A primer probe set, kit and method for detecting carbapenem-resistant gene by POCT
Patent Information
- Application Number
- CN202610716119.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-22
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2046-05-22
AI Technical Summary
[0008]为了解决本领域现有技术存在的缺乏直接直肠拭子/粪便等作为样本、能覆盖多种亚型、高包容性的碳青霉烯耐药基因的POCT检测产品及方法的技术问题,本发明提供一种 POCT 检测碳青霉烯耐药基因的引物探针组、试剂盒及方法
1)本发明设计并优化了一种核酸提取试剂,可直接从直肠拭子、粪便、拭子洗脱液、培养物和纯化核酸中提取核酸。
Smart Images

Figure CN122256545B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, and in particular to a primer and probe set, kit, and method for POCT detection of carbapenem resistance genes. Background Technology
[0002] Carbapenem-resistant Enterobacteriaceae (CRE) refers to Enterobacteriaceae that are resistant to any carbapenem antibiotic, such as imipenem, meropenem, ertapenem, or doribenem, or that are confirmed to produce carbapenemase.
[0003] Carbapenems are currently a powerful class of antibacterial drugs used clinically for bacterial infections, exhibiting strong antibacterial activity and a broad antibacterial spectrum. However, with the widespread use of carbapenems, cases of carbapenem insensitivity and even the emergence of drug-resistant bacteria have arisen, significantly limiting their use. A key reason for this phenomenon is the acquisition of carbapenemase genes by bacterial strains. KPC, NDM, VIM, IMP, OXA, and GES are the most common carbapenemase genes. Among these, plasmid-borne carbapenemase genes, due to the presence of transfer-mediated gene elements in their resistance gene environment, are easily transferred between different bacteria, leading to the widespread dissemination of carbapenemase resistance and becoming a major focus of clinical microbiology in recent years. The emergence and prevalence of carbapenem-resistant bacteria have brought great difficulties to clinical anti-infective treatment and hospital infection control. For effective diagnosis and control of carbapenem-resistant infections (CRE), CRE diagnosis is necessary. Current diagnostic methods include: Carba NP test: This is a phenotypic detection method for carbapenemases in Enterobacteriaceae. It is simple and rapid, and has good sensitivity (>90%) and specificity (>90%) for detecting KPC and NDM. However, it has low sensitivity for OXA-48 and is prone to false negatives.
[0004] The modified carbapenem inactivation method (mCIM) and the EDTA-carbapenem inactivation method (eCIM) show sensitivities of up to 99% against KPC, NDM, and OXA-48. However, this method may miss strains expressing low levels of metalloenzymes, or produce false negatives when the EDTA concentration is insufficient. High concentrations of EDTA may inhibit the growth of certain bacteria (such as Pseudomonas aeruginosa), leading to biased results. Furthermore, this method cannot accurately genotype drug resistance genes.
[0005] Boric acid synergistic assay: Boric acid can inhibit KPC enzyme activity. Boric acid combined with meropenem or imipenem susceptibility testing discs can effectively detect KPC enzyme-producing Enterobacteriaceae, but it is not suitable for detecting other drug resistance genes.
[0006] Immunochromatography (colloidal gold method): Commercially available colloidal gold test strips are available that can simultaneously and rapidly detect KPC, NDM, VIM, IMP, and OXA-48, providing results within 20 minutes. Sensitivity and specificity are both above 90%. Immunochromatography is simple to operate and results are easy to interpret, but it is relatively expensive. It is suitable for the rapid detection of carbapenemase types in CRE strains isolated from high-risk patients (immunosuppressed patients or bone marrow transplant patients, etc.).
