A molecular marker located on chromosome 7 associated with pig body size and carcass traits and application thereof

Abstract

The present application relates to the field of molecular markers and animal genetic breeding technology, in particular to a molecular marker related to pig body size and carcass traits on chromosome 7 and application thereof. The present application takes the chimeric family F7 generation as the research object, adopts whole genome resequencing and GWAS analysis, studies and determines the molecular marker related to pig body size and carcass traits on chromosome 7, and through the optimization of the dominant alleles of the above-mentioned molecular marker, the frequency of the dominant alleles can be increased generation by generation, the growth-related traits can be improved, the progress of pig genetic improvement can be accelerated, and thus the economic benefits of pig breeding can be effectively improved.

Description

Technical Field

[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, and in particular to a molecular marker located on chromosome 7 that is associated with pig body size and carcass traits and its application. Background Technology

[0002] Body size and carcass traits are core indicators for evaluating pig production performance and directly impact the economic benefits of pig farming. Body size traits include body length, carcass straight length, carcass oblique length, bone length and diameter, etc.; carcass traits include carcass weight, visceral weight, and muscle weight, etc. These traits encompass both skeletal and carcass development during growth and key indicators reflecting meat production performance after slaughter. Body size and carcass traits jointly influence a pig's meat production capacity, feed conversion efficiency, and the quality and commercial value of the final product. In modern intensive pig farming, even small genetic advances in these economic traits can lead to significant economic benefits through population accumulation. Therefore, continuous improvement of body size and carcass traits has become an important technical path and breeding goal for promoting high-quality development of the pig breeding industry and enhancing the competitiveness of core breeding stock.

[0003] With the rapid development of molecular biology and genomics technologies, marker-based genetic improvement methods (genome-wide selection and marker-assisted selection) have become an indispensable part of modern pig breeding systems. These methods offer significant advantages in terms of economy, speed, and efficiency, enabling early selection of target traits, shortening generation intervals, and increasing selection intensity, thereby significantly improving genetic progress. In particular, single nucleotide polymorphism (SNP) markers, due to their wide distribution in the genome, stability, heritability, and ease of detection, have become the core tool of marker-assisted selection, providing a novel technological pathway for the precise improvement of pig growth traits.

[0004] Body size and carcass traits are typical quantitative traits, controlled by multiple genes and easily influenced by the environment. Traditional breeding methods struggle to accurately analyze their complex genetic structure. Genome-wide association analysis (GWAS), as a highly efficient tool for elucidating the genetic basis of complex traits, provides strong technical support for identifying key molecular markers or loci influencing body size and carcass traits in pigs. GWAS can utilize high-density SNP markers to scan loci significantly associated with body size and carcass traits at the whole-genome level, thereby systematically identifying quantitative trait loci controlling skeletal development, muscle growth, and fat deposition, laying a theoretical foundation for overcoming the selection limits of traditional breeding. Using molecular markers discovered through GWAS for marker-assisted selection or genomic selection can significantly shorten generation intervals and improve selection accuracy, especially for carcass traits that can only be accurately measured after slaughter (such as carcass weight and muscle weight).

[0005] However, despite the identification of several candidate genes associated with body length and other traits in pigs by GWAS studies in recent years, causal evidence remains scarce. To date, only a limited number of genes (such as VRTN and NR6A1) have been functionally validated as determinants of body length and other traits in pigs. The genetic structure of pigs and the cellular and molecular regulatory mechanisms controlling their body size are still not fully understood. Therefore, research into molecular markers or loci influencing body size and carcass traits in pigs and their potential for improvement in breeding populations is of great significance to the production and economic benefits of pig farming. Summary of the Invention

[0006] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a molecular marker located on chromosome 7 that is associated with pig body size and carcass traits.

[0007] Another object of the present invention is to provide applications of the above-mentioned molecular markers.

[0008] Another object of the present invention is to provide an application for detecting the above-mentioned molecular markers in a product.

[0009] A fourth objective of this invention is to provide a method for identifying pig body size and / or carcass traits.

[0010] The fifth object of the present invention is to provide a method for genetic improvement of pigs.

[0011] The objective of this invention is achieved through the following technical solution:

[0012] A molecular marker located on chromosome 7 and associated with pig body size and carcass traits, comprising at least one of molecular markers (I)-(X), wherein the location and variation information of the mutation sites corresponding to the molecular markers are as follows:

[0013] (I) The mutation site corresponds to the G>A mutation at nucleotide position 30,294,745 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0014] (II) The mutation site corresponds to the T>C mutation at nucleotide position 30,294,877 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0015] (III) The mutation site corresponds to the CGGCT>CGCT mutation at nucleotide positions 30320365-30320369 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence;

[0016] (IV) The mutation site corresponds to the C>A mutation at nucleotide position 30,332,972 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0017] (V) The mutation site corresponds to the G>A mutation at nucleotide position 30335465 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0018] (VI) The mutation site corresponds to the T>A mutation at nucleotide position 30,415,226 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0019] (VII) The mutation site corresponds to the G>A mutation at nucleotide position 30300384 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0020] (VIII) The mutation site corresponds to the C>T mutation at nucleotide position 30,337,096 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0021] (IX) The mutation site corresponds to the C>A mutation at nucleotide position 30,336,982 on chromosome 7 of the international pig genome version 11.1 reference sequence;

[0022] (X) The mutation site corresponds to the AACAATTAT>A mutation at nucleotide positions 30443032-30443040 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence;

[0023] The molecular marker may also include a linkage disequilibrium degree r with at least one of the molecular markers (I) to (X). 2 Molecular markers ≥0.8.

[0024] For molecular marker (Ⅰ), its nucleotide sequence is preferably as shown in SEQ ID NO:1, wherein M in the sequence is G or A, and its mutation site is the G101-A101 nucleotide mutation at position 101 of the sequence marked in SEQ ID NO:1.

