Nwd2 gene 6_57554735 locus snp marker related to lambing number and application thereof

Abstract

This invention relates to the field of animal molecular breeding technology, specifically providing a method related to litter size. NWD2 The SNP marker at locus 6_57554735 and its application. The SNP marker is a G / T mutation at locus 57554735 on chromosome 6 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0. Using the SNP molecular marker provided by this invention, lambing numbers in sheep can be identified, and selective breeding can be carried out based on environmental adaptability.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method related to lambing numbers. NWD2 SNP marker at gene 6_57554735 and its application. Background Technology

[0002] The number of lambs born is the number of sheep ( Ovis aries One of the important economic traits in production, it directly affects the reproductive efficiency of ewes, the number of lambs produced, and the economic benefits of farms. The Small-tailed Han sheep is an important high-fertility sheep breed in my country, characterized by early sexual maturity, good reproductive performance, and a high lambing rate. It is an important genetic resource for studying the genetic basis of sheep fertility and conducting molecular breeding for high fertility.

[0003] Lamb number is a complex quantitative trait, influenced by a combination of factors including genetics, population structure, feeding environment, and reproductive management. Relying solely on phenotypic records for breeding is time-consuming, costly, and its accuracy is easily affected by environmental factors. Therefore, developing molecular markers that are stably associated with lamb number or reproductive traits in sheep is of great significance for improving the efficiency of sheep reproductive breeding.

[0004] With the development of genome-wide association studies and molecular marker detection technologies, screening candidate loci associated with reproductive traits using population genotype data and further developing SNP molecular markers applicable to production practices has become an important direction in sheep molecular breeding. KASP genotyping technology has advantages such as ease of operation, high throughput, low cost, and stable results, making it suitable for population validation of candidate SNP loci and marker-assisted selection.

[0005] Currently, marker-assisted selection can be directly applied to the trait of lambing number in sheep. NWD2 There are still relatively few SNP markers in gene regions. To improve the breeding efficiency of sheep reproductive traits, it is necessary to screen and validate traits related to litter size. NWD2 To establish a stable, accurate, and practical molecular detection method for SNP sites in gene regions, suitable for actual production applications. Summary of the Invention

[0006] The main objective of this invention is to provide a SNP molecular marker related to lambing number. Using this SNP molecular marker, gene selection can be performed precisely, thereby efficiently breeding sheep with ideal lambing numbers, thus overcoming the technical deficiency of the prior art in lacking SNP molecular markers directly related to lambing number in sheep.

[0007] To achieve the above objectives, the present invention provides the following technical solution: The first aspect of this invention provides an SNP molecular marker that affects lambing numbers in sheep. The SNP molecular marker is a G / T mutation at locus 57554735 on chromosome 6 of the sheep reference genome GCF_016772045.1_ARS-UI_Ramb_v2.0. When the genotype of the polymorphic site of the SNP molecular marker is TT, the sheep has a high lambing number; when the genotype is GT, the sheep has a low lambing number.

[0008] A second aspect of the present invention provides a primer set for an SNP molecular marker, the primer set comprising: a forward primer F1 with the nucleotide sequence shown in SEQ ID NO. 1, a forward primer F2 with the nucleotide sequence shown in SEQ ID NO. 2, and a reverse primer R with the nucleotide sequence shown in SEQ ID NO. 3.

[0009] Furthermore, the physical location of the SNP molecular marker is based on the locus at position 57554735 on chromosome 6 of sheep reference genome version GCF_016772045.1_ARS-UI_Ramb_v2.0, which has a polymorphism of G / T.

[0010] Furthermore, the 5' end of the forward primer F1 is linked to the FAM-tail universal fluorescent tag sequence, and the 5' end of the forward primer F2 is linked to the HEX-tail universal fluorescent tag sequence.

[0011] A third aspect of the present invention provides a detection kit containing the said primer set.

[0012] The fourth aspect of the present invention provides any of the following applications of the above-described primer set and the above-described detection kit: (1) Application in determining the number of lambs born in sheep; (2) Application in molecular marker-assisted breeding of sheep.

[0013] The fifth aspect of the present invention provides a method for identifying the number of lambs born in sheep, the method comprising: using the DNA of the sheep to be tested as a template, performing PCR amplification on it using the primer set; directly distinguishing genotypes and the correlation between the genotypes and the number of lambs born in sheep by fluorescence signals, thereby identifying the number of lambs born in sheep.