[0007] PCR method: This method amplifies target nucleic acids using primers, enabling the detection of KPC, NDM, VIM, IMP, OXA (including OXA-48, 23, 51, etc.), and GES resistance genes. Compared to methods such as the Carba NP assay, mCIM combined with eCIM, boric acid synergistic assay, and colloidal gold assay, PCR can use nucleic acid extracted from rectal swabs as samples, eliminating the need for bacterial isolation and culture. The entire process from sampling to result reporting takes only 1-2 hours, making it simple and low-risk. However, existing PCR methods for CRE identification generally require complex sample pretreatment or extraction of fecal samples, leading to cumbersome procedures and a high risk of contamination. For example, patent CN116083608A uses a PCR method based on gel electrophoresis, with culture as the sample type. After amplification, electrophoresis is still required for final identification, posing a significant risk of aerosol contamination. Furthermore, this patent only detects KPC and NDM genes and does not perform inclusion analysis; the inclusion of its primers and probes is unknown. Patent CN116479148A still requires the use of commercially available kits to extract nucleic acids from fecal or rectal swabs. This patent also lacks inclusion analysis, and the inclusion of its primers and probes is unknown. Patent CN116875717A requires complex sample pretreatment for rectal swabs and only detects KPC-2, KPC-3, NDM-1, and NDM-5 types; the inclusion of its primers and probes is also unknown. KPC, NDM, VIM, IMP, GES, and OXA subtypes are numerous, especially OXA, with as many as 1285 subtypes. These subtypes have poor conservation, and a highly inclusive detection system is lacking. There is an urgent need for a highly automated, sensitive, rapid, low-pollution, and highly inclusive point-of-care testing (POCT) method that directly uses rectal swabs / feces as samples and integrates nucleic acid extraction, purification, and amplification systems. Summary of the Invention
[0008] To address the technical problem of the lack of POCT detection products and methods in the field that can use direct rectal swabs / feces as samples, cover multiple subtypes, and have high inclusiveness of carbapenem resistance genes, the present invention provides a primer and probe set, kit, and method for POCT detection of carbapenem resistance genes.
[0009] To achieve the above objectives, the present invention adopts the following technical solution: A primer and probe set for POCT detection of carbapenem resistance genes, wherein the carbapenem resistance genes include: NDM, KPC, VIM, IMP, OXA, and GES; The primers and probes for the NDM gene include: SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; The primers and probes for the KPC gene include: SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6; The primers and probes for the VIM gene include: SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9; The primers and probes for the IMP gene include: SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12; The primers and probes for the OXA gene include: SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21; The primers and probes for the GES gene include: SEQ ID NO.22, SEQ ID NO.23 and SEQ ID NO.24.
[0010] The primer and probe set for POCT detection of carbapenem resistance genes further includes: internal standard primers, as shown in SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.27; Preferably, the primer and probe set for POCT detection of carbapenem resistance genes is specifically designed for detection in rectal swabs and fecal samples.
[0011] A POCT kit for detecting carbapenem resistance genes, comprising: a primer and probe set for POCT detection of carbapenem resistance genes and a DNA extraction and purification system; The DNA extraction and purification system includes: nucleic acid extraction reagents and magnetic beads; Nucleic acid extraction reagents include: isopropanol, guanidine hydrochloride, proteinase K, sodium dodecyl sulfate, Tween 80, ethylenediaminetetraacetic acid, and sodium carboxymethyl cellulose.
[0012] Nucleic acid extraction reagents include: isopropanol at a working concentration of 40%–60% (v / v), guanidine hydrochloride at a working concentration of 1–4 M, proteinase K at a working concentration of 0.2–2 mg / mL, sodium dodecyl sulfate at a working concentration of 0.1%–0.5% (w / v), Tween 80 at a working concentration of 1%–5% (w / v), ethylenediaminetetraacetic acid at a working concentration of 0.5–2 mM, and sodium carboxymethyl cellulose at a working concentration of 0.2–0.8 mg / mL.
[0013] The magnetic beads are hydroxyl magnetic beads or carboxyl magnetic beads; preferably, the working concentration of the magnetic beads is 1% to 5% by mass-volume ratio.
[0014] The POCT kit for detecting carbapenem resistance genes further includes: a magnetic bead-nucleic acid washing reagent and a nucleic acid elution reagent. The magnetic bead-nucleic acid washing reagent comprises 25-50 mM Tris-HCl, 10-25 mM EDTA, 150-300 mM NaCl, 0.8-1.5% aluminum ammonium sulfate (w / v), and 40-50% PEG6000 (w / v). The nucleic acid elution reagent comprises 10-20 mM Tris-HCl, 50-100 mM KCl, 5-20 mM MgSO4, 0.08-0.12% Triton-100 (w / v), and 0.08-0.12% tetramethylammonium chloride (w / v). Preferably, the magnetic bead-nucleic acid cleaning reagent comprises 30mM Tris-HCl, 20mM EDTA, 200mM NaCl, 1% aluminum ammonium sulfate (by mass / volume), and 50% PEG6000 (by mass / volume). Preferably, the nucleic acid elution reagent comprises 10mM Tris-HCl, 50mM KCl, 15mM MgSO4, 0.1% Triton-100 (v / v), and 0.1% tetramethylammonium chloride (w / v).