[0025] For molecular marker (II), its nucleotide sequence is preferably as shown in SEQ ID NO:2, wherein M in the sequence is T or C, and its mutation site is the T101-C101 nucleotide mutation at position 101 of the sequence marked in SEQ ID NO:2.

[0026] For molecular marker (Ⅲ), its nucleotide sequence is preferably as shown in SEQ ID NO:3, where M in the sequence is CGGCT or CGCT, and its mutation site is the nucleotide mutation of CGGCT55_59-CGCT55_59 at position 55-59 of the sequence marked in SEQ ID NO:3.

[0027] For molecular marker (Ⅳ), its nucleotide sequence is preferably as shown in SEQ ID NO:4, wherein M in the sequence is C or A, and its mutation site is the nucleotide mutation of C101-A101 at position 101 of the sequence label in SEQ ID NO:4;

[0028] For the molecular marker (V), its nucleotide sequence is preferably as shown in SEQ ID NO:5, wherein M in the sequence is G or A, and its mutation site is the G178-A178 nucleotide mutation at position 178 of the sequence label in SEQ ID NO:5.

[0029] For the molecular marker (VI), its nucleotide sequence is preferably as shown in SEQ ID NO:6, wherein M in the sequence is T or A, and its mutation site is the T101-A101 nucleotide mutation at position 101 of the sequence label in SEQ ID NO:6.

[0030] For the molecular marker (VII), its nucleotide sequence is preferably as shown in SEQ ID NO:7, wherein M in the sequence is G or A, and its mutation site is the G101-A101 nucleotide mutation at position 101 of the sequence label in SEQ ID NO:7.

[0031] For the molecular marker (VIII), its nucleotide sequence is preferably as shown in SEQ ID NO:8, wherein M in the sequence is C or T, and its mutation site is the C50-T50 nucleotide mutation at position 50 of the sequence label in SEQ ID NO:8.

[0032] For the molecular marker (IX), its nucleotide sequence is preferably as shown in SEQ ID NO:9, wherein M in the sequence is C or A, and its mutation site is the nucleotide mutation of C101-A101 at position 101 of the sequence label in SEQ ID NO:9.

[0033] For the molecular marker (X), its nucleotide sequence is preferably as shown in SEQ ID NO:10, where M in the sequence is AACAATTAT or A, and its mutation site is the nucleotide mutation of AACAATTAT102_110-A102_110 at the sequence marker position 102-110 in SEQ ID NO:10.

[0034] The aforementioned body size characteristics include body length, straight carcass length, oblique carcass length, total cervical vertebrae length, femur length, and canal circumference.

[0035] The carcass characteristics mentioned include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, and small intestine length.

[0036] The application of the molecular markers located on chromosome 7 that are associated with pig body size and carcass traits includes at least one of the following (1)-(6):

[0037] (1) Identify the body size and / or carcass characteristics of pigs;

[0038] (2) Prepare products for identifying pig body size traits and / or carcass traits;

[0039] (3) Select pigs with excellent body size and / or carcass traits;

[0040] (4) Prepare products for screening pigs with excellent body size and / or carcass traits;

[0041] (5) Genetic breeding of pig body size and / or carcass traits;

[0042] (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits.

[0043] The application of a product for detecting molecular markers located on chromosome 7 associated with pig body size and carcass traits, the application comprising at least one of the following (1)-(6):

[0044] (1) Identify the body size and / or carcass characteristics of pigs;

[0045] (2) Prepare products for identifying pig body size traits and / or carcass traits;

[0046] (3) Select pigs with excellent body size and / or carcass traits;

[0047] (4) Prepare products for screening pigs with excellent body size and / or carcass traits;

[0048] (5) Application in the genetic breeding of pig body size traits and / or carcass traits;

[0049] (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits.

[0050] The products described for detecting molecular markers located on chromosome 7 that are associated with pig body size and carcass traits include reagents, kits, chips, or detection devices.

[0051] The reagent comprises primer pairs or probes, wherein the primer pairs are used to amplify nucleic acid fragments containing the above-mentioned mutation sites, and the probes are able to specifically recognize and bind to the nucleic acid sequences of the mutation sites. Different probes carrying different labeling groups (e.g., fluorescent groups) can be designed to correspond to different genotypes of the above-mentioned mutation sites, thereby achieving genotyping detection.

[0052] The primer pairs preferably include at least one of the following primer pairs: primer-F1 and primer-R1, primer-F2 and primer-R2, primer-F3 and primer-R3, primer-F4 and primer-R4, primer-F5 and primer-R5, primer-F6 and primer-R6, primer-F7 and primer-R7, primer-F8 and primer-R8, primer-F9 and primer-R9, and primer-F10 and primer-R10, with nucleotide sequences as shown in SEQ ID NO:11-30.

[0053] The kit contains the aforementioned primer pairs or probes, and preferably also contains reaction buffers, etc.

[0054] The chip uses a solid-phase carrier to fix the primer pairs or probes to achieve high-throughput detection.

[0055] The aforementioned detection equipment is compatible with the detection process of the above-mentioned reagents, kits, and chips, and completes signal acquisition, genotype interpretation, and result output.

[0056] A method for identifying body size and / or carcass traits in pigs, comprising the following steps:

[0057] The above-mentioned molecular markers in pigs were detected, and the body size and / or carcass traits of the pigs were determined based on the mutation sites of the molecular markers:

[0058] For (I), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,294,745th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, G / A and G / G genotypes.

[0059] For (II), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,294,877th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: C / C, T / C and T / T genotypes.

[0060] For (III), the pig body size or carcass traits, from best to worst, are ordered by the genotypes at nucleotide sites 30320365-30320369 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: CGCT / CGCT, CGGCT / CGCT and CGGCT / CGGCT.

