A FBX048 inhibitor capable of effectively enhancing the efficacy of paclitaxel under hypoxia in lung cancer

Abstract

The application discloses an FBXO48 inhibitor which can effectively enhance the curative effect of paclitaxel under lung cancer hypoxia, and particularly relates to a combined use of an FBXO48 inhibitor (BC1618) and a chemotherapeutic drug (paclitaxel) and application of the combined use in preparation of a drug for treating hypoxia-driven drug-resistant tumors. The application discloses for the first time that FBXO48 up-regulates CA9 and glycolysis pathway through a CAMKK2-pAMPK alpha-HIF1 alpha signal axis, and mediates drug resistance of tumor cells to chemotherapeutic drugs such as paclitaxel under hypoxia. The FBXO48 inhibitor (BC1618) can block the signal axis, restore the sensitivity of tumor cells to the chemotherapeutic drugs, and show a significant synergistic effect in patient-derived tumor organoids and mouse xenograft models. The application provides a brand-new combined treatment strategy for overcoming the chemotherapeutic resistance caused by the tumor hypoxic microenvironment.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an FBXO48 inhibitor that can effectively enhance the efficacy of paclitaxel in hypoxic lung cancer patients. Background Technology

[0002] Tumor hypoxia is a typical characteristic of the solid tumor microenvironment and is closely related to tumor progression, metastasis, and treatment resistance. Hypoxia-inducible factor HIF1α is stably expressed under hypoxic conditions, activating downstream target genes such as CA9 and SLC2A1, promoting glycolytic metabolic reprogramming, acidifying the tumor microenvironment, and significantly reducing the cytotoxic effects of chemotherapeutic drugs (paclitaxel). Currently, there are no effective drugs in clinical practice to reverse paclitaxel-induced hypoxia-mediated chemotherapeutic resistance.

[0003] FBXO48 is a member of the F-box protein family and participates in ubiquitination-mediated protein degradation. In the prior art, the FBXO48 inhibitor BC1618 has been reported to improve insulin resistance (Nat Chem Biol 2021), but its role in tumor treatment, particularly in regulating the hypoxia signaling pathway and reversing chemotherapeutic resistance, has never been elucidated. The inventors have, for the first time, discovered in patient-derived organoids that FBXO48 expression is significantly upregulated under hypoxic conditions and activates the HIF1α signaling axis through pAMPKα degradation, making it a key molecule leading to paclitaxel resistance. Currently, there are no publicly available reports on the combined use of FBXO48 and chemotherapeutic drugs (paclitaxel). Summary of the Invention

[0004] Purpose of the invention: In order to overcome the shortcomings of the existing technology, the present invention provides an FBXO48 inhibitor that can effectively enhance the efficacy of paclitaxel in lung cancer under hypoxia. It is the first time that the mechanism by which FBXO48 mediates hypoxic chemotherapy resistance through the CAMKK2-pAMPKα-HIF1α-CA9 signaling axis has been discovered, and the synergistic effect of the inhibitor BC1618 in combination with paclitaxel in restoring chemotherapy sensitivity under hypoxic conditions has been proposed.

[0005] Technical solution: To achieve the above objectives, the technical solution adopted by this invention is as follows: On the one hand, the present invention proposes the application of an FBXO48 inhibitor in the preparation of a drug to reverse tumor cell drug resistance, wherein the FBXO48 inhibitor includes BC1618; and the reversal of tumor cell drug resistance refers to reversing the resistance of tumor cells to paclitaxel.

[0006] On the other hand, the present invention proposes the application of an FBXO48 inhibitor in the preparation of a paclitaxel antitumor synergist, wherein the FBXO48 inhibitor includes BC1618.

[0007] On the other hand, the present invention proposes the application of FBXO48 inhibitor in combination with paclitaxel in the preparation of antitumor drugs, characterized in that the FBXO48 inhibitor includes BC1618.

[0008] Optionally, in one embodiment of the present invention, the tumor includes lung cancer, gastric cancer, liver cancer, head and neck squamous cell carcinoma, gallbladder cancer, intestinal cancer, ovarian cancer, breast cancer, cervical cancer, endometrial cancer, or esophageal squamous cell carcinoma.

[0009] Further optionally, in one embodiment of the present invention, the tumor may include lung cancer, stomach cancer, liver cancer, head and neck squamous cell carcinoma, gallbladder cancer, or intestinal cancer.

[0010] Further, optionally, in one embodiment of the invention, the tumor includes lung cancer.

[0011] On the other hand, the present invention proposes an antitumor drug containing an effective amount of a first active ingredient, paclitaxel or its pharmaceutically acceptable salt or hydrate, a second active ingredient, an FBXO48 inhibitor or its pharmaceutically acceptable salt or hydrate, and optional pharmaceutically acceptable excipients, wherein the FBXO48 inhibitor includes BC1618.

[0012] Optionally, in one embodiment of the present invention, the formulation of the antitumor drug includes an oral formulation, a nasal formulation, or an injectable formulation.

[0013] Optionally, in one embodiment of the present invention, the tumor includes lung cancer, gastric cancer, liver cancer, head and neck squamous cell carcinoma, gallbladder cancer, intestinal cancer, ovarian cancer, breast cancer, cervical cancer, endometrial cancer, or esophageal squamous cell carcinoma.

[0014] Further optionally, in one embodiment of the present invention, the tumor may include lung cancer, stomach cancer, liver cancer, head and neck squamous cell carcinoma, gallbladder cancer, or intestinal cancer.