[0015] The aforementioned POCT kit for detecting carbapenem resistance genes is a detection tube for POCT detection of carbapenem resistance genes; the detection tube is arranged from top to bottom as follows: a cell lysis-nucleic acid binding magnetic bead region, a magnetic bead-nucleic acid washing region, and a nucleic acid elution-nucleic acid amplification region; The cell lysis-nucleic acid binding magnetic bead region is pre-loaded with a DNA extraction and purification system; The magnetic bead-nucleic acid cleaning area is pre-embedded with magnetic bead-nucleic acid cleaning reagent; The nucleic acid elution-nucleic acid amplification region is pre-embedded with nucleic acid elution reagent and a primer and probe set for detecting carbapenem resistance genes in POCT.
[0016] The tube body of the detection tube is the tube body structure described in CN 217838955U or Chinese Patent 202410813424.3; Preferably, the POCT kit for detecting carbapenem resistance genes is specifically designed for detection in rectal swabs or fecal samples.
[0017] A method for detecting carbapenem resistance genes by point-of-care testing (POCT) is provided, which uses the primer and probe set for detecting carbapenem resistance genes by POCT and / or the kit for detecting carbapenem resistance genes by POCT to detect the sample to be tested.
[0018] The method for detecting carbapenem resistance genes by point-of-care testing (POCT) includes the following steps: S1. Place the sample to be tested in the bacterial cell lysis-nucleic acid binding magnetic bead zone of the detection tube and react for 30 min; S2. Close the cap of the test tube and place the test tube on the fully automated PCR analyzer to perform the lysis and amplification program; Preferably, the reaction refers to: stirring; Preferably, the pyrolysis procedure is: 60℃ for 20 min, 95℃ for 10 min; Preferably, the amplification program is: 94℃ for 5 min, with 94℃ for 5 s and 60℃ for 30 s as one cycle, for a total of 40 cycles; Preferably, the sample to be tested is a rectal swab or a fecal sample.
[0019] Some embodiments of the present invention provide a point-of-care testing (POCT) method for carbapenem resistance genes, wherein the DNA extraction and purification system and the amplification and detection system are pre-packaged in the same detection tube.
[0020] As a preferred embodiment of the present invention, the detection tube comprises, from top to bottom, a bacterial cell lysis-nucleic acid binding magnetic bead region 2, a magnetic bead-nucleic acid washing region 3, and a nucleic acid elution-nucleic acid amplification region 4; The cell lysis-nucleic acid binding magnetic bead region 2 is pre-loaded with nucleic acid extraction reagent and magnetic beads. The nucleic acid extraction reagent contains cell lysis reagent, such as guanidine hydrochloride and sodium dodecyl sulfate.
[0021] The magnetic bead-nucleic acid cleaning zone 3 is pre-loaded with magnetic bead-nucleic acid cleaning reagent, which includes the following components: 30mM Tris-HCl, 20mM EDTA, 200mM NaCl, 1% aluminum ammonium sulfate (by mass / volume), and 50% PEG6000 (by mass / volume).
[0022] The nucleic acid elution-amplification region 4 is pre-embedded with nucleic acid elution reagents and primers and probes corresponding to the 28 sequences of this invention, as well as amplification reagents. The nucleic acid elution reagents include the following components: 10~20mM Tris-HCl, 50~100mM KCl, 5~20mM MgSO4, 0.08~0.12% Triton-100 (v / v), and 0.08~0.12% tetramethylammonium chloride (w / v). The amplification reagents include: Taq enzyme, dNTPs, Mg2+, and buffer solution.
[0023] As a preferred embodiment of the present invention, the bacterial cell lysis-nucleic acid binding magnetic bead region includes a nucleic acid extraction reagent, magnetic beads, and an internal standard plasmid; The nucleic acid extraction reagent comprises isopropanol at a working concentration of 40%–60%, guanidine hydrochloride at a working concentration of 1–4 M, proteinase K at a working concentration of 0.2–2 mg / mL, sodium dodecyl sulfate (SDS) at a working concentration of 0.1%–0.5%, Tween 80 at a working concentration of 1%–5%, ethylenediaminetetraacetic acid (EDTA) at a working concentration of 0.5–2 mM, and sodium carboxymethyl cellulose at a working concentration of 0.2–0.8 mg / mL.
