Application of maize ZmDLR9 gene in regulating plant lateral root development

Abstract

This invention discloses corn ZmDLR9 The application of genes in regulating the development of lateral roots in plants belongs to the field of plant genetic engineering and crop genetic improvement technology. ZmDLR9 This gene not only promotes lateral root development in maize, but can also replace the function of its homologous gene in the dicotyledonous plant Arabidopsis thaliana. Through complementation experiments, this was demonstrated... ZmDLR9 The gene's ability to rescue lateral root development defects following the loss of function of its Arabidopsis homolog APUM24 indicates that the gene's function in promoting lateral root development is conserved across species, further supporting this finding. ZmDLR9 The gene promotes lateral root development in plants, rather than through a regulatory mechanism unique to maize. Therefore, ZmDLR9 The gene is involved in regulating the development of lateral roots in both monocots and dicots. It has important agricultural application value for breeding new varieties with more developed lateral root systems, higher nutrient and water absorption efficiency, and stronger resistance to stress (such as drought resistance and tolerance to poor soil).

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and crop genetic improvement technology, specifically relating to maize. ZmDLR9 Application of genes in regulating plant lateral root development. Background Technology

[0002] Maize is one of the world's most important food, feed, and energy crops, and its yield stability is crucial to food security and sustainable agricultural development. Plant roots, especially the lateral root system, are the core organs for plants to anchor themselves in the soil and efficiently absorb water and mineral nutrients. A well-developed and optimized root system can significantly improve a crop's resistance to lodging, nutrient and water use efficiency, and tolerance to abiotic stresses such as drought and infertility. Therefore, improving root system architecture through genetic means is an important approach to breeding high-yielding and stress-resistant new crop varieties.

[0003] Currently, the improvement of root traits largely relies on traditional breeding methods. However, roots are typical underground traits, making accurate phenotypic identification difficult, costly, and highly susceptible to environmental interference, severely limiting breeding efficiency. With the development of molecular biology, direct regulation of key genes in root development through genetic engineering provides a new strategy for the targeted and efficient improvement of root traits.

[0004] In model plants such as Arabidopsis thaliana and rice, several genes related to lateral root development (such as ARF7 / ARF19 and WOX11) have been identified. However, the functions of their orthologous genes in maize are often unclear or accompanied by unfavorable agronomic traits. As a fibrous-rooted crop, maize has a unique mechanism of lateral root development. Although some quantitative trait loci (QTLs) related to maize roots have been reported, most of these QTLs have limited effects, and the key causal genes and their molecular functions remain unclear.

[0005] Therefore, isolating and identifying key genes that play a core positive regulatory role in maize lateral root development, elucidating their functions, and developing technical solutions that can significantly optimize root architecture without affecting other agronomic traits have become critical issues that urgently need to be addressed in maize genetics and breeding. Summary of the Invention

[0006] The purpose of this invention is to provide corn ZmDLR9 Application of genes in regulating plant lateral root development.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows: corn Zm00001d034750 The gene encodes a PUF (Pumilio / FBF) family protein, named ZmDLR9 ( Defective in Lateral Root 9The gene, whose nucleotide sequence is shown in SEQ ID NO.1, and whose encoded protein amino acid sequence is shown in SEQ ID NO.2.

[0008] The inventors of this invention, through their work on corn ZmDLR9 Studies of the lateral root development phenotype of the gene mutant revealed that, compared to the wild-type B73, dlr9-1 and dlr9-2 The mutants all had a significantly reduced number of lateral roots, and dlr9-2 The main root length is less than that of B73, but dlr9-1 The principal root lengths showed no significant difference, indicating that ZmDLR9 Genes positively regulate lateral root development.

[0009] In addition, given that the homolog of the maize ZmDLR9 protein in the dicotyledonous plant Arabidopsis thaliana is APUM24, a T-DNA insertion mutant of APUM24 was identified in Arabidopsis thaliana. apum24-2 Simultaneously, the intermediate carrier pDONR207 was used to transport corn... ZmDLR9 The gene was constructed into the vector pCUN-GW-VENUS, and finally the expression vector was transformed into... apum24-2 In the mutants, the complement lines Comp1 and Comp2 were successfully created. The results showed that after APUM24 function was lost in Arabidopsis thaliana, apum24-2 The mutant showed a significant reduction in both primary root length and lateral root number. However, when using maize... ZmDLR9 Gene replacement apum24-2 Subsequently, the development of the taproot and lateral roots of the Comp1 and Comp2 refilled lines was restored.