[0061] For (Ⅳ), the pig body size or carcass traits, from best to worst, are ordered by the genotype at nucleotide position 30,332,972 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, C / A and C / C genotypes;

[0062] For (V), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,335,465th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, G / A, and G / G genotypes.

[0063] For (VI), the pig body size or carcass traits, from best to worst, are ordered by the genotype at nucleotide 30,415,226 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, T / A, and T / T genotypes.

[0064] For (VII), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30300384th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, G / A, and G / G genotypes.

[0065] For (VIII), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,337,096th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: T / T, C / T, and C / C genotypes.

[0066] For (IX), the pig body size or carcass traits, from best to worst, are ordered by the genotype at nucleotide position 30,336,982 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, C / A, and C / C genotypes.

[0067] For (X), the pig body size or carcass traits, from best to worst, are ordered by the genotypes at nucleotide sites 30443032-30443040 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, AACAATTAT / A, and AACAATTAT / AACAATTAT genotypes.

[0068] The detection method includes the following steps:

[0069] (1) Extract genomic DNA from the pigs to be tested;

[0070] (2) Using the above primer pair as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products;

[0071] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0072] (4) Determine the genotype based on the sequencing results.

[0073] A method for genetic improvement of pigs, comprising the following steps:

[0074] Identify the aforementioned molecular markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on these molecular markers:

[0075] For (I), in the core breeding pig population, select breeding pig individuals with the A / A or G / A genotype at nucleotide position 30,294,745 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this locus generation by generation; prioritize breeding pig individuals with the A / A genotype, and cull breeding pig individuals with the G / A and G / G genotypes to increase the frequency of allele A at this locus generation by generation;

[0076] For (II), in the core breeding pig population, select breeding pig individuals with the C / C or T / C genotype at nucleotide position 30,294,877 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the T / T genotype to increase the frequency of allele C at this locus generation by generation; prioritize breeding pig individuals with the C / C genotype, and cull breeding pig individuals with the T / C and T / T genotypes to increase the frequency of allele C at this locus generation by generation;

[0077] For (III), in the core breeding pig population, select breeding pig individuals with the CGCT / CGCT or CGGCT / CGCT genotype at nucleotide sites 30320365-30320369 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the CGGCT / CGGCT genotype to increase the frequency of the CGCT allele at this site generation by generation; preferably select breeding pig individuals with the CGCT / CGCT genotype, and cull breeding pig individuals with the CGGCT / CGCT and CGGCT / CGGCT genotypes to increase the frequency of the CGCT allele at this site generation by generation;

[0078] For (IV), in the core breeding pig population, select breeding pig individuals with the A / A or C / A genotype at nucleotide position 30,332,972 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the C / C genotype to increase the frequency of allele A at this locus generation by generation; prioritize breeding pig individuals with the A / A genotype, and cull breeding pig individuals with the C / A and C / C genotypes to increase the frequency of allele A at this locus generation by generation;

[0079] For (V), in the core breeding pig population, select breeding pig individuals with the A / A or G / A genotype at nucleotide position 30335465 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this locus generation by generation; prioritize breeding pig individuals with the A / A genotype, and cull breeding pig individuals with the G / A and G / G genotypes to increase the frequency of allele A at this locus generation by generation;

[0080] For (VI), in the core breeding pig population, select breeding pig individuals with the A / A or T / A genotype at nucleotide position 30415226 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the T / T genotype to increase the frequency of allele A at this locus generation by generation; prioritize breeding pig individuals with the A / A genotype, and cull breeding pig individuals with the T / A and T / T genotypes to increase the frequency of allele A at this locus generation by generation;

[0081] For (VII), in the core breeding pig population, select breeding pig individuals with the A / A or G / A genotype at nucleotide position 30300384 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this locus generation by generation; prioritize breeding pig individuals with the A / A genotype, and cull breeding pig individuals with the G / A and G / G genotypes to increase the frequency of allele A at this locus generation by generation;

[0082] For (VIII), in the core breeding pig population, select breeding pig individuals with the T / T or C / T genotype at nucleotide position 30,337,096 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the C / C genotype to increase the frequency of the T allele at this locus generation by generation; preferably select breeding pig individuals with the T / T genotype, and cull breeding pig individuals with the C / T and C / C genotypes to increase the frequency of the T allele at this locus generation by generation;

[0083] For (IX), in the core breeding pig population, select breeding pig individuals with the A / A or C / A genotype at nucleotide position 30,336,982 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the C / C genotype to increase the frequency of allele A at this locus generation by generation; prioritize breeding pig individuals with the A / A genotype, and cull breeding pig individuals with the C / A and C / C genotypes to increase the frequency of allele A at this locus generation by generation;

[0084] For (X), in the core breeding population, select breeding pigs with the genotype A / A or AACAATTAT / A at nucleotide sites 30443032-30443040 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pigs with the AACAATTAT / AAACAATTAT genotype to increase the frequency of allele A at this site generation by generation; preferably select breeding pigs with the A / A genotype, and cull breeding pigs with the AACAATTAT / A and AACAATTAT / AAACAATTAT genotypes to increase the frequency of allele A at this site generation by generation.

[0085] The pigs are Western pig breeds, subspecies of pigs, or synthetic lines or hybrid groups containing Western pig breeds and / or subspecies of pig blood.

[0086] The pigs mentioned can be Duroc, Landrace, Large White, Pietrain, Erhualian, Laiwu, Bama miniature pig, Tibetan pig or their synthetic lines or hybrid groups.

[0087] The pigs mentioned are F7 generation individuals of chimeric families bred from Duroc pigs, Landrace pigs, Large White pigs, Pietrain pigs, Erhualian pigs, Laiwu pigs, Bama miniature pigs, and Tibetan pigs.