[0015] Further, optionally, in one embodiment of the invention, the tumor includes lung cancer.

[0016] Beneficial effects: This invention reveals for the first time that FBXO48 expression is increased under hypoxic conditions, serving as a key driver of chemotherapy resistance, and provides a new drug intervention target.

[0017] This invention is the first to propose a strategy of combining the FBXO48 inhibitor (BC1618) with the chemotherapy drug (paclitaxel), which can effectively reverse hypoxia-induced chemotherapy resistance and has a significant synergistic effect.

[0018] This invention also provides a method for screening patient groups suitable for combination therapy based on FBXO48 expression levels, which has value for personalized treatment. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 Representative morphological features of patient-derived organoids under a bright-field microscope (scale bar: 200 µm).

[0021] Figure 2 Histological comparison analysis of organoids and their corresponding parental tumor tissues (scale bar: 30 µm).

[0022] Figure 3 This study describes the characteristics and clinical significance of hypoxia-related CA9 expression in lung cancer organoids. A: Expression heatmap of hypoxia-related genes (columns) in four lung cancer organoid samples (rows); B: Histogram (x-axis) showing the distribution of CA9 expression levels in the above organoid cells under normoxic and hypoxic conditions.

[0023] Figure 4 The growth of different lung cancer organoids under normoxic and hypoxic conditions.

[0024] Figure 5 The expression of FBXO48 in organoids in response to hypoxia. A: Relative expression level of FBXO48 gene in lung cancer (LUNG) organoids under normoxic and hypoxic conditions; B: Relative expression level of FBXO48 gene in gastric cancer (GC), liver cancer (LC), head and neck squamous cell carcinoma (HNSC), gallbladder cancer (GBC), and colon cancer (CO) organoids under normoxic and hypoxic conditions.

[0025] Figure 6This study investigates the mechanism of action of BC1618 and the regulation of the FBXO48-dependent AMPK pathway in organoids. A: GSEA results of organoids treated with BC1618; B: Relative expression levels of related genes in organoids treated with BC1618 (*P<0.05, **P<0.01, ***P<0.001); C: Immunohistochemical staining of AMPKα and pAMPKα proteins in LUNG0043 organoids treated with BC1618 (scale bar: 50 μm); D: Western blot results of FBXO48 protein levels in sg-Control, sg-FBXO48_1, sg-FBXO48_2 and sg-FBXO48_3 organoids; E: Relative expression levels of related genes in sg-Control and sg-FBXO48_3 organoids; F: Western blot results of AMPKα and pAMPKα protein levels in sg-Control and sg-FBXO48_3 organoids. blot results; G: Western blot results of AMPKα and pAMPKα protein levels in sg-FBXO48_3 organoids after treatment with STO-609 (CAMKK inhibitor).

[0026] Figure 7 To investigate the regulatory effects of BC1618 on glycolysis in various cancer organoids. AB: Analysis of the effect of BC1618 on the glycolytic rate of lung cancer organoids.

[0027] Figure 8 The effects of clinical drugs and hypoxia on the cell viability of lung cancer organoids. AB: Cell viability of lung cancer organoids 72 hours after treatment with clinical drugs (N represents normoxic, H represents hypoxia).

[0028] Figure 9 To demonstrate how BC1618 enhances the sensitivity of lung cancer organoids to paclitaxel by regulating FBXO48. A: Fluorescence imaging of lung cancer organoids stained with CalceinAM / PI after corresponding treatments (scale bar: 200 µm); B: Cell viability analysis of lung cancer organoids after treatment with BC1618, PTX, and BC1618+PTX.

[0029] Figure 10 To evaluate the antitumor effects of BC1618, PTX, and their combination in a mouse xenograft tumor model. A: Schematic diagram of mouse sacrifice and tumor tissue collection at the experimental endpoint; B: Comparison of tumor weight statistics for each group at the experimental endpoint; C: Dynamic changes in tumor volume for each group during treatment; D: Changes in mouse body weight for each group during treatment, used to assess systemic toxicity of the drugs. Detailed Implementation

[0030] This invention relates to a combination therapy of an FBXO48 inhibitor (BC1618) and a chemotherapeutic drug (paclitaxel) and its application in the preparation of drugs for treating hypoxia-driven drug-resistant tumors. This invention reveals for the first time that FBXO48 upregulates CA9 and glycolysis pathways via the CAMKK2-pAMPKα-HIF1α signaling axis, mediating tumor cell resistance to chemotherapeutic drugs such as paclitaxel under hypoxic conditions. The FBXO48 inhibitor (BC1618) can restore the sensitivity of tumor cells to chemotherapeutic drugs by blocking this signaling axis, exhibiting significant synergistic effects in patient-derived tumor organoids and mouse xenograft models. This invention provides a novel combination therapy strategy for overcoming chemotherapy resistance caused by the hypoxic tumor microenvironment.

[0031] The present invention will be further described below with reference to the accompanying drawings and embodiments. The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the specific material ratios, process conditions, and results described in the embodiments are for illustrative purposes only and should not, and will not, limit the present invention as described in detail in the claims.

[0032] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0033] (1) Cells and organoids The patient-derived organoids were established from the biobank of Renji Hospital affiliated with Shanghai Jiao Tong University School of Medicine and cultured in Matricella.