[0010] The above results indicate that ZmDLR9 The gene not only promotes lateral root development in maize, but also replaces the function of its homolog APUM24 in the dicotyledonous plant Arabidopsis thaliana, rescuing lateral root development defects caused by the loss of APUM24 function. This indicates that... ZmDLR9 The gene's function in promoting lateral root development is conserved across species, further confirming that... ZmDLR9 The role of genes in promoting lateral root development in plants is not a regulatory mechanism unique to maize, but rather a conserved regulatory process involved in both monocots and dicots.

[0011] Therefore, the present invention protects the above-mentioned corn. ZmDLR9 Application of genes or their encoded proteins in regulating plant lateral root development.

[0012] The present invention also constructs a series of plant expression vectors, and the application of overexpression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes, as well as host cells containing the vectors, in regulating the development of plant lateral roots also falls within the protection scope of the present invention.

[0013] The gene functions protected by this invention include not only those described above. ZmDLR9 Genes, including those related to ZmDLR9 Homologous genes with high homology (such as above 80%; preferably above 90%; preferably above 95%; preferably above 98%) play a role in regulating the development of lateral roots in plants.

[0014] In addition, this invention also protects a method for improving plant root architecture, the method comprising increasing the root structure of the plant. ZmDLR9 Gene expression and / or the activity of the proteins encoded by them; preferably, the plant is maize or Arabidopsis thaliana.

[0015] Among them, improving the plant ZmDLR9 Genes can be expressed in the form of overexpression.

[0016] A method for cultivating transgenic plants with well-developed lateral roots, comprising introducing an expression vector containing the nucleotide sequence shown in SEQ ID NO.1 into a recipient plant, wherein the recipient plant is preferably maize or Arabidopsis thaliana.

[0017] The term "plant" in this invention includes not only maize or Arabidopsis thaliana, but also other monocotyledonous and dicotyledonous plants; any plant that can be transgenic is eligible. Gene expression encompasses the entire plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots, flowers, and other tissues and organs. Enhancement of gene expression in these different parts... ZmDLR9 Gene expression levels.

[0018] This invention also extends to harvestable parts of plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, and other tissues and organs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants. Therefore, a biological product for promoting lateral root development in plants is also protected, comprising the nucleotide sequence shown in SEQ ID NO. 1 or the amino acid sequence shown in SEQ ID NO. 2.

[0019] Advantages of this invention: 1. This invention combines forward genetics with allelic verification, firstly using map-based cloning technology to detect mutations... dlr9-1 The target gene was cloned in China. ZmDLR9 Then, the results of map-based cloning were further verified through allelic testing and genetic complementation, fully ensuring the effectiveness of the cloning. ZmDLR9 The correctness of the gene. For the first time, it has been identified and functionally validated in maize. ZmDLR9 The core positive regulatory role of genes in lateral root development provides a novel key gene resource for the genetic improvement of maize root system.

[0020] 2. This invention comprehensively utilizes multiple techniques, including genetics, molecular biology, and cell biology, to confirm that... ZmDLR9 The gene is used to regulate cell division activity in the later stages of lateral root development, revealing the molecular and cellular mechanism by which it regulates lateral root formation by influencing the cell division activity in the later stages of lateral root primordia.

[0021] 3. This invention deepens our understanding of the relationship between maize root morphogenesis and drought stress, providing an important theoretical basis and genetic resources for future breeding or design of more effective root structures and the creation of more drought-resistant maize varieties.

[0022] 4. The present invention provides Zm00001d034750 ( ZmDLR9 This gene can serve as a key target for molecular breeding of maize and other gramineous crops. By creating functionally enhanced allelic variants through gene editing (such as CRISPR / Cas9) or by overexpressing this gene in recipient plants through transgenic technology (using appropriate tissue-specific or inducible promoters), it is possible to breed new varieties with more developed lateral root systems, higher nutrient and water absorption efficiency, and stronger stress resistance (such as drought resistance and tolerance to poor soil), which has important agricultural production application value. Attached Figure Description

[0023] Figure 1 The wild-type B73 maize and its mutant in Example 1 of this invention. dlr9-1 Seedling root phenotypes; where A represents B73 and the mutant. dlr9-1 Root phenotype of seedlings 7 days after germination, scale bar = 5 cm; B represents B73 and mutant. dlr9-1 Main root length statistics; C represents B73 and mutant. dlr9-1 Statistical analysis of the number of lateral roots; D represents B73 and mutant. dlr9-1 The curve showing the increase in the number of lateral roots over time; E represents B73 and the mutant. dlr9-1 The curve showing the increase in principal root length over time.