[0088] The present invention has the following advantages and effects compared with the prior art:

[0089] This invention uses F7 individuals from chimeric families bred from four typical Western pig breeds (Duroc, Landrace, Large White, and Pietrain) and four typical Asian pig breeds (Erhualian, Laiwu, Bama Xiang, and Tibetan pigs) as research subjects. Using pig whole-genome resequencing and GWAS analysis, 10 molecular markers that significantly affect pig body size and carcass traits were studied and identified. At least one of the molecular markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for corresponding genetic improvement.

[0090] (2) Based on molecular markers related to pig body size and carcass traits, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including products such as primers and kits for detecting the molecular markers, methods for identifying pig body size traits and / or carcass traits, methods for genetic improvement of pigs, etc. When applied to the genetic improvement of pig body size traits and / or carcass traits, it can quickly and accurately select and breed body size traits and / or carcass traits, significantly accelerating the breeding process.

[0091] (3) By selecting the superior alleles of the above molecular markers, the present invention can increase the frequency of superior alleles generation by generation, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of breeding pigs. Attached Figure Description

[0092] Figure 1This is a Manhattan plot of body size and carcass traits (taking cannula circumference as an example) on chromosome 7 of pigs; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log10 (P-value) corresponding to the molecular marker site.

[0093] Figure 2 This is a box plot of different genotypes at the g.30332972 locus in body size traits (including body length, straight carcass length, oblique carcass length, cannon bone circumference, total cervical vertebra length, and femur length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.

[0094] Figure 3 This is a box plot of different genotypes at the g.30332972 locus in the carcass traits (including body weight, head weight, hind leg weight, carcass weight, biceps brachii length, and biceps brachii weight) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.

[0095] Figure 4 This is a box plot of different genotypes at the g.30332972 locus in the carcass traits (including heart weight, liver weight, lung weight, kidney weight, and small intestine length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.

[0096] Figure 5 This is a box plot of different genotypes at the g.30294745 locus in body size traits (including body length, straight carcass length, oblique carcass length, cannon bone circumference, total cervical vertebra length, and femur length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.

[0097] Figure 6 This is a box plot of different genotypes at the g.30294745 locus in the carcass traits (including body weight, head weight, hind leg weight, carcass weight, biceps brachii length, and biceps brachii weight) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.

[0098] Figure 7 This is a box plot of different genotypes at the g.30294745 locus in the carcass traits (including heart weight, liver weight, lung weight, kidney weight, and small intestine length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual. Detailed Implementation

[0099] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0100] Example 1

[0101] 1. Experimental pig herd

[0102] The experimental pig population used in this invention was: F7 generation individuals from a chimeric family (Ji J, Zhou L, Huang Y, Zheng M, Liu X, Zhang Y, Huang C, Peng S, Zeng Q, Zhong L, Yang B, Li W, Xiao S, Ma J, Huang L. A whole-genome sequence based association study on porkeating quality traits and cooking loss in a specially designed heterogeneous F6 pig population. Meat Sci. 2018 Dec;146:160-167. doi: 10.1016 / j.meatsci.2018.08.013. Epub 2018 Aug 23. PMID: 30153624.) (Yang, H., Wu, J., Huang, X. et al. ABO genotype alters the gut microbiota by regulating GalNAclevels in pigs. Nature 606, 358–367 (2022). https: / / doi.org / 10.1038 / s41586-022-04769-z (bred from four typical Western pig breeds (Duroc, Landrace, Large White, and Pietrain) and four typical Asian pig breeds (Erhualian, Laiwu, Bama Xiang, and Tibetan), totaling 671 pigs.

[0103] 2. Phenotypic determination

[0104] The 240-day weight is the weight measured when the pigs are 240 days old. Pigs are fasted for 20 hours before slaughter but have free access to water. The entire slaughter process is carried out according to standard commercial procedures. Pre-slaughter measurements include individual live body length and cannon bone circumference. Live body length is measured using a tape measure along the backline to the tail root, from the midpoint of the line connecting the bases of the pig's ears. Cannon bone circumference refers to the circumference of the left hind leg, measured with a tape measure. Post-slaughter measurements include: straight carcass length (from the midpoint of the anterior edge of the pubic symphysis to the midpoint of the anterior edge of the first cervical vertebra); oblique carcass length (from the midpoint of the anterior edge of the pubic symphysis to the junction of the first rib and sternum); total cervical vertebral length (measured with a tape measure from the first cervical vertebra to the last cervical vertebra); femur length (from the greater trochanter to the intercondylar fossa); and biceps brachii length and small intestine length, all measured post-slaughter using a tape measure. Carcass weight, biceps weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, and head weight were all measured using an electronic scale after slaughter.

[0105] Example 2

[0106] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.

[0107] (1) DNA extraction: Ear tissue samples were collected from each individual pig in the experimental herd in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was around 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.

[0108] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.

[0109] (3) Sequence alignment: The raw sequencing data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0110] (4) Variation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, and then use Sambamba (v0.8.2) to remove PCR repeat sequences in the bam format file. Finally, use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).

[0111] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained only if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Furthermore, Plink (v1.9) software was used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.

[0112] 2. Genome-wide association study (GWAS) analysis

[0113] Genome-wide association analysis was performed on phenotypic data corrected for confounding factors using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:

[0114] ① Phenotypic processing: This invention uses the lm() function in R language to perform simple linear regression on gender and batch number, and the corrected residuals are used as the phenotypes for the final association analysis.

[0115] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:

[0116] Where y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which in this study is the measurement value of body size or carcass related traits in Example 1; W represents a matrix consisting of a column of "1"s (n×c dimensions); α is the vector of the effect and intercept of the corresponding covariate (c dimensions); x represents the vector of the genotype of the detection locus (n dimensions); β represents the vector of the magnitude of the effect of the detection locus; u represents a vector with a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ.-1 I n The remaining residual vector (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix and I... n Let represent an n×n identity matrix; MVNn represents an n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 5E-8 is set.

