Use of a SNP molecular marker associated with cow viability

By detecting the genotype of the SNP molecular marker chr6:g.88919352 A>G, the problem of high mortality during lactation in dairy cows was solved, enabling early screening of cow viability and efficient breeding, thereby improving the reproductive rate of dairy cow herds and farm profitability.

CN122256530BActive Publication Date: 2026-08-04INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI
Filing Date
2026-05-25
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

The lack of existing technologies for genetic-level research on methods to improve mortality rates in lactating dairy cows has led to a decline in the stability and productivity of dairy herds, as well as an increase in culling rates and rebreeding costs.

Method used

By detecting the genotype of the SNP molecular marker chr6:g.88919352 A>G, PCR amplification and sequencing technologies are used to determine the viability of cows, providing SNP molecular markers related to cow viability and guiding production practices.

Benefits of technology

It can effectively predict the risk of mortality in lactating dairy cows, increase the frequency of high-survival-rate genotypes in the cow population, extend the service life of cows, reduce breeding costs, and increase fertility and ranch profits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

The application discloses application of a SNP molecular marker related to cow survivability and belongs to the technical field of dairy cow breeding markers. The cow survivability is the genetic ability of a cow to survive and remain in a lactating group after entering the lactating group. The SNP molecular marker is used to determine the high and low survivability of the cow. The SNP molecular marker is chr6:g.88919352 A>G, the coordinate position is taken as the standard of the bovine reference genome version UMD3.1, and the NCBI reference sequence is AC_000163.1. The SNP molecular marker genotypes of the cow survivability from high to low are GG, GA and AA in sequence. By detecting the genotypes of the SNP site in the blood or other tissue samples of the cow, the risk of the cow in the lactation period can be effectively predicted, early screening and cultivation are carried out, and the service life of the cow is prolonged.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of dairy cow breeding marker technology, specifically to the application of a SNP molecular marker related to cow viability. Background Technology

[0002] The lactation period is the peak milk production period for dairy cows and a crucial stage in their production cycle. The death of a dairy cow during lactation disrupts the herd's normal production rhythm, affecting herd stability and continuous performance. It also means the direct loss of that cow's milk production potential and future reproductive value throughout the lactation cycle, while increasing culling rates and rebreeding costs.

[0003] In CDCB (Dairy Boar Breeders Database) genetic assessments, cow viability typically refers to the trait CowLivability (LIV): it assesses a cow's genetic ability to "avoid death on the farm and remain alive in the lactating herd" after entering the milking herd. The difference between cow viability and Productive Life (PL): PL reflects "how long a cow can stay in the herd," including both culling and death; while LIV focuses more on death itself (reducing culling / loss).

[0004] Previous studies have shown that mortality in lactating dairy cows is usually related to the lactation stage, parity, breed, and management practices. Therefore, efforts to improve mortality rates have mostly focused on these aspects. Currently, there are no published research findings on the genetic level. Summary of the Invention

[0005] The purpose of this invention is to address the gap in existing research on genetic factors in lactating dairy cows by providing an application of SNP molecular markers related to cow viability. By detecting the genotype of these SNP molecular markers, cow viability can be determined, thereby guiding production practices.

[0006] In a first aspect, the present invention provides an application of SNP molecular markers related to cow viability to determine the level of cow viability, wherein cow viability is the genetic ability of a cow to survive and remain in the lactating herd after entering the lactating herd. The SNP molecular marker is chr6:g.88919352 A>G, and the coordinate position is based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000163.1. The SNP molecular marker genotypes for cow survival, from highest to lowest, are AA, AG, and GG.

[0007] Optionally or preferably, the SNP molecular marker is the 95th nucleotide shown in SEQ ID NO:1 in the sequence listing, with a polymorphism of A or G.