[0024] Figure 2 For the heterozygous and homozygous compounds in Embodiment 1 of the present invention dlr9-2 The root phenotype of seedlings; where A represents ZmDLR9 grown for 10 days under liquid culture conditions. dlr9-2 / + (Heterozygote, left) and ZmDLR9 dlr9-2 / dlr9-2 (Homozygous, right) Representative seedling phenotype of the plant. Scale bar = 5 cm; B represents the root phenotype of the seedling shown in Figure A. Scale bar = 5 cm; C represents heterozygous and homozygous seedlings. dlr9-2 Statistical analysis of taproot length in seedlings; D represents heterozygotes and homozygotes. dlr9-2Seedling lateral root length statistics; E represents wild-type B73, heterozygous and homozygous. dlr9-2 Genotyping of seedlings.

[0025] Figure 3 The corn B73 and in Embodiment 2 of the present invention dlr9-1 Phenotype of lateral root primordia in seedling roots; where A represents B73 and mutant. dlr9-1 Folden staining of lateral root primordia; B indicates B73 and mutant. dlr9-1 Statistical analysis of the number of primordia on the main root and lateral roots; C represents B73 and the mutant. dlr9-1 Detection of lateral root primordium cell division activity; D represents B73 and mutant. dlr9-1 Statistical analysis of EdU-labeled lateral root primordia cells.

[0026] Figure 4 In Embodiment 3 of the present invention ZmDLR9 Map-based cloning and allelic complementation verification; Figure A shows the results generated by MutMap analysis. dlr9-1 Genome-wide single nucleotide polymorphism (SNP) index diagram of mutants; where B represents dlr9- 1 SNP index diagram of mutants on chromosome 1; C represents ZmDLR9 Map-based clonal localization of the gene. The gene was initially located on chromosome 1 between molecular markers M1 and M3. The numbers below the molecular markers indicate its location... dlr9-1 SNP index value in the B73F2 population; D indicates ZmDLR9 The gene structure is shown. Black boxes indicate exons, black lines indicate introns, yellow boxes indicate the 5′ and 3′ untranslated regions, and red arrows mark the regions. dlr9-1 and dlr9-2 Mutants in genes ZmDLR9 The mutation sites, P1 and P2, correspond to respectively dlr9-1 and dlr9-2 The mutation location; E indicates phenotypic validation of the allelic test, demonstrating the parental B73 and dlr9-1 and homozygous dlr9-1 with heterogeneity dlr9-2 Lateral root phenotype of F1 seedlings from hybrid offspring. Scale bar = 2cm; F represents the taproot length statistics for each seedling type in Figure E; Figure G represents the lateral root number statistics for each seedling type in Figure E; H represents homozygosity in allelism test. dlr9-1 with heterogeneity dlr9-2 Genotyping of F1 seedlings from hybrid offspring. Analysis of candidate genes in F1 seedlings. ZmDLR9 Two genotypes.

[0027] Figure 5 In embodiment 4 of the invention ZmDLR9Expression pattern; where A represents transient co-expression of ZmDLR9-RFP and the nucleolar marker protein AtFIB1-GFP in leaves of Nicotiana benthamiana, both fusion proteins being driven by the 35S promoter. The merged image shows ZmDLR9-RFP localized in the nucleolar. Scale bar = 20 μm; B indicates the subcellular localization of ZmDLR9 in maize protoplasts. ZmDLR9-RFP is co-expressed with the nucleolar marker protein AtFIB1-GFP. The merged image shows ZmDLR9-RFP localized in the nucleolus. Scale bar = 5 μm.