[0024] The magnetic beads are hydroxyl or carboxyl magnetic beads; The internal standard plasmid is a plasmid containing an MS2 gene sequence, the MS2 sequence of which is shown in SEQ ID NO.28; As a preferred embodiment of the present invention, the amplification detection system includes a primer set and a probe set for detecting carbapenem resistance genes, wherein the carbapenem resistance genes are NDM, KPC, VIM, IMP, GES and OXA. The primer pairs and probes for the NDM gene are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively; The primer pairs and probes for the KPC gene are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, respectively; The primer pairs and probes for the VIM gene are shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, respectively; The primer pairs and probes for the IMP gene are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, respectively; The OXA gene was detected using three sets of primer pairs and probes, as shown in SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21, respectively. The primer pairs and probes for the GES gene are shown in SEQ ID NO.22, SEQ ID NO.23 and SEQ ID NO.24, respectively; As a preferred embodiment of the present invention, it further includes an internal standard primer pair and a probe, as shown in SEQ ID NO.25, SEQ ID NO.26 and SEQ ID NO.27.
[0025] As a preferred embodiment of the present invention, the amplification detection system further includes PCR buffer, dNTPs, hot-start Taq enzyme, and UDG enzyme.
[0026] In a preferred embodiment of the present invention, the working concentrations of the primer pairs and probes for the nucleic acid elution-nucleic acid amplification reaction system are all 0.05 μM to 0.3 μM for NDM, 0.05 μM to 0.3 μM for KPC, 0.05 μM to 0.3 μM for VIM, 0.05 μM to 0.3 μM for IMP, 0.05 μM to 0.3 μM for OXA, 0.05 μM to 0.3 μM for GES, 0.05 μM to 0.3 μM for PCR Buffer, 0.5 × 2 × 10⁻⁶ for dNTPs, 450 μM to 900 μM for dNTPs, 5 U to 20 U for hot-start Taq enzyme, and 0.5 U to 2 U for UDG enzyme.
[0027] As a preferred embodiment of the present invention, the following steps are included: 1) Add the sample to be tested into the detection tube, cap the tube, and place it into the appropriate instrument. In some embodiments, the applicable instrument refers to the fully automated PCR analyzer described in Chinese invention patent application 202210601588.0, "A Fully Automated PCR Analyzer and Nucleic Acid Detection Method"; or it may be the fully automated medical PCR analysis system manufactured by the second applicant, Hangzhou Youstar Biotechnology Co., Ltd.
[0028] 2) It can automatically complete lysis, nucleic acid extraction, amplification, and signal reporting on applicable instruments.
[0029] As a preferred embodiment of the present invention, in step 1), the rectal swab sample operation procedure is as follows: insert the part of the swab tip with the fecal sample directly into the liquid surface of the detection tube, rotate it gently several times, take out the swab, cover the tube cap, and put it into the applicable instrument; As a preferred embodiment of the present invention, in step 2), the pyrolysis procedure is: 60℃ for 20 min, 95℃ for 10 min; As a preferred embodiment of the present invention, in step 2), the amplification program is as follows: 94℃ for 5 min, 1 cycle; 94℃ for 5 s, 60℃ for 30 s, 40 cycles.
[0030] Compared with the prior art, the present invention has the following beneficial effects: 1) This invention designs and optimizes a nucleic acid extraction reagent that can directly extract nucleic acids from rectal swabs, feces, swab eluent, cultures, and purified nucleic acids.
[0031] 2) This invention can simultaneously detect carbapenem resistance genes NDM (75 subtypes), KPC (232 subtypes), VIM (90 subtypes), IMP (101 subtypes), GES (64 subtypes), and OXA-48, 23, 51, and 213 groups in a single detection tube.
[0032] 3) This invention takes only 1 hour from adding the sample to the detection tube to reporting the results.
[0033] 4) This invention requires only one step, "sample loading-machine loading," to obtain test results from rectal swabs. It is simple to operate, the detection system is fully enclosed, and the risk of contamination is low.
