and recovery of the digestion products, the target fragment was ligated to the linearized vector backbone using the Gibson assembly method, successfully constructing the recombinant expression vector pMOD_B2103-tRNA-5xgRNA. This recombinant vector can achieve simultaneous and efficient expression of five sgRNAs. Through a single transformation process, utilizing the efficiency differences in base editing at multiple sites, mutant populations containing different uORF deletion combinations can be screened.
[0029] 2.3 Transformation and Identification The ligation product was transformed into *E. coli* DH5α competent cells. The transformed bacterial culture was plated on LB agar containing kanamycin and incubated overnight at 37°C with the culture inverted position. The next day, multiple single colonies were picked and inoculated into LB liquid agar containing the same antibiotic, and cultured with shaking at 37°C and 220 rpm. Plasmid DNA was extracted and sequenced for verification. Clones whose sequencing results were completely consistent with the expected design were selected, and their plasmids were extracted. These were the target vectors that could be used to transform the recipient wheat variety KN199.
[0030] A schematic diagram of the target carrier is shown below. Picture 1 C. The base editor-mediated site-directed mutagenesis involves mutating the start codon ATG to ATA in each uORF. Picture 1 B), thereby causing the uORF to lose its translation initiation function.
[0031] Example 3: Wheat genetic transformation and identification of mutant lines The recombinant vector pMOD_B2103-tRNA-5xgRNA constructed in Example 2 was transformed into the immature embryo callus tissue of wild-type recipient material KN199 wheat using Agrobacterium-mediated transformation. Transgenic plants were obtained after screening, differentiation, and rooting culture. Positive lines were amplified by PCR using primers Primer5F2 and Primer5R (Table 1), and the amplification products were sequenced and identified using Primer5R primers.
[0032] Table 1 Primer sequence listing
[0033] The results showed that by simultaneously editing five core target sites, this embodiment not only obtained multi-site homozygous mutant lines, but also accurately identified and screened four representative core element combination inactivation T0 lines, namely: 1&3&12 combination, 1&12 combination, 1&4&5&12 combination and 1&5&12 combination.
[0034] The T0 lines were planted, and after harvesting T2 generation wheat seeds, they were continued to be grown in a greenhouse. The target fragment was amplified and sequenced using the same primer pairs. T2 generation lines with homozygous mutations in the uORF start codons for each combination were screened and obtained.
[0035] Example 4 TaABA2 Functional validation of upstream 5'UTR uORF cluster regulating downstream gene translation To confirm the impact of uORF mutations on downstream gene expression, this embodiment uses a dual-luciferase reporter system for detection.
[0036] T aABA2 The 5'UTR (wild-type) gene and the mutant 5'UTRs of the aforementioned four uORF mutation combinations (1&3&12, 1&12, 1&4&5&12, 1&5&12) were constructed into a dual-luciferase reporter system, transformed into wheat protoplasts, and the mRNA expression and enzyme activity of LUC / REN were detected. Results showed: (1) Transcription level: qRT-PCR detection confirmed that there was no significant difference in mRNA expression levels between wild type and the four mutant combinations (1&3&12, 1&12, 1&4&5&12, 1&5&12). Picture 2 A) This proves that different combinations of uORF elements do not change the inactivation process. TaABA2 The transcriptional level of genes.
[0037] (2) Translational level: Luciferase activity assays showed that the LUC / REN activity ratios of the four mutant combinations 1&3&12, 1&12, 1&4&5&12, and 1&5&12 were significantly higher than those of the wild type. P < 0.01, Picture 2 B). This indicates that different combinations of deactivating these core uORF components can effectively relieve the downstream... TaABA2 Translation inhibition.
[0038] Example 5 TaABA2 Phenotypic analysis of uORF mutant lines To assess whether the uORF mutations in each combination adversely affect the normal growth and development of wheat, the four mutant lines of the T2 generation were observed throughout their entire growth period. The specific procedures were as follows: the wheat growth conditions were 18℃, 16 h light / 8 h dark; the temperature during the booting stage was adjusted to 25℃, 16 h light / 8 h dark. The results showed that lines 1&3&12, 1&12, 1&4&5&12, and 1&5&12 showed no significant differences compared to the wild-type KN199 in either the vegetative or reproductive growth stages. Picture 3(A, B) proves that the precise editing of these core component combinations does not affect the normal growth and development of wheat.