[0117] Based on GWAS analysis ( Figure 1 (Taking the tube circumference as an example), this invention discovered a quantitative trait locus (QTL) on pig chromosome 7 that significantly affects body size and carcass traits, and obtained 10 representative mutation sites. Their basic genetic parameters are shown in Table 1.

[0118] Table 1. Basic genetic parameters of 10 representative mutation sites.

[0119]

[0120] Note: Body size characteristics include body length, straight length of carcass, oblique length of carcass, total length of cervical vertebrae, length of femur, and circumference of canal, etc. Carcass characteristics include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, and small intestine length, etc.

[0121] 3. Association analysis between different genotypes and long phenotypes

[0122] (1) The linkage disequilibrium of the 10 mutation sites in Table 1 was calculated using Plink (v1.9) software according to conventional methods. The results showed that the 10 mutation sites in Table 1 were highly linked (r 2 ≥0.8).

[0123] (2) The present invention further analyzes the association between genotype and pig body size and carcass phenotype at the above-mentioned mutation sites. The specific method is as follows: using Plink (v1.9) software, the genotype of each individual in the F7 generation of chimeric family experimental pigs at the corresponding mutation site is extracted from the sequencing file. After counting the number of individuals of each genotype, the genotypes of these individuals are correlated with their corresponding body size and carcass traits. Then, the multGomp package in R language is used to statistically analyze the differences in phenotypic distribution under different genotypes in the F7 generation of chimeric family.

[0124] For the g.30332972 site, the results are shown in Table 1 and Figure 2 , Figure 3 and Figure 4The p-values ​​were obtained from the variance test. The analysis showed that locus g.30332972 significantly affected all indicators (P<0.001). Regarding allele effects, the A allele showed a clear positive association trend: the phenotypic mean of genotypes carrying the A allele (A / A and C / A) was generally higher than that of the C / C genotype without the A allele, and the mean of the A / A homozygous genotype was the highest among most indicators, suggesting that the A allele is a potential dominant allele. Further multiple comparison analysis of the phenotypes corresponding to different genotypes showed a significant difference between the C / A and C / C genotypes (P<0.01). Due to the extremely small sample size of the A / A genotype (n=3), the statistical power was insufficient, and the p-value did not reach a significant level (P>0.05). However, based on the variance analysis results and mean data, it can be concluded that the indicators of individuals with the A / A genotype were higher than those of individuals with the A / C and C / C genotypes. Therefore, when selecting breeding pigs, individuals with the A / A or C / A genotypes are given priority as parents for subsequent breeding (Table 2).

[0125] The other nine mutation sites were highly linked to the g.30332972C>A site. The results in Tables 3-11, combined with multiple comparison analysis of the phenotypes corresponding to different genotypes, show that these nine mutation sites and the g.30332972 site have the same effect on these indicators. Specifically, the genotypes corresponding to n=3 individuals and n=124 or n=125 individuals were the dominant genotypes, while the genotype with the largest sample size (n=544 or n=543) was the inferior genotype (Table 2). Therefore, in pig breeding:

[0126] Targeting the g.30294745G>A site ( Figure 5 , Figure 6 and Figure 7 Individuals with the A / A or G / A genotype should be preferentially selected as parents for subsequent breeding;

[0127] For the g.30294877T>C locus, individuals with C / C or T / C genotypes are preferentially selected as parents for subsequent breeding;

[0128] For the g.30320365_30320369CGGCT>CGCT locus, individuals with the CGCT / CGCT or CGGCT / CGCT genotypes are preferentially selected as parents for subsequent breeding;

[0129] For the g.30335465G>A locus, individuals with the A / A or G / A genotypes are preferentially selected as parents for subsequent breeding;

[0130] For the g.30415226T>A locus, individuals with the A / A or T / A genotypes are preferentially selected as parents for subsequent breeding;

[0131] For the g.30300384G>A locus, individuals with the A / A or G / A genotypes are preferentially selected as parents for subsequent breeding;

[0132] For the g.30337096C>T site, individuals with the T / T or C / T genotypes are preferentially selected as parents for subsequent breeding;

[0133] For the g.30336982C>A site, individuals with the A / A or C / A genotypes are preferentially selected as parents for subsequent breeding;

[0134] For the g.30443032_30443040AACAATTAT>A locus, individuals with the A / A or AACAATTAT / A genotypes are preferentially selected as parents for subsequent breeding.

[0135] Table 2. Effects of locus g.30332972 on body size and carcass traits in mosaic family F7.

[0136]

[0137] Note: n is the number of individuals with each genotype.

[0138] Table 3. Effects of locus g.30294745 on body size and carcass traits in mosaic family F7.

[0139]

[0140] Table 4. Effects of locus g.30294877 on body size and carcass traits in mosaic family F7.

[0141]

[0142] Table 5. Effects of locus g.30320365 on body size and carcass traits in mosaic family F7.

[0143]

[0144] Table 6. Effects of locus g.30335465 on body size and carcass traits in mosaic family F7.

[0145]

[0146] Table 7. Effects of locus g.30415226 on body size and carcass traits in mosaic family F7.

[0147]

[0148] Table 8. Effects of locus g.30300384 on body size and carcass traits in mosaic family F7.

[0149]

[0150] Table 9. Effects of locus g.30337096 on body size and carcass traits in mosaic family F7.

[0151]

[0152] Table 10. Effects of locus g.30336982 on body size and carcass traits in mosaic family F7.