[0034] The beneficial effects of this invention are as follows: This invention relates to a point-of-care testing (POCT) method for detecting carbapenem resistance genes in samples such as rectal swabs, feces, swab eluates, cultures, and purified nucleic acids. The method boasts advantages including high automation, short processing time, simple operation, high sensitivity, good specificity, good inclusiveness, and a fully enclosed, low-contamination environment, demonstrating promising clinical application prospects. This invention can directly detect carbapenem resistance genes causing bacterial carbapenem resistance using rectal swab samples and integrates a nucleic acid extraction and purification system as well as an amplification system. Only two steps are required: sample loading and instrument loading, achieving "sample in, result out." The method can be used for in-vitro detection of carbapenem resistance genes NDM (75 subtypes), KPC (232 subtypes), VIM (90 subtypes), IMP (101 subtypes), GES (64 subtypes), and OXA-48, 23, 51, and 213 groups in a single test tube. This detection method has the advantages of short processing time, simple operation, wide coverage, good specificity, and prevention of contamination. Attached Figure Description
[0035] Figure 1 This is a schematic diagram of a detection tube inserted into a rectal swab according to some embodiments of the present invention. In the diagram, 1. Rectal swab; 2. Bacterial cell lysis-nucleic acid binding magnetic bead region; 3. Magnetic bead-nucleic acid washing region; 4. Nucleic acid elution-nucleic acid amplification region.
[0036] Figure 2 This is a curve of fluorescent PCR results for detecting subtype 1 of the carbapenem resistance gene NDM using the kit in Experiment Example 2 of this invention.
[0037] Figure 3 This is a curve of fluorescent PCR results for detecting two subtypes of the carbapenem resistance gene KPC using the kit in Experiment Example 2 of this invention.
[0038] Figure 4 This is a curve of fluorescent PCR results for detecting two subtypes of the carbapenem resistance gene VIM using the kit in Experiment Example 2 of this invention.
[0039] Figure 5 This is a curve of fluorescent PCR results for detecting the four subtypes of the carbapenem resistance gene IMP using the kit in Experiment Example 2 of this invention.
[0040] Figure 6 This is a curve of fluorescent PCR results for detecting the five subtypes of the carbapenem resistance gene GES using the kit in Experiment Example 2 of this invention.
[0041] Figure 7 This is a curve of fluorescent PCR results for detecting the 48th subtype of the carbapenem resistance gene OXA using the kit in Experimental Example 2 of this invention. Detailed Implementation
[0042] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0043] biomaterial sources I. The engineered bacteria used in Table 1 of Experimental Example 1 of this invention were prepared by the applicant.
[0044] II. The engineered bacteria used in Table 5 of Experimental Example 2 of this invention were prepared by the applicant.
[0045] The gene sequences of the carbapenem resistance genes NDM, KPC, VIM, IMP, GES, and OXA contained in each engineered bacterium, as well as the sequences of each gene subtype, can be downloaded from the following link; https: / / www.ncbi.nlm.nih.gov / pathogens / refgene / #gene_family:blaNDM https: / / www.ncbi.nlm.nih.gov / pathogens / refgene / #gene_family:blaVIM https: / / www.ncbi.nlm.nih.gov / pathogens / refgene / #gene_family:blaKPC https: / / www.ncbi.nlm.nih.gov / pathogens / refgene / #gene_family:blaIMP https: / / www.ncbi.nlm.nih.gov / pathogens / refgene / #gene_family:blaOXA https: / / www.ncbi.nlm.nih.gov / pathogens / refgene / #gene_family:blaGES Based on known gene sequences, artificially synthesizing nucleic acid fragments of each gene and its subtypes, cloning these artificially synthesized nucleic acid fragments into vectors, and selecting single clones with correct sequences as the corresponding engineered bacteria are routine techniques familiar to those skilled in molecular biology. For example, the steps described in the book *Molecular Cloning: A Laboratory Manual* can be followed. In the experimental examples of this invention, the vector used for preparing the engineered bacteria was pUC57, and the host cell used was DH5α. The artificial synthesis of nucleic acid fragments of each gene and its subtypes can be outsourced to commercial biotechnology companies. In this invention, the artificial synthesis of nucleic acid fragments of each gene and its subtype corresponding to the engineered bacteria was completed by Sangon Biotech (Shanghai) Co., Ltd.