[0008] Optional or preferred methods for determining the viability of cows include the following steps: (1) Extracting genomic DNA from cows; (2) Using the genomic DNA obtained in step (1) as a template, and the nucleotide sequences shown in SEQ ID NO:2~3 as primers, PCR amplification was performed to obtain amplification products containing SNP molecular markers; (3) Sequencing of the amplification product. The 95th position of the amplification product is the SNP molecular marker. The SNP molecular marker genotypes of cows with high to low survival rate are AA, AG, and GG.

[0009] Secondly, the present invention provides the application of products for detecting SNP molecular markers in determining the viability of cows. The products include primer pairs, such as detection kits, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO:2~3. The SNP molecular marker is chr6:g.88919352 A>G, and the coordinate position is based on the bovine reference genome version UMD3.1 and the NCBI reference sequence AC_000163.1. The SNP molecular marker genotypes for cow survival, from highest to lowest, are AA, AG, and GG.

[0010] Compared with the prior art, the present invention has the following beneficial effects: This invention has discovered a single SNP (chr6:g.88919352 A>G) whose genotype polymorphism is significantly correlated with the survival rate of cows. By detecting the genotype of this SNP locus in cow blood or other tissue samples, the risk of mortality during lactation can be effectively predicted. Early screening and breeding can increase the frequency of high-survival-rate genotypes in the cow population, thereby increasing the reproductive rate of dairy cows, extending the service life of cows, reducing breeding costs, and increasing farm profits. Detailed Implementation

[0011] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all of the embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0012] Example 1: SNP site screening and identification of dominant genotypes 1. Screening for SNP loci (1) A total of 1,557 calved Chinese Holstein cows were sampled from 7 large-scale farms across the country. The location of the farms and the number of samples collected from each farm are shown in Table 1.

[0013] Table 1. Location of the pastures where samples were collected and the number of samples collected. (2) Genomic DNA was extracted from the samples, and the genotype of the collected samples was determined using the Illumina Bovine SNP50 chip. The determination and analysis of genotypes were performed by Neocare Biotech (Shanghai) Co., Ltd., and the genotypes of 49,482 SNP marker loci were obtained. The genomic breeding value (LIV_GEBV) of each individual cow was estimated based on the genotype.

[0014] (3) Genome-wide association analysis was performed on the genomic breeding values ​​of cow viability using GEMMA software based on genotype data. A mixed linear model was used as the analysis model, with pasture location and cow age as covariates. Multiple regression analysis was performed using the FDR method. The association analysis results showed that the most significant SNP locus was located on chromosome 6 at position 88919352, with a significance P-value of 5.16E-13 after multiple regression analysis.

[0015] 2. Identification of dominant genotypes at SNP loci Among the sampled Chinese Holstein cattle, 627 individuals with the homozygous AA genotype at the SNP locus were identified, with a mean genomic estimated breeding value for cow viability of 0.9921; 738 individuals with the heterozygous AG genotype were identified, with a mean genomic estimated breeding value for cow viability of 0.4498; and 192 individuals with the homozygous GG genotype were identified, with a mean genomic estimated breeding value for cow viability of 0.3671. In genomic genetic assessment, a higher genomic estimated breeding value for cow viability is better; therefore, the AA genotype at this SNP locus is the dominant genotype.

[0016] Example 2: Association Analysis of SNP Locus Genotypes with Cow Viability 1. Amplification of SNP loci sequences, detection and analysis of SNP genotype and allele frequency distribution. To determine whether the genotypes of the SNP loci selected in this application are related to the viability of cows, 1151 young Holstein cows from China were selected for association analysis between genotype and the estimated breeding value of cow viability.

[0017] (1) Blood collection from the tail vein of cattle 1151 cattle with estimated genomic viability for breeding were selected as experimental subjects. Blood was collected from the tail veins of the cattle, and genomic DNA was extracted.

[0018] (2) Primer design Based on the bovine gene sequence containing the SNP sites identified in Example 1, a pair of specific primers was designed. The forward primer is 5F (SEQ ID NO:2): GTTGGAGGGTTTTGAGCACAG; The reverse primer is 3R (SEQ ID NO:3): AAGCGGTTAAGAAACATCAGGC.