[0039] Example 6 TaABA2 Salt tolerance phenotype evaluation of uORF mutant lines Salt tolerance was evaluated in four homozygous mutant lines (1&3&12, 1&12, 1&4&5&12, 1&5&12) obtained through screening. The specific procedures were as follows: Mature wheat seeds were harvested and dried at room temperature for one month. Then, the seeds were placed on moistened double-layered filter paper and grown under conditions of 22℃, 16 h light / 8 h darkness. Five-day-old wheat seedlings were subjected to salt stress treatment by immersing their roots in a wheat nutrient solution containing 200 mM NaCl for 10 days. Phenotypic characteristics were then observed and statistical data were collected.
[0040] The results showed that the mutant lines 1&3&12, 1&12, 1&4&5&12 and 1&5&12 all exhibited significant growth advantages under salt stress. Picture 4 A). Statistical data analysis showed that the root length and aboveground height of the four mutant lines were significantly better than those of the wild-type KN199. P < 0.05, Picture 4 B).
[0041] In summary, this invention is the first to discover and confirm the wheat A genome. TaABA2 The uORF1, uORF3, uORF4, uORF5, and uORF12 molecules in the upstream 5' UTR of the gene constitute a core module that synergistically regulates salt tolerance. When the start codon ATG of the corresponding uORF is mutated to ATA in a combinatorial manner to inactivate its function, precise upregulation can be achieved without affecting transcriptional levels or normal growth and development. TaABA2 This invention significantly enhances wheat's tolerance to salt stress by improving translation efficiency. It provides a clear multi-target combination and a feasible gene editing technology solution for breeding new salt-tolerant wheat varieties.
Claims
1. Wheat TaABA2 Application of inactivation of the uORF element set of genes in at least one of the following: A1) Improve wheat's salt tolerance; A2) Breed salt-tolerant wheat; The TaABA2 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO:
4. TaABA2 The mRNA sequence of the gene is shown in SEQ ID NO: 1; the uORF element set is uORF1, uORF3, uORF4, uORF5 and uORF12, and their nucleotide sequences are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The inactivation is a mutation of the uORF start codon ATG to ATA, selected from any of the following combinations: (a) The start codons of uORF1, uORF3 and uORF12 mutate simultaneously; (b) The start codons of uORF1 and uORF12 mutate simultaneously; (c) The start codons of uORF1, uORF4, uORF5 and uORF12 mutate simultaneously; (d) The start codons of uORF1, uORF5 and uORF12 mutate simultaneously.
2. The application according to claim 1, characterized in that, The function is deactivated without changing TaABA2 Under the premise of gene transcription level, the uORF element set is deactivated. TaABA2 Gene translation repression, increase TaABA2 Increased gene expression levels enhance the biosynthesis of abscisic acid in wheat.
3. The application according to claim 1 or 2, characterized in that, The inactivation of the function is achieved by a cytosine base editor, which contains tandemly expressed sgRNAs that target the start codon regions of the corresponding uORFs in the selected combinations, and mutate the start codon ATG of the corresponding uORF to ATA.
4. The application according to claim 3, characterized in that, The nucleotide sequence of the sgRNA is selected from SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, which correspond to the uORF in the selected combination.
5. A method for improving the salt tolerance of wheat, characterized in that, The steps include: [The text abruptly ends here, likely due to an incomplete sentence or a formatting error.] TaABA2 The start codon ATG of the uORF element set of a gene is mutated to ATA in a combinatorial manner to inactivate the uORF element set. The uORF component group consists of uORF1, uORF3, uORF4, uORF5, and uORF12; TaABA2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 4; TaABA2 The mRNA sequence of the gene is shown in SEQ ID NO: 1; the nucleotide sequences of uORF1, uORF3, uORF4, uORF5 and uORF12 are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The combination is selected from any one of the following (a) to (d): (a) Simultaneously mutate the start codons of uORF1, uORF3 and uORF12; (b) Simultaneously mutate the start codons of uORF1 and uORF12; (c) Simultaneously mutate the start codons of uORF1, uORF4, uORF5 and uORF12; (d) Simultaneously mutate the start codons of uORF1, uORF5 and uORF12.
6. The method according to claim 5, characterized in that, The function is deactivated without changing TaABA2 Under the premise of gene transcription level, the uORF element set is deactivated. TaABA2 Gene translation repression, increase TaABA2 The translational expression level of genes enhances the biosynthesis of abscisic acid in wheat.
7. The method according to claim 5 or 6, characterized in that, The mutations are achieved using a cytosine base editor, which contains tandemly expressed sgRNAs that target the corresponding uORF start codon regions in the selected combinations.
8. The method according to claim 7, characterized in that, The nucleotide sequence of the sgRNA is selected from SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16, which correspond to the uORF in the selected combination.
Citation Information
Patent Citations
Application of uORF in upstream non-coding region of ABA2 gene in regulation of crop agronomic traits
CN121699992A