[0046] Third, the applicant promises that within 20 years from the date of application of this invention, the above-mentioned engineered bacteria may be distributed to the public for verification of the technical effects of this invention.
[0047] Group 1 Examples, Primer and Probe Set of the Present Invention This set of embodiments provides a primer and probe set for POCT detection of carbapenem resistance genes. All embodiments in this set share the following common feature: the carbapenem resistance genes include: NDM, KPC, VIM, IMP, OXA, and GES; The primers and probes for the NDM gene include: SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; The primers and probes for the KPC gene include: SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6; The primers and probes for the VIM gene include: SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9; The primers and probes for the IMP gene include: SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12; The primers and probes for the OXA gene include: SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21; The primers and probes for the GES gene include: SEQ ID NO.22, SEQ ID NO.23 and SEQ ID NO.24.
[0048] In a further embodiment, the primer and probe set for POCT detection of carbapenem resistance genes further includes: internal standard primers, as shown in SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.27; Preferably, the primer and probe set for POCT detection of carbapenem resistance genes is specifically designed for detection in rectal swabs and fecal samples.
[0049] Group 2 Examples, the reagent kit of the present invention This set of embodiments provides a kit for POCT detection of carbapenem resistance genes. All embodiments in this set share the following common feature: the kit for POCT detection of carbapenem resistance genes includes: a primer and probe set for POCT detection of carbapenem resistance genes and a DNA extraction and purification system as described in any of the embodiments in the first set; The DNA extraction and purification system includes: nucleic acid extraction reagents and magnetic beads; Nucleic acid extraction reagents include: isopropanol, guanidine hydrochloride, proteinase K, sodium dodecyl sulfate, Tween 80, ethylenediaminetetraacetic acid, and sodium carboxymethyl cellulose.
[0050] In a specific embodiment, the nucleic acid extraction reagent includes: isopropanol at a working concentration of 40%~60% (v / v), guanidine hydrochloride at a working concentration of 1~4M, proteinase K at a working concentration of 0.2~2 mg / mL, sodium dodecyl sulfate at a working concentration of 0.1%~0.5% (w / v), Tween 80 at a working concentration of 1%~5% (w / v), ethylenediaminetetraacetic acid at a working concentration of 0.5~2 mM, and sodium carboxymethyl cellulose at a working concentration of 0.2~0.8 mg / mL.
[0051] In some embodiments, the magnetic beads are hydroxyl magnetic beads or carboxyl magnetic beads; preferably, the working concentration of the magnetic beads is 1% to 5% by mass-volume ratio. In some embodiments, the magnetic beads are branded as Nanomicro, with the product number MSRSH-030.
[0052] In a further embodiment, the POCT kit for detecting carbapenem resistance genes further includes: a magnetic bead-nucleic acid washing reagent and a nucleic acid elution reagent. The magnetic bead-nucleic acid washing reagent comprises 25-50 mM Tris-HCl, 10-25 mM EDTA, 150-300 mM NaCl, 0.8-1.5% aluminum ammonium sulfate (w / v), and 40-50% PEG6000 (w / v). The nucleic acid elution reagent comprises 10-20 mM Tris-HCl, 50-100 mM KCl, 5-20 mM MgSO4, 0.08-0.12% Triton-100 (w / v), and 0.08-0.12% tetramethylammonium chloride (w / v). Preferably, the magnetic bead-nucleic acid cleaning reagent comprises 30mM Tris-HCl, 20mM EDTA, 200mM NaCl, 1% aluminum ammonium sulfate (by mass / volume), and 50% PEG6000 (by mass / volume). Preferably, the nucleic acid elution reagent comprises 10mM Tris-HCl, 50mM KCl, 15mM MgSO4, 0.1% Triton-100 (v / v), and 0.1% tetramethylammonium chloride (w / v).
[0053] In other embodiments, the POCT kit for detecting carbapenem resistance genes is a POCT detection tube for detecting carbapenem resistance genes; the detection tube is arranged from top to bottom as follows: a cell lysis-nucleic acid binding magnetic bead region, a magnetic bead-nucleic acid washing region, and a nucleic acid elution-nucleic acid amplification region; The cell lysis-nucleic acid binding magnetic bead region is pre-loaded with a DNA extraction and purification system; The magnetic bead-nucleic acid cleaning area is pre-embedded with magnetic bead-nucleic acid cleaning reagent; The nucleic acid elution-nucleic acid amplification region is pre-embedded with nucleic acid elution reagent and a primer and probe set for detecting carbapenem resistance genes in POCT.