[0034] (2) Drugs and reagents FBXO48 inhibitor: BC1618 (MedChemExpress, HY-112271) Paclitaxel (PTX, MedChemExpress, HY-B0015) CAMKK inhibitor: STO-609 (TargetMol, T3546) CellTiter-Glo Cell Viability Assay Kit (Promega, G7572) Calcein-AM / PI Live / Dead Cell Double Staining Kit (MedChemExpress, HY-KD3001) APC anti-human CA9 antibody (R&D Systems, FAB2188A) Anti-AMPKα and anti-pAMPKα (Thr172) antibodies (Cell Signaling Technology) Anti-FBXO48 antibody (Biorbyt, orb183658) Matrigel (Corning, 356231) DMEM / F12 medium, TrypLE trypsin, penicillin and streptomycin (Thermo Fisher) (3) Laboratory animals NOD.Cg-Prkdc scid Il2rg tm1Sug / JicCrl (NOG) female mice, 6-8 weeks old, weighing 18-20 g (4) Main instruments Hypoxia incubator (Heal Force, HF100) BioTek Cytation Hybrid Multifunctional Microplate Reader Fluorescence microscope (Invitrogen, EVOS M7000) Seahorse XF24 Cellular Energy Metabolism Analyzer (Agilent) Example 1 Experimental Method

[0035] Organoids were cultured and grouped for subsequent testing experiments.

[0036] (1) Organoid culture plate Lung cancer organoids were mechanically dispersed from the matrix gel and digested with TrypLE for 5 min to obtain single cells. After centrifugation and counting, they were seeded into 96-well plates at a density of 1000 cells / 1 μL of matrix gel per well. After the matrix gel solidified, 100 μL of organoid culture medium (based on Advanced F12 supplemented with B27, N2, N-acetylcysteine, glutamine, and other growth factors including EGF, Noggin, R-spondin 1, Wnt-3a, and other small molecule inhibitors, including TGF-β inhibitors, ROCK inhibitors, PGE2, etc.) was added to each well. The plates were then incubated at 37°C in a 5% CO2, 21% O2 incubator.

[0037] (2) Hypoxia treatment After the organoids were treated according to method (1), they were cultured under normoxic conditions for 48 h. Once the organoids reached a length of 50 μm, they were divided into two groups, with three replicates in each group. The normoxic group was placed in a normoxic incubator (37℃, 5% CO2, 21% O2), while the hypoxic group was placed in a hypoxic incubator (1% O2, 5% CO2, 94% N2) and cultured for another 72 h. During the culture process, the morphology of the organoids and the state of the culture medium were observed regularly to confirm that the organoid cells were in a normal state.

[0038] (3) Drug treatment This experiment used hypoxia-induced lung cancer organoids LUNG0043 and LUNG0050 (rather than intrinsically hypoxic LUNG0051) for in vitro drug sensitivity testing. The reason is that LUNG0051 highly expresses hypoxia genes such as CA9 even under normoxic conditions. Figure 3 The LUNG0043 and LUNG0050 exhibit an inherent hypoxic phenotype, failing to effectively reflect the dynamic drug resistance process induced by hypoxia; while the expression of hypoxia genes such as CA9 is significantly upregulated under hypoxic conditions. Figure 3 This model is more suitable for simulating the paclitaxel resistance mechanism mediated by the hypoxic microenvironment of clinical tumors, and was therefore selected as a representative model for studying the reversal of hypoxic resistance by BC1618. The specific procedures are as follows: After treating the organoids according to method (1) and culturing them for 48 hours, once the organoids reached a length of 50 μm, the two types of lung cancer organoids (LUNG0043 and LUNG0050) were each set up into four groups as follows, with three replicates in each group. The following AD experimental group materials were added respectively: A: Control group (containing 0.1% DMSO medium). B: BC1618 monotherapy group (20 μM). C: Paclitaxel monotherapy group (0.03 ug / ml) D: Combination group (containing paclitaxel 0.03 ug / ml and BC1618 20 μM).

[0039] Given the presence of severely hypoxic regions within tumors, the drug-treated organoids were cultured in a hypoxic incubator (1% O2, 5% CO2, 94% N2) for 72 hours to simulate hypoxic environments under various pathological or special physiological conditions. During the culture process, the morphology of the organoids and the state of the culture medium were observed regularly to confirm that the organoids were in a normal state.

[0040] (4) Cytotoxicity test The cultured organoids obtained in the above steps were subjected to cell viability testing and live / dead fluorescence staining experiments to test their toxicity.

[0041] Cell viability assay (CellTiter-Glo method): Remove the 96-well plate and bring it to room temperature. Add an equal volume of CellTiter-Glo reagent to each well, shake to mix, and incubate at room temperature in the dark for 30 min. Detect the luminescence value using a microplate reader.

[0042] Cell viability (%) = (luminescence value of drug-treated group / luminescence value of control group) × 100%.

[0043] Live / dead cell fluorescence staining (Calcein-AM / PI): Remove the 96-well plate and bring it to room temperature. Add an equal volume of Calcein-AM and PI to each well, and incubate at 37°C in the dark for 30 min. Observe and photograph using a fluorescence microscope. Live cells show green fluorescence (Calcein-AM), and dead cells show red fluorescence (PI).

