A caps molecular marker of a salt-tolerant st2 gene promoter region of rice and application thereof

Abstract

This invention relates to the field of agricultural technology, specifically providing a salt-tolerant rice variety. ST2 CAPS molecular markers in gene promoter regions and their applications. Genomic DNA was extracted from rice leaves, and then PCR amplification was performed using specific primer pairs of CAPS molecular markers as templates to obtain amplified fragments. The amplified fragments were digested with AleI-v2 restriction endonuclease, followed by electrophoresis. Plants with only one 1522 bp band were identified as salt-sensitive, while plants with two bands (985 bp and 515 bp) were identified as salt-tolerant. This invention allows for the rapid breeding of plants utilizing wild rice. ST2 Genetically modified rice varieties can help improve the current situation where a large amount of field work and workload are required for salt tolerance identification using population materials. This has important theoretical and practical significance for breeding new salt-tolerant rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a salt-tolerant rice variety. ST2 CAPS molecular markers in gene promoter regions and their applications. Background Technology

[0002] Rice ( Oryza sativa L. (Lysimachia christinae) is one of my country's major food crops and is classified as a moderately salt-sensitive plant. According to statistics from the Food and Agriculture Organization of the United Nations in 2021, the global area of ​​saline soils exceeds 833 million hectares. 2 The research findings of the public welfare industry (agriculture) scientific research project "Research and Demonstration of Supporting Technology Models for Saline-Alkali Land Agriculture and High-Efficiency Utilization" (2003-2013) show that saline soil is one of the most important low- and medium-yield soil types in my country. Regarding how to address soil salinization, Hugo BoyKo advocates using saline water to irrigate crops and employing salt-tolerant crops. Compared to methods such as constructing water conservancy facilities for drainage and chemical treatment of saline-alkali land, these methods are slower to take effect but are more economical and have more lasting results. Therefore, identifying salt-tolerant genes in rice and studying the response mechanism of rice to salt stress are of great significance for breeding salt-tolerant varieties.

[0003] Wild rice is the ancestor of cultivated rice. Having grown in the natural environment for a long time, it possesses a large number of stress-resistance and disease-resistant genes that were lost or weakened during rice domestication. In recent decades, due to the widespread adoption of bred varieties, the genetic base of cultivated rice varieties has become increasingly narrow. Developing and utilizing salt-tolerant genes in wild rice germplasm resources is a key means to broaden the genetic base of cultivated rice and cultivate salt-tolerant rice varieties. Molecular marker-assisted breeding can significantly shorten the breeding cycle and rapidly cultivate new salt-tolerant rice varieties; therefore, developing molecular markers associated with salt-tolerant genes in wild rice is particularly important. Summary of the Invention

[0004] The inventors of this invention have discovered a new salt-tolerant gene in wild rice. ST2 ( LOC_ Os02g08540 Through the construction of near-isogenic lines and transgenic experiments, it was verified that the alleles in wild rice have extremely strong salt tolerance.

[0005] The purpose of this invention is to design new molecular markers based on the sequence polymorphism of this gene in wild rice and cultivated rice, for molecular-assisted selection to use this gene to breed new varieties in the future, so as to accelerate the process of salt-tolerant rice breeding.

[0006] To achieve the above objectives, the present invention provides the following technical solution: The first aspect of the present invention provides a rice ST2The CAPS molecular marker of the gene and its specific primer pair, wherein the CAPS molecular marker is located on chromosome 2 of the rice genome; the upstream primer sequence of the specific primer pair for amplifying the CAPS molecular marker is shown as ProST2-F, and the downstream primer sequence is shown as ProST2-R; upstream primer ProST2-F: GCACTTATGGCTAATCATGGACTAATTAGG; downstream primer ProST2-R: GCAAGACGGAGGTGGAAGGA.

[0007] A second aspect of this invention provides the application of the specific primer pair of the CAPS molecular marker in screening salt-tolerant rice. ST2 The PCR amplification product of rice containing a salt-tolerant gene fragment in its gene promoter region contained two bands of 985 bp and 515 bp after digestion with the restriction endonuclease AleI-v2. ST2 The PCR amplification product of rice whose gene promoter region does not contain salt tolerance gene fragments, after being digested with restriction endonuclease AleI-v2, only has a 1522 bp major band.