[0014] In a preferred embodiment, individuals with the TT genotype can be retained, selected for mating, or expanded for validation as candidates with high average litter size potential; individuals with the GT genotype can be managed as individuals with average or low average litter size potential. Since the GG genotype was not detected in this batch of validation samples, the relationship between the GG genotype and litter size needs further evaluation after expanding the sample size. In practical applications, a comprehensive judgment should be made considering individual breeding records, kinship, and population background.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides for the first time a location in sheep NWD2 The SNP molecular marker 6_57554735 (G / T polymorphism) within the gene region is significantly associated with litter size and fertility traits in small-tailed Han sheep, and can serve as a candidate marker for marker-assisted selection of sheep fertility. Based on this marker, this invention further established a KASP genotyping method and designed a specific primer combination (SEQ ID NO: 1-3). This method is simple to operate, has high throughput, low cost, and stable results, with a genotyping accuracy of 100% (successfully genotyped samples are consistent with the original genotype). In a validation sample of 40 small-tailed Han sheep, the KASP genotyping call rate reached 95.0%, and the difference in average litter size between the TT and GT genotypes reached a significant level (one-way ANOVA P=0.0158, Kruskal test P=0.0193, Welch t test P=0.008735). It should be noted that litter size is a complex quantitative trait with low heritability, and the explanatory power of a single molecular marker for phenotype is usually limited. In this invention, the average litter size of individuals with the T / T genotype is higher than that of individuals with the G / T genotype, with mean values ​​of 2.1725 and 1.5000, respectively, a difference of approximately 0.67 lambs. The median is 2.00 for the T / T group and 1.25 for the G / T group. Based on a descriptive comparison of the median, the T / T group is approximately 60% higher than the G / T group. By cumulatively selecting individuals with the TT genotype, continuous and stable improvement of the average litter size can be achieved over several generations in large-scale breeding populations, demonstrating clear economic value and breeding application prospects. Furthermore, the SNP markers, primer combinations, detection methods, and kits provided in this invention offer reliable technical means for early screening of high fertility traits in Small-tailed Han sheep, breeding sheep selection, and population genetic improvement, effectively overcoming the shortcomings of traditional phenotypic selection methods, which have long cycles and are easily affected by environmental factors. Attached Figure Description

[0016] Figure 1 for NWD2 KASP genotyping clustering diagram of gene locus 6_57554735. Green circles represent samples with genotype GT; blue circles represent samples with genotype TT; pink circles represent samples for which no clear genotyping result was obtained.

[0017] Figure 2 for NWD2 A significant association analysis plot between the KASP genotype at gene locus 6_57554735 and the average number of lambs per litter phenotype. The horizontal axis represents the average number of lambs per litter, and the vertical axis represents the KASP genotype. The average number of lambs per litter was calculated at the individual level, with each sheep calculating its own average number of lambs per litter based on its existing parity records. Detailed Implementation

[0018] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0019] Example 1: Detection of lambing number using the SNP molecular marker chr6:57554735 Experimental subjects: A total of 40 small-tailed Han sheep were selected.

[0020] SNP molecular marker detection: (1) Collect 5 mL of venous blood from the sheep to be tested, extract genomic DNA by magnetic bead method, and dilute the DNA to 20 ng / μL; dilute the primers to 100 μmol / L; mix forward primer F1, forward primer F2, reverse primer R and water in the ratio of F1:F2:R:water=24:24:48:100 to obtain SNP Primer Mix.

[0021] The primer sequences are as follows: Forward primer F1 (SEQ ID NO:1): GAAGGTCGGAGTCAACGGATTGACTCGTTCGGTTCTGAGGC; Forward primer F2 (SEQ ID NO:2): GAAGGTGACCAAGTTCATGCTTGACTCGTTCGGTTCTGAGGA; Reverse primer R (SEQ ID NO:3): CAGCCCCATCACCGTGAGT.

[0022] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using the specific primers of the SNP molecular marker. The amplification system is shown in Table 1 and the amplification program is shown in Table 2. The PCR products were obtained. Table 1 PCR amplification system

[0023] Table 2 PCR amplification program

[0024] (3) After the PCR amplification cycle is completed, the fluorescence signal is read using a real-time PCR instrument or a compatible fluorescence reading device at an environment below 40°C, and the fluorescence clustering results are analyzed using the LGC OMEGA genotype reading software Kluster Caller.