[0044] (5) Establishment of patient-derived organ xenograft model and in vivo drug efficacy evaluation Organoids from the LUNG0043 lung cancer cell line were expanded to a sufficient quantity, digested into single cells using TrypLE, and counted. 2 × 10⁻⁶ cells were collected. 6 One cell was resuspended in 200 μL of a 1:1 mixture of Matrigel and organoid culture medium and subcutaneously injected into the right back of NOG mice. Tumors were allowed to grow to 800-1000 mm². 3 At that time, the mouse was euthanized, the tumor was aseptically removed, and cut into 1-2 mm pieces. 3 Small pieces were transplanted subcutaneously into new NOG mice using a cannula. When the average tumor volume reached 200 mm²... 3 At that time, the mice were randomly divided into 4 groups (6 mice in each group): A: Control group (solvent control, 0.5% sodium carboxymethyl cellulose + 0.1% Tween 80, oral + intraperitoneal injection of normal saline). B: BC1618 monotherapy group (30 mg / kg, orally, once daily); C: Paclitaxel monotherapy group (10 mg / kg, intraperitoneal injection, once every 3 days); D: Combination group (BC1618 30 mg / kg orally daily + paclitaxel 10 mg / kg intraperitoneally every 3 days).

[0045] Measure the tumor's long and short diameters every 3 days, and calculate the tumor volume = long diameter × short diameter. 2 ×0.5. Mice were euthanized 21 days after treatment, and the tumors were removed and weighed.

[0046] (6) CRISPR-mediated FBXO48 gene knockout Three high-scoring, low-off-target-risk sgRNA sequences were designed targeting the exon region of the human FBXO48 gene, synthesized, and cloned into the LentiCRISPR v2 vector digested with BsmBI. HEK293T cells were co-transfected with the sgRNA vector, pMD2.G, and psPAX2 plasmids, and lentiviruses were packaged. Viral supernatants were collected and filtered after 48 and 72 hours. LUNG0043 organoids were digested into small clusters, co-incubated with viral supernatant and polybrene for 24 hours, and cultured for another 48 hours after medium change. Pyroxenin S (60 μg / mL) was added for selection for 5-7 days. After verifying the knockout efficiency by Western blotting, the knockout organoids were amplified for subsequent experiments.

[0047] The sgRNA sequence is as follows: sg-FBXO48_1: TCTTTCAGGTGATACTGCTG; sg-FBXO48_2: GAAGAGTAAAGTGAAACACG; sg-FBXO48_3: AGAGTAAAGTGAAACACGAA.

[0048] (7) Western blot detection of signaling pathway proteins Organoid precipitates were collected, and RIPA lysis buffer (containing protease and phosphatase inhibitors) was added. Lysis was performed on ice for 30 min, followed by centrifugation at 12000 rpm for 15 min, and the supernatant was collected. Protein concentration was determined by BCA method. An equal volume of protein (30 μg) was transferred to a PVDF membrane after SDS-PAGE electrophoresis, blocked with 5% skim milk powder for 1 h, and then incubated overnight at 4°C with primary antibodies against FBXO48 (1:1000), anti-AMPKα (1:1000), anti-pAMPKα (Thr172) (1:1000), and anti-β-actin (1:5000), respectively. After washing, the membrane was incubated at room temperature for 1 h with HRP-labeled secondary antibody, followed by ECL chemiluminescence imaging.

[0049] (8) Real-time quantitative PCR (qRT-PCR) Total RNA was extracted from organoids using the Trizol method and reverse transcribed into cDNA. qPCR was performed using the SYBR Green assay. Primer sequences are as follows: FBXO48: F: 5'-GTGCAGGGCTTCATTGACAT-3', R: 5'-ATTCCTCAGCAGTATCACCCTCC-3'; CA9: F: 5'-TGTGCCCAGGGTGTCATCT-3', R: 5'-GAAGTTCAGCTGTAGCCGAGAGTC-3'; HIF1A: F: 5'-AGATTTTGGCAGCAACGACAC-3', R: 5'-GTTTCAGCGGTGGGTAATGG-3'; CAMKK2: F: 5-TCCAGACCAGCCCGACATAG-3', R: 5'-CAGGGGTGCAGCTTGATTTC-3'; PRKAA1: F: 5-CGACAAGCCCACCTGATTCT-3', R: 5'-CCCTTGGTGTTTCAGCAACC-3'; SLC2A1: F: 5'-TCTTTGAAGTGGGTCCTGGC-3', R: 5'-AGACGTAGGGACCACACAGT-3'; SLC16A4: F: 5'-TGCCATCTTTGCTGGTGGTT-3', R: 5'-GGTCCAGAAAGGACAGCCAT-3'; β-actin: 5'-CCTGTGGCATCCACGAAACT-3', β-actin reverse: 5'-CAGTGATCTCCTTCTGCATCCTG-3'.

[0050] (9) Determination of glycolysis rate The specific method for determining the glycolysis rate of organoids is as follows: Organoids are digested into single cells, at a rate of 4 × 10⁻⁶. 4 Cells were seeded in Seahorse XF24 cell culture plates (pre-coated with Substrate). After 48 h of hypoxic culture, the culture medium was replaced with Seahorse XF glycolysis rate assay medium (containing glucose, glutamine, and pyruvate) and incubated at 37°C without CO2 for 1 h. Rot / AA (0.5 μM) and 2-DG (50 mM) were injected sequentially to detect the proton release rate during glycolysis. Data were analyzed using the Agilent Seahorse Glycolysis Rate Assay reporter generator.

[0051] (10) Culture of organs from other cancer types For organoids derived from patients with other cancer types such as gastric cancer (GC), liver cancer (LC), head and neck squamous cell carcinoma (HNSC), gallbladder cancer (GBC), and colorectal cancer (CO), the culture methods, passage conditions, matrix gel coating, culture medium formulation, normoxic and hypoxic treatments, and all subsequent detection experiments are completely identical to the procedures described in methods (1) and (2). Organoids for different cancer types are derived only from patient samples of the corresponding tumor tissue; all other experimental conditions remain consistent. For simplicity, the relevant methods will not be described again.