[0008] The third aspect of the present invention provides screening rice ST2 The method for determining the presence or absence of salt-tolerant genes in the promoter region of a gene includes the following steps: S1. Select rice leaves to extract genomic DNA, and then use the genomic DNA as a template and the corresponding sequences of ProST2-F and ProST2-R as specific primers to perform PCR amplification to obtain amplified fragments. S2. The PCR amplification products were digested with the restriction endonuclease AleI-v2. The digested products were then classified by agarose gel electrophoresis. The presence of salt-tolerant gene fragments was determined based on the electrophoretic bands. S3. Identification Results: If the enzyme digestion product shows only one 1522 bp band, then the rice sample tested... ST2 The gene promoter region does not contain a salt-tolerance gene fragment; the enzyme digestion product contains two bands of 985 bp and 515 bp, indicating that the rice being tested... ST2 The promoter region of the gene contains a salt-tolerant gene segment.

[0009] Further, the PCR amplification system is as follows: 50 μL, including 25 μL of 2×PCR Buffer for KODFX Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water added to 50 μL.

[0010] Furthermore, the PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 98℃ pre-denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 45 s, for 35 cycles; and finally 68℃ extension for 10 min.

[0011] The beneficial effects of this invention are: Detecting different individual plants using this CAPS marker ST2 The genotype of this gene enables rapid breeding of rice varieties improved using the salt-tolerant locus in wild rice. The successful development of this molecular marker has enabled precise laboratory identification of salt-tolerant genotypes. Compared to traditional field phenotypic screening methods, it effectively improves the current situation where field trials are greatly affected by environmental factors, have long screening cycles, and consume high levels of manpower and resources. It provides an efficient molecular marker-assisted selection technology system for salt-tolerant rice breeding, and has significant theoretical and practical implications. Attached Figure Description

[0012] Figure 1 Nipponbare and wild rice ST2 Electrophoresis diagram of gene promoter fragment digested with enzymes: M is the marker, lanes 2 and 3 are Nipponbare and wild rice, respectively.

[0013] Figure 2 Salt-sensitive individual plants (left) and salt-tolerant individual plants (right) in the F2 population.

[0014] Figure 3 For individual plants of Nipponbare, wild rice, and F2 segregating populations ST2 Electrophoresis diagram of gene promoter fragment digestion: M is Marker, NIP is Nipponbare, S1, S2, and S3 are salt-sensitive single plants in the F2 segregating population, and T1, T2, and T3 are salt-tolerant single plants in the F2 segregating population. Detailed Implementation

[0015] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0016] Explanation of the sequence list: SEQ ID NO. 1 (ProST2-F): GCACTTATGGCTAATCATGGACTAATTAGG SEQ ID NO. 2 (ProST2-R): GCAAGACGGAGGTGGAAGGA SEQ ID NO. 3 (wild rice) ST2 (Gene promoter region and downstream 420 bp nucleotide sequence) SEQ ID NO. 4 (Japanese Harinaka ST2 (Gene promoter region and downstream 420 bp nucleotide sequence) Experimental materials: wild rice, Nipponbare rice, and wild rice constructed using wild rice as the donor parent and Nipponbare rice as the recipient parent. ST2 Nearly isogenetic populations and wild rice ST2 The F2 segregating population was constructed by crossing a near-isogenic line population with Nipponbare. Example 1

[0017] A screening method for wild rice ST2 W The method for determining the presence or absence of salt-tolerant genes in the promoter region includes the following steps: Primer design: Through the genetic analysis of cultivated rice ST2 Alleles of wild rice ST2 W Sequence alignment of the promoter revealed 87 bp and 22 bp InDel variants, along with 40 SNPs, that induce salt tolerance. The 22 bp InDel variant specifically modifies the wild rice allele. ST2 The promoter sequence contains a restriction endonuclease site for AleI-v2. Primers were designed based on the sequences upstream and downstream of this restriction site. ProST2-F:GCACTTATGGCTAATCATGGACTAATTAGG; ProST2-R: GCAAGACGGAGGTGGAAGGA.