[0153]

[0154] Table 11 Effects of locus g.30443032 on body size and carcass traits in mosaic family F7

[0155]

[0156] The present invention further uses r 2 A threshold of ≥0.8 was used to obtain molecular markers surrounding (within a 1 MB range before and after) g.30332972C>A in the F7 population of the chimeric family. The results showed that it was closely linked to the major site g.30332972C>A (r 2 Molecular markers with a correlation coefficient (r² ≥ 0.8) are significantly associated with body size traits (including body length, straight carcass length, oblique carcass length, total cervical vertebrae length, femur length, and cannula circumference) and carcass traits (including body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, and small intestine length). Furthermore, the degree of their correlation with the phenotype depends on the degree of their tight linkage with the major locus g.30332972C>A. Therefore, any molecular marker tightly linked to the major locus g.30332972C>A (r² ≥ 0.8) can be used as molecular markers for the genetic improvement of body size and carcass traits in breeding pigs and should be within the scope of this patent protection.

[0157] Example 3

[0158] This embodiment further provides a specific method and process for detecting the molecular marker in Example 2, as follows:

[0159] 1. Primer design

[0160] The target fragment containing the mutation site located on chromosome 7 associated with pig body size and carcass traits is shown in SEQ ID NO:1-10. The nucleic acid sequences of the upstream and downstream primers used for sequence amplification to detect the mutation site are shown in the table below.

[0161] Table 12 Primer List

[0162]

[0163] 2. PCR amplification

[0164] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.

[0165] 3. DNA sequencing

[0166] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced in both forward and reverse directions. The obtained sequences were compared with the NCBI genome sequence to identify the corresponding mutation sites.

[0167] SEQ ID NO:1 (chr7: 30294645-30294845):

[0168] CATGAGCTGTGGTG TAGGTCTCAGATGCAGCTCG GATCCCGTGTTGCCAGTGTAGGCCGGCAACTGTAGCTCCAATTCGACCCCTAGCCTGGGAACTTCC M(G / A) TGTGTGGCAGGTTCGGTCCTAAAAAGCAAAAAAATAAAATAAAATAAAAATAATCTTTAAAAAAAAAGGAAAATA AGCAAAAGATTTGGACAGAACTT TGA

[0169] SEQ ID NO:2 (chr7: 30294777-30294977):

[0170] AAATAAAATAAAATAAAAATAATCTTTAAAAAAAAAGGAAAATA AGCAAAAGATTTGGACAGAACTT TGAAAGAAAAGGAGCAGCCCAAGGCTATTATACA M(T / C) GAGAAGCTGTTTAGTCTCACTAGTAAGCAGAGAAATGCAAATTAAAACAAGAACAGAATACTACTTCACACC CCACAAATGGGCCAGAATTAAT AGCCCT

[0171] SEQ ID NO:3(chr7: 30320311-30320475):

[0172] CCGCCCTTTTAAATCTCCGG GCTCATTTGCATGGTCCCGCCCCCCTCAGTGACA M(CGGCT / CGCT) GGCGCGGGCGGGCCCGTCCCCCCTGCCCCTGGGTCGCTCTTTTTAAGCTCCCCTGAGCCGGGGCTGCGCTCCTCTAATTGGGACTC CGAGTCCGGGCTATTTCTGG

[0173] SEQ ID NO:4(chr7: 30332872-30333072):

[0174] AGG CACAGACGGAGCTATGAGGT GAAGTCCCCCTGGGTCACAGGTAGCTTGATCAGTAGGTGAGCTTGGTTTGGTAAGTAAAATGTCACAATGTCACACA M(C / A) TTAACTGGAGAAATGTGAATAAGATTGTT GGATTTTAC CAGTGTCAGTGTCC TGGTTGTGATGTTATACTACAGTTCTGCAAATGTTAGCACTGGGCGGA

[0175] SEQ ID NO:5(chr7: 30335288 - 30335495):

[0176] TGTAGCTCCTATTCAACCCCT AAACTGGGAACTTCTATATGCTGCAAGTATGGTCCTAAAAAGCAAAACCAAAACAAAGAAAAACTGACTCAAGAAGAAATAGAGACTCTCAACAGACCTGTAATAAGTAAGAAGGTTGGATCAGTATTCGAAAACCTCCCAAAAAAGAAAAGTCAG M(G / A) ACTAGATGTC TCCACTGGCCAATTCTACCA

[0177] SEQ ID NO:6(chr7: 30415126-30415326):

[0178] GATGGAA ACAAGAATTCAGTTTGGGCATT TTAAGTTTGAGATCCTATCAGATATCCAAACGGGAATACTGGAGTTCCCATCGTGTTGCAGTGGAAACGAAM(T / A) CCAACGAGGAACTACGAGGTTGCAGGTTTGATCCCTGACCTCGC TCAGCGGGTTAAGGATCTGG TGTTGCCATGAGCTGTGGTGTATGTCGAGATGTGGC

[0179] SEQ ID NO:7(chr7: 30300284-30300484):

[0180] GAGTACTTCTCTCTCTCTTAGAAGTGTTGGGAGT CCACCCAGGGCAAAAGCC CAGGTGGGAAGTGCTTCCCCATGAGAGACAGAGCTGGCCTCACCCAGC M(G / A) GGGTGGGGGGCAGTAGCTCCGTTAGGGGTTTTCCTCACCTAAACCGTGGAGAACCCTCCCTGTCTACCGAGCAG CAGAGACGGGAGCAGTTGG CTTGTCA

[0181] SEQ ID NO:8(chr7: 30337047 - 30337291):

[0182] CCAACGTGTCCTGACCTCAT TACTAACTACTCTGTGGCTTCAAGTAAGT M(C / T) AATACCTTGGACTCTCAGCATTCTTCACTCTAAGATAATACCCACCTCAAAAATAACAACGTTTATGAGATTAAGTATTAGGTAAATGATAACATGGTCCATAAATGTAAGGGACTATTTCCTTTTGACTACAAAAATCAAATTGCTATCAAGAGGTAGAGGAGTTCCCTTTGTG GCACAGCCAGTTAAGGATCC