[0052] Example 2 Experimental Results

[0053] The results are as follows Figure 1-10 As shown.

[0054] (1) Light micrograph of lung cancer organoid growth Figure 1 The images show representative morphological features of patient-derived organoids under a bright-field microscope (scale bar: 200µm). As can be seen, lung cancer organoids mostly form well-defined, dense spherical or oval solid structures. Some high-grade adenocarcinoma organoids exhibit microcavities, mimicking the solid growth pattern in the early stages of gland formation. These diverse, stable, and reproducible three-dimensional morphologies are not only visual classification features but also direct evidence of how cells within PDOs reconstruct their native microenvironment and intercellular connections through self-organization processes, preliminarily demonstrating the reliability of this model in simulating the complex structures of tumor tissue.

[0055] (2) Immunohistochemistry demonstrates the similarity between tissues and organoids. Figure 2 The histological comparison analysis of organoids and their corresponding parental tumor tissues is shown (scale bar: 30 µm). The figure reveals that lung cancer organoids consistently and highly express cytokeratin CK5 / 6 (CK5 / 6) and tumor protein 40 (P40). Ki67 is also highly expressed in the nuclei of lung cancer organoid cells, reflecting the active proliferative state of tumor cells, consistent with the biological characteristics of tumors. These immunohistochemical results not only highly correlate with the staining patterns of the original tumor tissues but also remain stable across different passages of organoids, strongly demonstrating that organoids mimic the molecular phenotype of their source tumors not only in macroscopic morphology but also, more importantly, in key protein expression profiles and cellular functional states.

[0056] (3) Transcriptome sequencing and cell flow cytometry confirmed that LUNG0051 is an inherently hypoxic organoid (high expression of hypoxia genes such as CA9 under normoxic conditions), and LUNG0043 and LUNGG050 are hypoxia-inducible organoids (high expression of CA9 under hypoxia induction). Figure 3This study illustrates the characteristics and clinical significance of hypoxia-associated CA9 expression in lung cancer organoids. Figure 3 A shows a heatmap of hypoxia program-related genes (columns) expression in four lung cancer organoid samples (rows). The figure shows that under normal culture conditions, LUNG0051 can be detected with a strong CA9 positive signal, while LUNG0043 and LUNG0050 have weaker CA9 expression.

[0057] Figure 3 Figure B shows a histogram (x-axis) of CA9 expression levels in the aforementioned organoids under normoxic and hypoxic conditions. The figure reveals that the LUNG0051 organoid exhibits high basal CA9 expression even under normoxic conditions (positive cell rate reaches 54.7%). After 5 days of hypoxic culture, the CA9 positivity rate further increases to 65.6%, but the increase is relatively gradual. This suggests that LUNG0051 may possess an inherent ability to adapt to hypoxia, and its HIF pathway may be in a partially activated state. In stark contrast are the LUNG0043 and LUNG0050 organoids. Under normoxic conditions, these two organoids show low CA9 expression levels, with positivity rates of 17.1% and 21.3%, respectively. However, under hypoxic stimulation, their CA9 expression is strongly induced, with positivity rates rising sharply to 38.1% and 40.8%, respectively, representing induction folds exceeding 2-fold. This strong, inducible CA9 upregulation pattern mimics the typical response of cells in hypoxic regions of most solid tumors, thus LUNG0043 and LUNG0050 have been established as ideal “inducible” models for studying hypoxia-induced biological processes.

[0058] (4) Growth of different lung cancer organoids under normoxic and hypoxic conditions Figure 4 The growth of different lung cancer organoids under normoxic and hypoxic conditions is shown in the figure. It can be seen from the figure that the intrinsically hypoxic organoid (LUNG0051) shows little difference in growth under normoxic and hypoxic conditions, further supporting the view that it possesses intrinsic hypoxia tolerance. Conversely, the induced hypoxic organoids (LUNG0043 and LUNG0050) grow slowly under hypoxia; this growth inhibition may be related to cell cycle arrest or metabolic stress in the early stages of hypoxia.

[0059] (5) FBXO48 expression is upregulated under hypoxic conditions Figure 5 The expression level of FBXO48 in the hypoxia response of organoids is shown, where, Figure 5Figure A shows the relative expression levels of the FBXO48 gene in lung cancer organoids under normoxic and hypoxic conditions. As can be seen from the figure, in the two "inducible" models LUNG0043 and LUNG0050, hypoxia treatment for 24 hours can significantly upregulate the mRNA expression of FBXO48.

[0060] The intrinsically hypoxic organoid LUNG0051 may carry inherent molecular features related to hypoxia adaptation (such as stable HIF1α mutations or upstream regulatory abnormalities), and its FBXO48 expression regulation mechanism may differ from that of the typical inducible model. To clearly elucidate the "universal hypoxia response pathway," selecting a phenotypically pure inducible model is more rigorous. Therefore, Figure 5 The omission of LUNG0051 data in experiment A is a reasonable experimental design choice, aiming to clearly present the pattern of FBXO48 upregulation induced by hypoxia and avoid interference from the inherent hypoxia background in the judgment of the phenomenon.