[0028] Figure 6 In embodiment 5 of the invention ZmDLR9 Heterologous expression in dicotyledonous Arabidopsis thaliana; where A represents APUM24 The exon-intron structure of the gene is shown in the diagram, with T-DNA insertion sites marked. Arrows indicate primer positions used for genotyping; B represents a schematic diagram of the heterologous expression vector of the ZmDLR9 gene, with arrows indicating primer positions used for genotyping; C represents wild-type Col-0 and mutant. apum24-2 And transformed pUBQ::ZmDLR9 builder apum24-2 Genomic DNA genotyping PCR results of complementary lines (Comp-1 and Comp-2); D indicates wild-type Col-0, mutant apum24-2 And the root phenotypes of complementary lines Comp-1 and Comp-2. Scale bar = 1 cm; E represents wild-type Col-0, mutant. apum24-2 and the primary root lengths of the complementary lines Comp-1 and Comp-2; F represents wild-type Col-0, mutant apum24-2 And the number of lateral roots of the complementary lines Comp-1 and Comp-2. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0030] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1: Corn dlr9 Mutant lateral root development phenotype identification Ingredients: Corn ZmDLR9 (Zm00001d034750) gene mutant, named in this application dlr9 : defect in lateral root 9 ), mutant dlr9-1 This mutant was obtained in the laboratory through ethyl methyl ester (EMS) mutagenesis based on wild-type B73 material. dlr9-2 It comes from the EMS-induced mutation library of maize inbred lines (maizeEMSDB).

[0033] Methods: Uniform corn seeds were selected, soaked overnight in deionized water, and then germinated on moist filter paper before being transplanted into Hoagland nutrient solution for hydroponics. Growth conditions: 16 h light / 8 h dark, 28℃ during the light period and 24℃ during the dark period. Root phenotypes were observed and scanned at different growth days (e.g., 3-7 days), and the length of the taproot and the number of lateral roots were counted using image analysis software (e.g., ImageJ). Hoagland nutrient solution preparation: 5 mM KNO3, 5 mM Ca(NO3)2•4H2O, 2 mM KH2PO4, 1 mM MgSO4•7H2O, 1 mM Fe-EDTA, 1 μM MnCl2•4H2O, 1 μM H3BO3, 1 μM ZnSO4•7H2O, 0.01 μM CuSO4•5H2O, 0.005 μM (NH4)6Mo7O 24 Result: As Figure 1 and Figure 2 As shown, compared to wild-type B73, dlr9-1 and dlr9-2 The mutants all had a significantly reduced number of lateral roots, and dlr9-2 The main root length is less than that of B73, but dlr9-1 The principal root lengths showed no significant difference, indicating that ZmDLR9 Genes positively regulate lateral root development.

[0034] Example 2: Analysis of Lateral Root Primordial Development and Cell Division Activity Based on the above research results, the inventors further observed in detail the formation and development of lateral root primordia in the early stage of lateral root development using the Forgen staining method. Lateral root growth originates from the continued growth and development of lateral root primordia after they break through the cortex and epidermis. To explore...dlr9-1 Whether the defects in lateral roots are due to a reduction in lateral root primordia or developmental inhibition. The inventors took maize B73 grown for 4 days and dlr9-1 The taproot system of the seedlings. Detailed observation and statistical analysis were performed using Fork root staining. dlr9-1 The number of lateral root primordia, the results showed dlr9-1 There was no significant difference in the number of lateral root primordia between B73 and B74. Figure 3 (A and B in the text). This indicates that... dlr9-1 The initiation of lateral root primordia was normal; the defect occurred in the later stages of lateral root primordia development. Furthermore, the inventors used an EdU assay kit to detect the cell division activity of the lateral root primordia, and the results showed... dlr9-1 Cell division activity was significantly lower than that of wild-type B73 ( Figure 3 (C and D in the above results). dlr9-1 The developmental defect of the lateral root primordia is caused by the reduced cell division activity in the later stage of lateral root primordia development, which leads to slow development of the lateral root primordia and their inability to break through the cortex in time.

[0035] Forgen staining method: (1) Select maize inbred line B73 and target mutant seedlings that have germinated for 4 days and cut complete primary roots with a sharp and clean blade. After cutting, the roots are quickly dried with absorbent paper and then placed in 6 N hydrochloric acid (HCl) solution for vacuum treatment. The vacuum degree is maintained at 0.8 MPa and the vacuum time is controlled at 30-50 min to ensure that the acid solution fully penetrates the root tissue. The purpose is to perform acid hydrolysis to soften the cell wall and promote subsequent staining observation. Preparation method of 6 N HCl solution: Take 247 mL of commercially available concentrated hydrochloric acid (specific gravity 1.19, mass fraction about 37%), slowly add it to deionized water, and make up to 500 mL. Mix well to obtain 6 N HCl solution (the operation should be carried out in a fume hood and pay attention to protection). (2) After acid hydrolysis, discard the hydrochloric acid solution and gently rinse the roots with deionized water 2-3 times until there is no acid residue on the surface. (3) Then, gently absorb the moisture from the root surface with clean tissue paper and transfer the sample into Schiff reagent for staining. Continuously observe during the staining process, and stop staining when the lateral root primordia appear distinctly red (indicating that the intracellular polysaccharides are specifically stained by Schiff reagent). (4) Finally, use an EPSON scanner to perform a whole-body scan of the stained root system to obtain high-resolution images for subsequent observation and statistical analysis of the lateral root primordia.