[0183] SEQ ID NO:9(chr7: 30336882-30337082):

[0184] GTGCACATTTACCTGATAAACGAGATAATGG ACTGAATGACACGTGGGACA GTGGGCCCCTATCCAGGGCTTGGGAAGGGGGAGACACATAAAGGAGGAA M(C / A) CAAGACTGTAGCAAAATCTGTCGGCCACTACCATACCGGCCTGGTTCAACCTTGCCAGGCTGGC CCAACGTGTCCTGACCTCATTACTAACTACTCTGTG

[0185] SEQ ID NO:10 (chr7: 30442931 - 30443284):

[0186] TCTTTGTTTCCTGTCGGTGA TTTAACTTACTATTATGTAAGTAATATATGCTCTTTGAGCGGGAAAAAGAGACCATTCAGACAAAAATAAACAACAGTAAT M(AACAATTAT / A) AAAAGAATAAAAGTAGAATACTATCGACCAAAGAATCGCTATTAACAATTTGGTATACATTCTTCCAGACTCATAGGAAATCTATATATTTTTTTAACAAAAACGGAATGTTTTGTGTGTACATCATGATATGCTGTTTGACAACCTGTTTTTTTCCTTTCCCAATAATACATAATGAATTTTTTTTTTCTTTTTACCGTCACACCTGTAGCATATGCAAGTTCC CAGGCTAGTGGTGGAATGGA

[0187] Note: M marked in the sequence is the mutation site (the mutated base in parentheses is the allele mutation); the underlined part is the primer binding position.

[0188] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a molecular marker located on chromosome 7 associated with pig body size and carcass traits, characterized in that... Its application includes at least one of the following (1)-(6): (1) Identify the body size and / or carcass characteristics of pigs; (2) Prepare products for identifying pig body size traits and / or carcass traits; (3) Select pigs with excellent body size and / or carcass traits; (4) Prepare products for screening pigs with excellent body size and / or carcass traits; (5) Genetic breeding of pig body size and / or carcass traits; (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits; The molecular markers located on chromosome 7 that are associated with pig body size and carcass traits include at least one of molecular markers (I)-(X), and the locations and variation information of the mutation sites corresponding to the molecular markers are shown below in sequence: (I) The mutation site corresponds to the G>A mutation at nucleotide position 30,294,745 on chromosome 7 of the international pig genome version 11.1 reference sequence; (II) The mutation site corresponds to the T>C mutation at nucleotide position 30,294,877 on chromosome 7 of the international pig genome version 11.1 reference sequence; (III) The mutation site corresponds to the CGGCT>CGCT mutation at nucleotide positions 30320365-30320369 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence; (IV) The mutation site corresponds to the C>A mutation at nucleotide position 30,332,972 on chromosome 7 of the international pig genome version 11.1 reference sequence; (V) The mutation site corresponds to the G>A mutation at nucleotide position 30335465 on chromosome 7 of the international pig genome version 11.1 reference sequence; (VI) The mutation site corresponds to the T>A mutation at nucleotide position 30,415,226 on chromosome 7 of the international pig genome version 11.1 reference sequence; (VII) The mutation site corresponds to the G>A mutation at nucleotide position 30300384 on chromosome 7 of the international pig genome version 11.1 reference sequence; (VIII) The mutation site corresponds to the C>T mutation at nucleotide position 30,337,096 on chromosome 7 of the international pig genome version 11.1 reference sequence; (IX) The mutation site corresponds to the C>A mutation at nucleotide position 30,336,982 on chromosome 7 of the international pig genome version 11.1 reference sequence; (X) The mutation site corresponds to the AACAATTAT>A mutation at nucleotide positions 30443032-30443040 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence; The aforementioned body size characteristics include body length, straight length of carcass, oblique length of carcass, total length of cervical vertebrae, and length or circumference of femur; The carcass characteristics mentioned include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, or small intestine length; The pigs mentioned are F7 generation individuals of chimeric families bred from Duroc pigs, Landrace pigs, Large White pigs, Pietrain pigs, Erhualian pigs, Laiwu pigs, Bama miniature pigs, and Tibetan pigs.

2. The application according to claim 1, characterized in that: For molecular marker (Ⅰ), its nucleotide sequence is shown in SEQ ID NO:1, where M in the sequence is G or A; For molecular marker (II), its nucleotide sequence is shown in SEQ ID NO:2, where M in the sequence is T or C; For molecular marker (Ⅲ), its nucleotide sequence is shown in SEQ ID NO:3, where M in the sequence is CGGCT or CGCT; For molecular marker (Ⅳ), its nucleotide sequence is shown in SEQ ID NO:4, where M in the sequence is C or A; For molecular marker (V), its nucleotide sequence is shown in SEQ ID NO:5, where M in the sequence is G or A; For molecular marker (VI), its nucleotide sequence is shown in SEQ ID NO:6, where M in the sequence is T or A; For molecular marker (Ⅶ), its nucleotide sequence is shown in SEQ ID NO:7, where M in the sequence is G or A; For the molecular marker (VIII), its nucleotide sequence is shown in SEQ ID NO:8, where M in the sequence is C or T; For the molecular marker (IX), its nucleotide sequence is shown in SEQ ID NO:9, where M in the sequence is C or A; For the molecular marker (X), its nucleotide sequence is shown in SEQ ID NO:10, where M in the sequence is AACAATTAT or A.