[0061] Figure 5 Figure B shows the relative expression levels of the FBXO48 gene in organoids of gastric cancer (GC), liver cancer (LC), head and neck squamous cell carcinoma (HNSC), gallbladder cancer (GBC), and colorectal cancer (CO) under normoxic and hypoxic conditions. As can be seen from the figure, hypoxia-induced upregulation of FBXO48 was observed in organoids of multiple cancer types, suggesting that FBXO48 may be a common molecule in response to hypoxic stress.

[0062] (6) BC1618 regulates the CAMKK2-pAMPKα-HIF1α-CA9 signaling axis and glycolysis Figure 6 This study illustrates the mechanism of action of BC1618 and the regulation of the FBXO48-dependent AMPK pathway in organoids. Figure 6 Figure A shows the GSEA results of organoids treated with BC1618. As can be seen from the figure, after BC1618 treatment, the gene expression profile was significantly enriched in the "CAMKK-dependent AMPK signaling pathway," while significantly negatively enriched in the "HIF1α signaling pathway" and "glycolysis." This suggests that BC1618 may inhibit the transcriptional activity of HIF1α by activating AMPK.

[0063] Figure 6 Figure B shows the relative expression levels of related genes in organoids after BC1618 treatment (*P<0.05, **P<0.01, ***P<0.001). As can be seen from the figure, the mRNA level of CAMKK2 significantly increased after BC1618 treatment. Conversely, the expression of HIF1α and its downstream key target genes, including CA9, SLC2A1, and SLC16A4, was significantly inhibited.

[0064] Figure 6 Figure C shows the immunohistochemical staining of AMPKα and pAMPKα proteins in the LUNG0043 organoid after BC1618 treatment (scale bar: 50 μm). As can be seen from the figure, the pAMPKα protein level also increased significantly after BC1618 treatment.

[0065] Figure 6 Figure D shows the Western blot results of FBXO48 protein levels in sg-Control, sg-FBXO48_1, sg-FBXO48_2, and sg-FBXO48_3 organoids. As can be seen from the figure, all three different sgRNAs can effectively reduce FBXO48 protein expression, with sg3 being used in subsequent experiments.

[0066] Figure 6 E shows the relative expression levels of related genes in sg-Control and sg-FBXO48_3 organoids. As can be seen from the figure, FBXO48 knockout also led to upregulation of CAMKK2 expression and downregulation of HIF1A and its downstream effector molecules, which are highly consistent with the phenotype of pharmacological inhibition of BC1618.

[0067] Figure 6 Figure F shows the Western blot results of AMPKα and pAMPKα protein levels in sg-Control and sg-FBXO48_3 organoids. As can be seen from the figure, consistent with the phenotype of pharmacological inhibition by BC1618, FBXO48 knockout also led to the upregulation of pAMPKα protein levels.

[0068] Figure 6 Figure G shows the Western blot results of AMPKα and pAMPKα protein levels in sg-FBXO48_3 organoids treated with STO-609 (a CAMKK inhibitor). The figure shows that in FBXO48 knockout organoids, the addition of the CAMKK2 specific inhibitor STO-609 completely blocks the increase in pAMPKα levels caused by FBXO48 deficiency. This demonstrates that AMPK activation induced by FBXO48 knockout is strictly dependent on the upstream kinase activity of CAMKK2.

[0069] (7) Regulatory effect of BC1618 on organoid glycolysis Figure 7 This demonstrates the regulatory role of BC1618 in organoid glycolysis, among which, Figure 7Figures A and B illustrate the effect of BC1618 on the glycolytic rate of lung cancer organoids. As shown in the figures, under hypoxic conditions, treatment of LUNG0043 organoids with 20 μM BC1618 for 24 hours significantly reduced their glycolytic rate. This further demonstrates that inhibiting FBXO48 can weaken the glycolytic activity of organoids.

[0070] (8) The cytotoxicity of organoid paclitaxel decreases under hypoxia. Figure 8 The effects of clinical drugs and hypoxia on the viability of lung cancer organoid cells were shown, among which... Figure 8 Figures A and B show the cell viability of lung cancer organoids 72 hours after clinical drug treatment (N represents normoxic, H represents hypoxia). The figures demonstrate that hypoxia selectively affects drug sensitivity. For the anti-angiogenic drugs anlotinib, vinorelbine, and bevacizumab, the organoid models exhibited inherent resistance under both normoxic and hypoxic conditions, unaffected by oxygen concentration. However, for the microtubule inhibitor paclitaxel, we observed a clear hypoxia-induced decrease in sensitivity. Specifically, the mean viability of LUNG0043 was 17.5% under normoxic conditions and 28.9% under hypoxia; the mean viability of LUNG0050 was 12.9% under normoxic conditions and 38.2% under hypoxia. In contrast, other chemotherapeutic drugs, such as gemcitabine, showed relatively mild hypoxia-induced resistance. The mean viability of LUNG0043 was 8.6% under normoxic conditions and 13.8% under hypoxia; the mean viability of LUNG0050 was 10.9% under normoxic conditions and 21.8% under hypoxia. This result clearly identifies paclitaxel as one of the drugs most significantly affected by hypoxia, suggesting that its efficacy may be highly dependent on the oxygenation status of the tumor.