[0036] EdU detection method for cell division activity: (1) Material treatment: collect the roots of 4-day-old maize seedlings, select the mature area of ​​the primary roots of the seedlings, and cut them into 0.5-1 cm segments. (2) EdU labeling: incubate the root segments with 10 μM EdU (purchased from Ribobio Cell-Light™ EdU Apollo®488 In Vitro Kit) solution overnight. (3) Slice preparation: wash the labeled root segments with 1×PBS buffer, embed them in 4% agarose, and cut them into 50 μm thick slices using a vibrating microtome. (4) Sample selection and staining: select slices containing lateral root primordia (LRPs) under a stereomicroscope, fix and stain them according to the kit instructions. (5) Imaging and statistics: observe and acquire images using a confocal microscope. The positive cell density is calculated by dividing the number of labeled cells in each LRP by the area of ​​the LRP.

[0037] Example 3: Map-based cloning and verification of the ZmDLR9 gene Using BSA pooled sequencing and Mutmap analysis technology ( Figure 4 (As shown in A and B in the figure), for dlr9-1 The mutant gene was located within the mutant. The location results showed that ZmDLR9 is located at the end of chromosome 1. Further analysis using molecular markers revealed candidate genes located between 291 Mb and 302 Mb. Within this candidate interval, only Zm00001d034750 (…) was found. ZmDLR9 A valid mutation exists. ZmDLR9 encodes a PUF family protein with a typical pumilio domain. Mutation dlr9-1 The mutation causes premature termination of translation of the amino acid encoded by ZmDLR9. Figure 4 (D in the middle).

[0038] dlr9-2 Mutation leads to ZmDLR9 A mutation occurred in the Splice site acceptor at the second intron of the gene, which led to ZmDLR9 The mistranslation led to the loss of protein function. To verify this candidate gene... ZmDLR9 The applicant used ZmDLR9 Allelic mutants of genes dlr9-2 (Hybrid) and dlr9-1 (Homozygous) hybridization was performed, and the root phenotype of the F1 seedlings was observed and statistically analyzed. The results showed that the F1 seedlings exhibited characteristics similar to those of the mutant parents. dlr9-1 Consistent lateral root defect phenotype. This indicates... dlr9-1 and dlr9-2 Phenotypes that cannot mutually compensate for root defects. Further utilization of primers dlr9-1 _F and dlr9-1 _R, anddlr9-2 _F and dlr9-2 _R respectively for passing ZmDLR9 Two mutation sites in the gene were amplified, and the F1 segregating seedling phenotype was detected by Sanger sequencing. The results showed linkage between genotype and phenotype, further demonstrating that... ZmDLR9 dlr9-1 and ZmDLR9 dlr9-2 This confirms that Zm00001d034750 is an allele, further validating its role. ZmDLR9 .

[0039] Identification primers: dlr9-1 _F:GTACAACGGACTGGCGTACA (SEQ ID NO.3) dlr9-1 _R: CTGACTTGAATGGCGTGGTG (SEQ ID NO.4) dlr9-2 _F:GCCAGGACACAGGCAACATA (SEQ ID NO.5) dlr9-2 _R:TCCAGAGAGCCAGTTTCTGC (SEQ ID NO. 6).

[0040] Example 4: Subcellular localization of ZmDLR9 protein Vectors: The intermediate vector pDONR207, the subcellular localization vector pK7RWG2, and the nucleolar marker vector (AtFIB-GFP) were all from our laboratory research group.