[0018] Step 1: Extract genomic DNA from rice leaves. Using the DNA as a template, perform PCR amplification with specific primers corresponding to ProST2-F and ProST2-R sequences to obtain amplified fragments. The PCR amplification volume is 50 μL, including 25 μL of 2×PCR Buffer for KOD-FX-Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water to a final volume of 50 μL. The PCR amplification program is as follows: DNA pre-denaturation at 95℃ for 5 min; pre-denaturation at 98℃ for 10 s; annealing at 60℃ for 30 s; extension at 68℃ for 45 s; 35 cycles; and final extension at 68℃ for 10 min.

[0019] Step 2: The PCR amplification product was digested with the restriction endonuclease AleI-v2. The digestion system was as follows: 1 μg PCR product, 1 μL AleI-v2, 2 μL 10×rCutSmart buffer, and ddH2O to a final volume of 50 μL. The digestion conditions were incubation at 37°C for 1.5 h. The digested products were then classified by agarose gel electrophoresis, and the presence of salt-tolerant gene fragments was determined based on the electrophoretic bands.

[0020] Step 3, Identification Results: The rice with only one 1522 bp band on electrophoresis after enzyme digestion was cultivated Nipponbare rice, a salt-sensitive plant; the rice with two bands (985 bp and 515 bp) was wild rice, a salt-tolerant plant. (Two types of rice) ST2 The molecular identification results of the gene were consistent with the salt tolerance phenotype identification results, indicating that the identification procedure of this invention is simple and has a wide range of applications. Figure 1 ). Example 2

[0021] Constructing wild rice ST2 with cultivated rice NIP as the background parent W Near-isogenic NIL (NIL-ST5) W NIL and NIP were backcrossed to construct an F2 segregating population. The salt tolerance of individual F2 plants was then assessed.

[0022] Step 1: Genomic DNA was extracted from leaves of Nipponbare and F2 rice populations. Using the DNA from these tissues as templates, PCR amplification was performed using the corresponding sequences of ProST2-F and ProST2-R as specific primers to obtain amplified fragments. The PCR amplification volume was 50 μL, including 25 μL of 2×PCR Buffer for KOD-FX-Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water to a final volume of 50 μL. The PCR amplification program was as follows: DNA pre-denaturation at 95℃ for 5 min; pre-denaturation at 98℃ for 10 s; annealing at 60℃ for 30 s; extension at 68℃ for 45 s; 35 cycles; and a final extension at 68℃ for 10 min.

[0023] Step 2: The PCR amplification product was digested with the restriction endonuclease AleI-v2. The digestion system was as follows: 1 μg PCR product, 1 μL AleI-v2, 2 μL 10×rCutSmart buffer, and ddH2O to a final volume of 50 μL. The digestion conditions were incubation at 37°C for 1.5 h. The digested products were then classified by agarose gel electrophoresis, and the presence of salt-tolerant gene fragments was determined based on the electrophoretic bands.

[0024] Step 3, Identification Results: Individual plants showing only a single 1522 bp band on enzyme digestion electrophoresis are salt-sensitive plants from the F2 population; plants showing two bands (985 bp and 515 bp) on electrophoresis are salt-tolerant plants. Figure 3 ).

Claims

1. The application of a CAPS molecular marker-specific primer pair in identifying salt tolerance in rice, characterized in that, The PCR amplification product of salt-tolerant rice, after digestion with restriction endonuclease AleI-v2, contained two bands of 985 bp and 515 bp; the PCR amplification product of salt-sensitive rice, after digestion with restriction endonuclease AleI-v2, contained only one band of 1522 bp. The CAPS molecular marker-specific primer pair consists of the upstream primer ProST2-F with the nucleotide sequence shown in SEQ ID NO. 1 and the downstream primer ProST2-R with the nucleotide sequence shown in SEQ ID NO. 2; The rice variety mentioned is wild rice, Nipponbare, and a wild rice variety constructed by using wild rice as the donor parent and Nipponbare as the recipient parent. ST2 Nearly isogenetic populations and wild rice ST2 The F2 segregating population was constructed by crossing a genetically near-isogenic line population with Nipponbare. ST2 Genes are LOC_Os02g08540 .

Images