[0071] (9) Targeting FBXO48 can effectively restore the sensitivity of paclitaxel. Figure 9 The study showed that BC1618 combined with paclitaxel treatment can enhance the sensitivity of paclitaxel to lung cancer organoids, wherein... Figure 9 Figure A shows fluorescence images (scale bar: 200 µm) of LUNG0043 / 50 organoids stained with Calcein AM / PI after corresponding treatments. The images show that under hypoxic conditions, the control group organoids exhibited bright, uniform green fluorescence (Calcein-AM, live cells). BC1618 monotherapy resulted in partial red fluorescence (PI, dead cells). Paclitaxel monotherapy also induced moderate cell death. However, in the BC1618 and paclitaxel combined treatment group, green fluorescence almost completely disappeared, replaced by strong red fluorescence, indicating the death of the vast majority of cells, demonstrating an effect far exceeding that of the single-drug combination.

[0072] Figure 9 Figure B shows the cell viability analysis of LUNG0043 / 0050 organoids after treatment with BC1618, PTX, and the combined treatment of BC1618 and PTX. As can be seen from the figure, the cell viability of the BC1618 and paclitaxel combined treatment group was significantly lower than that of any single drug treatment, further demonstrating... Figure 9 The synergistic effect shown in A.

[0073] (10) The combination of BC1618 and paclitaxel produced a significant antitumor effect in the PDOX model. Figure 10 The study demonstrated that the combination of BC1618 and paclitaxel produced a significant antitumor effect in the PDOX model. Figure 10 Figure A shows a schematic diagram of the mouse sacrifice and tumor tissue collection at the experimental endpoint. As can be seen from the figure, the combination of BC1618 and paclitaxel produced the strongest synergistic therapeutic effect, and tumor growth was almost completely inhibited.

[0074] Figure 10 B shows the statistical comparison of tumor weight in each group at the experimental endpoint. As can be seen from the figure, the tumor weight in the combined group was significantly lower than that in any single-drug group, and the difference was extremely significant compared with the control group.

[0075] Figure 10 Figure C shows the dynamic changes in tumor volume in each group during treatment. As can be seen from the figure, the combination of BC1618 and paclitaxel produced the strongest synergistic therapeutic effect. During the treatment, the tumor volume remained stable or even shrank slightly, with the mean tumor volume at the endpoint being only 200 mm.

[0076] Figure 10 Figure D shows the weight change curves of mice in each group during the treatment period. As can be seen from the figure, the weight of mice in each group remained stable during the treatment period, and no significant weight loss (more than 20%) was observed.

[0077] These data strongly demonstrate that, in the in vivo PDOX model, the combination therapy of BC1618 and paclitaxel can produce a synergistic anti-tumor effect, and the dosing regimen is well tolerated, showing clear prospects for clinical translation.

[0078] In summary, this invention is based on the following novel discovery: Under hypoxic conditions, FBXO48 expression is elevated in tumor cells. FBXO48 promotes the degradation of pAMPKα, thereby relieving its negative regulation of HIF1α signaling, leading to upregulation of HIF1α and its downstream target genes (CA9, SLC2A1, SLC16A4), enhancing glycolytic flux, and thus conferring resistance to chemotherapeutic drugs such as paclitaxel to tumor cells. This invention proposes that by using an FBXO48 inhibitor (such as BC1618) to block the above pathway, the sensitivity of tumor cells to chemotherapeutic drugs can be restored. In vitro PDO experiments and in vivo PDOX models have both confirmed that the combined use of BC1618 and paclitaxel produces a synergistic tumor-killing effect under hypoxic conditions, significantly superior to monotherapy. Therefore, this invention provides a novel combination drug and its pharmaceutical applications.

[0079] The embodiments of this invention, using lung cancer organoid and xenograft models as examples, fully demonstrate the significant synergistic effect of the combined application of the FBXO48 inhibitor BC1618 and paclitaxel in overcoming hypoxia-mediated chemotherapy resistance. Those skilled in the art will understand that, based on the core mechanism of "FBXO48 mediating hypoxic paclitaxel resistance through the CAMKK2-pAMPKα-HIF1α signaling axis" disclosed for the first time in this invention, the applicability of this combined treatment strategy is not limited to lung cancer, but can be reasonably extended to other solid tumor types with the following common characteristics, including but not limited to ovarian cancer, breast cancer, cervical cancer, endometrial cancer, and esophageal squamous cell carcinoma. The theoretical basis is as follows: 1. Hypoxic microenvironment is a common feature of various solid tumors. Solid tumors (including gastric cancer, ovarian cancer, breast cancer, cervical cancer, endometrial cancer, head and neck squamous cell carcinoma, and esophageal squamous cell carcinoma) commonly exhibit a hypoxic microenvironment during rapid proliferation due to abnormal angiogenesis and limited oxygen diffusion distance. This hypoxic microenvironment is a key driver inducing chemotherapy resistance and promoting malignant tumor progression. Therefore, intervention strategies targeting hypoxia adaptation pathways have universal value across cancer types.