[0041] Maize was cloned using primers ZmDLR9-EN207-F and ZmDLR9-EN207-R. ZmDLR9 The gene (primer sequences are shown below) was constructed into the intermediate vector pdonr207, forming pdonr207-ZmDLR9. The gene was then reacted with the final vector pk7RWG2 via an LR reaction to construct an overexpression 35S promoter. ZmDLR9 Simultaneously, the carrier of RFP ( 35S::ZmDLR9:RFP Meanwhile, a laboratory-constructed nucleolar marker (AtFIB1-GFP) was used as a control. Both vectors were co-expressed in tobacco and maize protoplast systems, respectively, and observations were performed using laser confocal microscopy. Figure 5 The results showed that ZmDLR9 and the nucleolar marker could co-localize in both systems. These results indicate that... ZmDLR9 It encodes nucleolar proteins.

[0042] Cloning gene primers: ZmDLR9-EN207-F: ACAAAAAAGCAGGCTCCATGGCAGGCGGCGGTCTCC (SEQ ID NO.7) ZmDLR9-EN207-R: TACAAGAAAGCTGGGTCTTTTTTGAACAACCTTAGGG (SEQ ID NO. 8).

[0043] Example 5: Verification of the functional conservation of ZmDLR9 in Arabidopsis thaliana Materials: Arabidopsis thaliana mutants apum24-2 These are mutant seeds purchased by the laboratory in the early stages.

[0044] Gene cloning construction vector: The empty vector pCUN-VENUS used for heterologous expression was provided by Professor Guo Siyi in our laboratory, and was later modified by our laboratory into pCUN-GW-VENUS.

[0045] The homolog of maize ZmDLR9 protein in the dicotyledonous plant Arabidopsis thaliana is APUM24. To investigate whether ZmDLR9 is functionally conserved in both monocotyledonous and dicotyledonous plants, the applicant first identified a T-DNA insertion mutant of APUM24 using primers F1, R1, and R2. At3g16810 () Figure 6 (A) Meanwhile, the maize gene was delivered using the intermediate vector pDONR207. ZmDLR9 Constructed into the pCUN-GW-VENUS vector ( Figure 6 (B in the text), and finally the expression vector is transformed to apum24-2 Complementary lines Comp1 and Comp2 were created from the mutant. F2 and R3 were used to identify the heterologous expression vector pCUN-ZmDLR9-VENUS. The identification results are as follows: Figure 6 As shown in C. The results show that after the loss of APUM24 function in Arabidopsis thaliana, apum24-2 Both the length of the central taproot and the number of lateral roots were significantly reduced. Figure 6 (DF in the middle). However, utilizing corn ZmDLR9 Gene replacement apum24-2 Subsequently, the Comp1 and Comp2 replanted lines recovered the development of their taproots and lateral roots, indicating that... ZmDLR9 Genes can promote the development of lateral roots in plants, through... ZmDLR9 Overexpression can be used to cultivate transgenic plants with an increased number of lateral roots. These results also indicate... ZmDLR9 The gene is involved in regulating lateral root development in both monocots and dicots and has a conserved function.

[0046] Primer F1 sequence: GGATCTTGTTATGGACAAGG (SEQ ID NO.9) Primer R1 sequence: AGTGAGGCCGTTGCATCATT (SEQ ID NO.10) Primer R2 sequence: TGGTTCACGTAGTGGGCCATCG (SEQ ID NO.11) Primer F2 sequence: GCATATGCAGCAGCTATATG (SEQ ID NO.12) Primer R3 sequence: GAAGGTTGGCAACACGAC (SEQ ID NO.13).

[0047] In conclusion, ZmDLR9 The gene is involved in regulating the development of lateral roots in both monocots and dicots. In actual production, by overexpressing the gene in recipient plants through transgenic technology (using appropriate tissue-specific or inducible promoters), new varieties with more developed lateral root systems, higher nutrient and water absorption efficiency, and stronger stress resistance (such as drought resistance and tolerance to poor soil) can be bred, which has important agricultural production application value.

[0048] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Corn ZmDLR9 The application of genes or their encoded proteins in regulating plant lateral root development, characterized by: The plant is maize or Arabidopsis thaliana. ZmDLR9 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein is shown in SEQ ID NO.

2. The regulation is characterized by: compared with the wild type, maize... ZmDLR9 Gene mutants and Arabidopsis thaliana ZmDLR9 The number of lateral roots was significantly reduced in homologous gene mutants; moreover, in Arabidopsis thaliana... ZmDLR9 Maize with heterologous expression in the context of homologous gene mutants ZmDLR9 In the restored strains obtained from the gene, the development of lateral roots returned to normal.

Images