[0025] (4) In this embodiment, among the 40 verification samples, based on the fluorescence clustering positions of the samples, NWD2 The genotype at gene locus 6_57554735 was divided into two types: GT and TT. 38 samples successfully obtained clear KASP genotyping results, including 28 with the TT genotype and 10 with the GT genotype. Two samples did not obtain clear genotyping results and were marked as "-". The GG genotype was not detected in this batch of samples. The KASP marker identification results of 40 Small-tailed Han sheep are shown in Table 3.

[0026] Table 3. KASP marker identification results in 40 Small-tailed Han sheep.

[0027] The KASP genotyping results of 40 validation samples were compared with the original sequencing / filler genotypes for consistency. The results showed that 38 samples with clear KASP genotyping results were consistent with the original sequencing / filler genotypes, achieving a 100% consistency rate; samples without clear genotyping results were marked "-" and not included in the consistency statistics. These results indicate that the KASP genotyping method at this locus has good accuracy and can be used for subsequent population detection and marker-assisted selection.

[0028] Example 2: Distribution of lambing numbers in individuals with different genotypes and its application in judgment Statistical and significant association analyses were performed on 38 samples that successfully obtained clear KASP typing and had records of average litter size. The results showed that... NWD2 Significant differences were found in the mean number of lambs phenotype at gene locus 6_57554735 among individuals with different genotypes, with 28 individuals of the TT genotype and 10 individuals of the GT genotype. One-way ANOVA yielded a P=0.0158 result, and Kruskal's test showed a P=0.0193 result, indicating a significant correlation between the KASP genotype and the mean number of lambs phenotype at this locus. Pairwise comparisons were performed using Welch's t-test, and a significant difference was found between the TT and GT genotypes (0.008735, **). Figure 2 As shown in the distribution, the average number of lambs born to individuals with the TT genotype is generally more skewed towards the higher range, with a distribution range of up to 4; individuals with the GT genotype are mainly distributed in the lower to middle range, and are generally lower than the TT group.

[0029] Table 4 NWD2Significant association analysis between different KASP genotypes at gene locus 6_57554735 and the average number of lambs per litter phenotype.

[0030] Given that the significance results in this embodiment mainly come from the comparison between the TT and GT genotypes, this invention is primarily based on the significant differences between the TT and GT genotypes, the overall genotype distribution trend, and the accuracy and reproducibility of the KASP genotyping results. NWD2 The 6_57554735 locus of the gene is a candidate marker for molecular marker-assisted selection of lambing number in small-tailed Han sheep.

[0031] In practical breeding applications, blood, ear tissue, or other samples suitable for extracting genomic DNA from the small-tailed Han sheep to be tested can be collected, and the primer combination and KASP typing method described in this invention can be used for detection. NWD2 Genotype at locus 6_57554735. For individuals with the TT genotype, their reproductive records, kinship, population background, and production management conditions can be considered to prioritize their retention, selection, or expansion for verification as individuals with high potential for average litter size. For individuals with the GT genotype, routine management can be implemented based on actual reproductive records.

Claims

1. The application of reagents for detecting SNP molecular markers in the determination of lambing numbers in Small-tailed Han sheep, characterized in that, The physical location of the SNP molecular marker is based on the locus at position 57554735 on chromosome 6 of sheep reference genome version GCF_016772045.1_ARS-UI_Ramb_v2.0, and the polymorphism of this locus is G / T. When the genotype at the locus is TT, the lambing rate of the Small-tailed Han sheep is high; when the genotype is GT, the lambing rate of the Small-tailed Han sheep is low.

2. The application according to claim 1, characterized in that, The reagent is a primer set, including: forward primer F1 with the nucleotide sequence shown in SEQ ID NO. 1, forward primer F2 with the nucleotide sequence shown in SEQ ID NO. 2, and reverse primer R with the nucleotide sequence shown in SEQ ID NO.

3.

3. A method for determining the number of lambs born in a Small-tailed Han sheep, characterized in that, The method includes: using the DNA of the small-tailed Han sheep to be tested as a template, performing PCR amplification with the primer set described in claim 2, and directly identifying the number of lambs born by distinguishing the genotype of the SNP molecular marker described in claim 1 through fluorescence signal. When the genotype is TT, the small-tailed Han sheep have a high lambing rate; when the genotype is GT, the small-tailed Han sheep have a low lambing rate.

Images