[0080] 2. The FBXO48-pAMPKα-HIF1α signaling axis is conserved in the above-mentioned cancer types. This invention has demonstrated that FBXO48, as an upstream regulator of hypoxia response in lung cancer, promotes pAMPKα degradation, thereby relieving its negative regulation of HIF1α and activating downstream CA9 and glycolysis pathways, thus mediating paclitaxel resistance. Figure 5Preliminary evidence suggests that hypoxia-induced upregulation of FBXO48 is not limited to lung cancer (LUNG) but can also be observed in other cancer types and organs, including gastric cancer (GC), liver cancer (LC), head and neck squamous cell carcinoma (HNSC), gallbladder cancer (GBC), and colorectal cancer (CO). This demonstrates that the core phenomenon of "FBXO48 upregulation under hypoxic conditions" is universal across cancer types, rather than being specific to lung cancer. Based on this universality and the conservation of molecular evolution, combined with the well-known fact that the hypoxic microenvironment is common to most solid tumors and that paclitaxel is a standard treatment for the aforementioned extended cancer types, it is reasonable to expect that this mechanism will also hold true in solid tumors such as ovarian cancer (OC), breast cancer (BC), cervical cancer (CC), endometrial cancer (UCEC), and esophageal squamous cell carcinoma (ESCC). Those skilled in the art would reasonably expect to extend the combination therapy strategy of the present invention from lung cancer to other solid tumors that also exhibit hypoxia-resistant drug resistance and are treated with paclitaxel, such as gastric cancer (GC), liver cancer (LC), head and neck squamous cell carcinoma (HNSC), gallbladder cancer (GBC), and colorectal cancer (CO), as well as ovarian cancer (OC), breast cancer (BC), cervical cancer (CC), endometrial cancer (UCEC), and esophageal squamous cell carcinoma (ESCC).

[0081] 3. Paclitaxel is the standard treatment for the aforementioned cancers, and its efficacy is inhibited by hypoxia. Paclitaxel, a classic microtubule stabilizer, is a first-line or core chemotherapy drug for ovarian cancer, breast cancer, cervical cancer, endometrial cancer, and esophageal squamous cell carcinoma. Numerous independent studies have shown that in ovarian cancer, the degree of intratumoral hypoxia is significantly associated with paclitaxel resistance and poor patient prognosis; in breast cancer, hypoxia reduces the cytotoxic effect of paclitaxel by upregulating drug efflux pumps (such as ABCB1) and anti-apoptotic proteins via HIF1α; and in cervical cancer, endometrial cancer, and esophageal squamous cell carcinoma, clinical evidence also suggests that hypoxia is an independent risk factor for poor efficacy of paclitaxel-based chemotherapy regimens. Therefore, all of the above-mentioned cancer types face the same problem of "hypoxia-induced paclitaxel resistance" in clinical practice as the lung cancer described in this invention.

[0082] 4. The intervention effect targeting the core nodes of the signal axis has a deducible mechanism. This invention demonstrates that the FBXO48 inhibitor BC1618 reverses hypoxia-mediated paclitaxel resistance by restoring pAMPKα levels and inhibiting the expression of HIF1α and its downstream target genes (CA9, SLC2A1, etc.). Given that the hypoxia adaptation pathway in ovarian cancer, breast cancer, cervical cancer, endometrial cancer, and esophageal squamous cell carcinoma shares the same core molecular node (FBXO48-AMPK-HIF1α) as lung cancer, and that the cytotoxic mechanism of paclitaxel is highly conserved in these cells, those skilled in the art can fully anticipate that BC1618 can also restore the sensitivity of these cancer types to paclitaxel under hypoxic conditions by blocking this signaling axis.

[0083] In summary, the scope of application of the combination therapy strategy (FBXO48 inhibitor + paclitaxel) protected by this invention, based on the "common hypoxic microenvironment," "conserved signal transduction mechanism," and "consistent clinical medication background," can be reasonably extended from lung cancer to ovarian cancer, breast cancer, cervical cancer, endometrial cancer, and esophageal squamous cell carcinoma, which also rely on paclitaxel treatment and exhibit hypoxia-mediated resistance. These cancer types constitute a complete set of technical solutions with a common mechanism of action.

[0084] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of FBXO48 inhibitors in the preparation of drugs to reverse drug resistance in tumor cells, characterized in that, The FBXO48 inhibitor is BC1618; the reversal of tumor cell drug resistance refers to reversing the resistance of tumor cells to paclitaxel.

2. The application of FBXO48 inhibitors in the preparation of paclitaxel-based antitumor drugs, characterized in that, The FBXO48 inhibitor is BC1618.

3. The application of FBXO48 inhibitors in combination with paclitaxel in the preparation of antitumor drugs, characterized in that, The FBXO48 inhibitor is BC1618.

4. The application according to any one of claims 1 to 3, characterized in that, The tumors mentioned are lung cancer, stomach cancer, liver cancer, head and neck squamous cell carcinoma, gallbladder cancer, intestinal cancer, ovarian cancer, breast cancer, cervical cancer, endometrial cancer, or esophageal squamous cell carcinoma.

5. The application according to claim 4, characterized in that, The tumor is lung cancer, stomach cancer, liver cancer, head and neck scleroderma, gallbladder cancer, or intestinal cancer.

6. The application according to claim 5, characterized in that, The tumor is lung cancer.

7. An antitumor drug, characterized in that, The antitumor drug contains an effective amount of a first active ingredient, paclitaxel or a pharmaceutically acceptable salt thereof, a second active ingredient, an FBXO48 inhibitor or a pharmaceutically acceptable salt thereof, and optional pharmaceutically acceptable excipients, wherein the FBXO48 inhibitor is BC1618.

8. The antitumor drug according to claim 7, characterized in that, The antitumor drug is formulated as an injectable preparation.

9. The antitumor drug according to claim 7, characterized in that, The tumors mentioned are lung cancer, stomach cancer, liver cancer, head and neck squamous cell carcinoma, gallbladder cancer, intestinal cancer, ovarian cancer, breast cancer, cervical cancer, endometrial cancer, or esophageal squamous cell carcinoma.

10. The antitumor drug according to claim 9, characterized in that, The tumor is lung cancer, stomach cancer, liver cancer, head and neck scleroderma, gallbladder cancer, or intestinal cancer.

Images