[0019] (3) Complex enzyme chain reaction Using genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The genotypes of the obtained PCR products were determined using Sanger sequencing, and the sequences are as follows: GTTGGAGGGTTTTGAGCACAG GATATTCTGTTTTGAAAGTTACATGCTGGCTACTCTATGAGGATGAATTATGTGGGTGTAAGGGAAAATAGCT A TAGTTATCTAGGTGAAGAGTGGTTAGATTCTGGACACATTTTTAAAGACATAGTTGATAGGTCCTGCTCTCAGATTGGATATGGGGTACAAAAGAAAGAGCTAAGTCTAAATTTATTTATTGTAAATTATTGCTTCTGATGAACTAAAAGCAATGAAGACTGAGGATGAGATCATAGGTATGGCACGTATGATCAGATGTT CTATTTAGGGTGTGTTAAGTTTGGGGTGCCTATTTGATGTCAAAGGGAAATGTCAGCTGTTCTTTGATAAGAATCCAGACTTCAAGGAAGAGATTCAGACTAAATACATAAATTCTACTTACAATGATCATATTACTTTGAAAACTTACCTAGTAATACTTTGAGAATGTTATGTTGGTTTTGTCTTCCACTCACAAATTT GCCTGATGTTTCTTAACCGCTT (SEQ ID NO:1).

[0020] The SNP site is located at position 95, with polymorphisms of A or G, and is indicated by bold and underline in the sequence.

[0021] (4) Distribution frequency of different genotypes at SNP loci The results of the analysis of allele frequency distribution at SNP loci are shown in Table 2.

[0022] Table 2. Distribution of different SNP genotypes in Chinese Holstein cattle population. The results showed that among all the tested groups, the frequency of the AA gene was 32.41%, the frequency of the AG genotype was 46.48%, the frequency of the GG genotype was 21.11%, and the AA genotype was the dominant genotype.

[0023] (5) Association between different SNP loci genotypes and estimated breeding values ​​of cow viability Association analysis of SNP locus genotypes and estimated breeding values ​​of cow viability in 1151 Chinese Holstein cattle.

[0024] Association analysis was performed between this SNP locus and LIV_GEBV. The results showed that the mean LIV_GEBV values ​​for the AA, AG, and GG genotypes were 1.529, 1.017, and 0.700, respectively, exhibiting a decreasing trend from AA to AG to GG. One-way ANOVA indicated that the differences in LIV_GEBV among different genotypes were highly significant (F(2,1148)=32.544, P=1.79×10⁻⁶). -14 Genotype can explain approximately 5.4% of LIV_GEBV variation. Additive dosing models showed that for each additional allele, LIV_GEBV decreased by an average of 0.424 (P = 3.87 × 10⁻⁶). -15 The additive-dominant model further indicates that this site primarily exhibits a significant additive effect, with no significant deviation from dominance. Therefore, this SNP is significantly associated with LIV_GEBV.

[0025] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. The application of primer pairs for detecting SNPs in the preparation of reagents for determining the viability of cows, characterized in that, The SNP is chr6:g.88919352 A>G, with coordinates based on bovine reference genome version UMD3.1 and NCBI reference sequence AC_000163.1; The cow viability is the genetic ability of a cow to survive and remain in the lactating herd after entering the herd. The SNP genotypes for cows, from highest to lowest survival rate, are AA, AG, and GG.

2. The application according to claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2~3.

3. The application of primer pairs for detecting SNPs in the preparation of a kit for assessing the viability of cows, characterized in that... The SNP is chr6:g.88919352 A>G, with coordinates based on bovine reference genome version UMD3.1 and NCBI reference sequence AC_000163.1; The cow viability is the genetic ability of a cow to survive and remain in the lactating herd after entering the herd. The SNP genotypes for cows, from highest to lowest survival rate, are AA, AG, and GG.

4. The application according to claim 3, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2~3.