3. The application of a product for detecting molecular markers located on chromosome 7 associated with pig body size and carcass traits, characterized in that... Its application includes at least one of the following (1)-(6): (1) Identify the body size and / or carcass characteristics of pigs; (2) Prepare products for identifying pig body size traits and / or carcass traits; (3) Select pigs with excellent body size and / or carcass traits; (4) Prepare products for screening pigs with excellent body size and / or carcass traits; (5) Application in the genetic breeding of pig body size traits and / or carcass traits; (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits; The molecular markers located on chromosome 7 that are associated with pig body size and carcass traits are the molecular markers described in claim 1; The pigs mentioned are F7 generation individuals of chimeric families bred from Duroc pigs, Landrace pigs, Large White pigs, Pietrain pigs, Erhualian pigs, Laiwu pigs, Bama miniature pigs, and Tibetan pigs.

4. The application according to claim 3, characterized in that: The products described for detecting molecular markers located on chromosome 7 that are associated with pig body size and carcass traits include reagents, kits, chips, or detection devices.

5. The application according to claim 4, characterized in that: The reagents described contain primer pairs or probes.

6. The application according to claim 5, characterized in that: The primer pairs comprise at least one of the following primer pairs: primer-F1 and primer-R1, primer-F2 and primer-R2, primer-F3 and primer-R3, primer-F4 and primer-R4, primer-F5 and primer-R5, primer-F6 and primer-R6, primer-F7 and primer-R7, primer-F8 and primer-R8, primer-F9 and primer-R9, and primer-F10 and primer-R10, with nucleotide sequences as shown in SEQ ID NO:11-30.

7. The application according to claim 4, characterized in that: The kit contains primer pairs or probes, and the kit also contains a reaction buffer.

8. A method for identifying body size and / or carcass traits in pigs, characterized in that... It includes the following steps: Detect the molecular markers described in claim 1 in pigs, and determine the pig's body size and / or carcass traits based on the mutation sites of the molecular markers: For (I), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,294,745th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, G / A and G / G genotypes. For (II), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,294,877th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: C / C, T / C and T / T genotypes. For (III), the pig body size or carcass traits, from best to worst, are ordered by the genotypes at nucleotide sites 30320365-30320369 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: CGCT / CGCT, CGGCT / CGCT and CGGCT / CGGCT. For (Ⅳ), the pig body size or carcass traits, from best to worst, are ordered by the genotype at nucleotide position 30,332,972 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, C / A and C / C genotypes; For (V), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,335,465th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, G / A, and G / G genotypes. For (VI), the pig body size or carcass traits, from best to worst, are ordered by the genotype at nucleotide 30,415,226 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, T / A, and T / T genotypes. For (VII), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30300384th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, G / A, and G / G genotypes. For (VIII), the pig body size or carcass traits, from best to worst, are ordered by the genotype at the 30,337,096th nucleotide site on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: T / T, C / T, and C / C genotypes. For (IX), the pig body size or carcass traits, from best to worst, are ordered by the genotype at nucleotide position 30,336,982 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, C / A, and C / C genotypes. For (X), the pig body size or carcass traits, from best to worst, are ordered by the genotypes at nucleotide sites 30443032-30443040 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence as follows: A / A, AACAATTAT / A, and AACAATTAT / AACAATTAT genotypes. The pigs mentioned are F7 generation individuals of chimeric families bred from Duroc pigs, Landrace pigs, Large White pigs, Pietrain pigs, Erhualian pigs, Laiwu pigs, Bama miniature pigs, and Tibetan pigs.

9. The method for identifying pig body size and / or carcass traits according to claim 8, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using primer pairs as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results; The primer pairs comprise at least one of the following primer pairs: primer-F1 and primer-R1, primer-F2 and primer-R2, primer-F3 and primer-R3, primer-F4 and primer-R4, primer-F5 and primer-R5, primer-F6 and primer-R6, primer-F7 and primer-R7, primer-F8 and primer-R8, primer-F9 and primer-R9, and primer-F10 and primer-R10, with nucleotide sequences as shown in SEQ ID NO:11-30.

10. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the molecular markers described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the molecular markers: For (I), select breeding pig individuals with the A / A or G / A genotype at nucleotide position 30,294,745 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this position generation by generation. For (II), select breeding pig individuals with the C / C or T / C genotype at nucleotide position 30,294,877 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this position generation by generation. For (III), select breeding pig individuals with the CGCT / CGCT or CGGCT / CGCT genotype at nucleotide sites 30320365-30320369 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the CGGCT / CGGCT genotype to increase the frequency of the CGCT allele at this site generation by generation. For (IV), select breeding pig individuals with the A / A or C / A genotype at nucleotide position 30332972 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the C / C genotype to increase the frequency of allele A at this position generation by generation. For (V), select breeding pig individuals with the A / A or G / A genotype at nucleotide position 30335465 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this position generation by generation. For (VI), select breeding pig individuals with the A / A or T / A genotype at nucleotide position 30415226 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele A at this position generation by generation. For (VII), select breeding pig individuals with the A / A or G / A genotype at nucleotide position 30300384 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence from the core breeding pig population, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this position generation by generation. For (VIII), in the core breeding pig population, select breeding pig individuals with the T / T or C / T genotype at nucleotide position 30,337,096 on chromosome 7 of the International Pig Genome Version 11.1 reference sequence, and cull breeding pig individuals with the C / C genotype to increase the frequency of the T allele at this position generation by generation. For (IX), select breeding pig individuals with the A / A or C / A genotype at nucleotide position 30,336,982 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence from the core breeding pig population, and cull breeding pig individuals with the C / C genotype to increase the frequency of allele A at this position generation by generation; For (X), select breeding pig individuals with the genotype A / A or AACAATTAT / A at nucleotide sites 30443032-30443040 on chromosome 7 of the International Swine Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the genotype AACAATTAT / AACAATTAT to increase the frequency of allele A at this site generation by generation; The pigs mentioned are F7 generation individuals of chimeric families bred from Duroc pigs, Landrace pigs, Large White pigs, Pietrain pigs, Erhualian pigs, Laiwu pigs, Bama miniature pigs, and Tibetan pigs.

Images