[0054] In a more specific embodiment, the tube body of the detection tube is the tube body structure described in CN 217838955U or Chinese Patent 202410813424.3; In some embodiments, the structure of the detection tube can be configured to be consistent with the tube structure described in Chinese Patent 202410813424.3, "Integrated POCT Reagent Kit, Detection Tube and Detection System for Detecting 15 Diarrheal Pathogens".
[0055] In other embodiments, the structure of the detection tube (hereinafter referred to as the detection tube) is described below. Figure 1 From top to bottom, it includes the lysis-nucleic acid binding magnetic bead region, the magnetic bead-nucleic acid washing region, and the nucleic acid elution-nucleic acid amplification region.
[0056] The specific gene sequences of carbapenem resistance genes NDM, KPC, VIM, IMP, GES and OXA were detected in the nucleic acid elution-nucleic acid amplification region (hereinafter referred to as the amplification region).
[0057] The test tube also includes an internal standard system, consisting of a plasmid containing an MS2 gene sequence and primer pairs and probes specifically targeting the plasmid, used to monitor the effectiveness of the extraction, purification, and amplification reactions. The test tube is pre-loaded with nucleic acid extraction reagents, magnetic beads, an internal standard plasmid, nucleic acid purification reagents, nucleic acid elution reagents, and PCR reaction reagents. Before use, the user simply adds the sample to the test tube. Under the control of the instrument, the nucleic acid in the sample is automatically purified. The purified nucleic acid is mixed with the PCR reaction reagents and heated by the instrument for PCR amplification. Simultaneously, the fluorescent probe specifically binds to the target, generating a fluorescent signal. The instrument acquires the fluorescence signal in real time and automatically determines the test results by analyzing changes in the fluorescence signal.
[0058] Preferably, the POCT kit for detecting carbapenem resistance genes is specifically designed for detection in rectal swabs or fecal samples.
[0059] Group 3 embodiments, the method of the present invention This set of embodiments provides a method for detecting carbapenem resistance genes using point-of-care testing (POCT). All embodiments in this set share the following common feature: they employ a primer and probe set for detecting carbapenem resistance genes using POCT as described in any of the embodiments in Group 1, and / or a kit for detecting carbapenem resistance genes using POCT as described in any of the embodiments in Group 2, to detect the sample to be tested.
[0060] In a specific embodiment, the method for detecting carbapenem resistance genes by POCT includes the following steps: S1. Place the sample to be tested in the bacterial cell lysis-nucleic acid binding magnetic bead zone of the detection tube and react for 30 min; S2. Close the cap of the test tube and place the test tube on the fully automated PCR analyzer to perform the lysis and amplification program; Preferably, the reaction refers to: stirring; Preferably, the pyrolysis procedure is: 60℃ for 20 min, 95℃ for 10 min; Preferably, the amplification program is: 94℃ for 5 min, with 94℃ for 5 s and 60℃ for 30 s as one cycle, for a total of 40 cycles; Preferably, the sample to be tested is a rectal swab or a fecal sample.
[0061] Experimental Example 1: Preparation of the reagent kit of the present invention Preferred ranges and optimal values for working concentrations of proteinase K, SDS, and sodium carboxymethyl cellulose Sample: Mix the engineered bacteria shown in Table 1 with the fecal matrix evenly, and collect a portion using a rectal swab as the sample to be tested; Table 1. Sample Information
[0062] Reagents: Proteinase K, SDS, and sodium carboxymethyl cellulose were purchased from Solarbio; Test tubes: Test tubes (excluding nucleic acid extraction reagents, internal standards, and magnetic beads); Instrument: Fully automated medical PCR analysis system (Hangzhou Ustar Biotechnology Co., Ltd.); Preparation of nucleic acid extraction reagents: Prepare some components of the nucleic acid extraction reagent according to Table 2: Table 2. Nucleic Acid Extraction Reagents
[0063] According to the orthogonal experimental design, the concentration gradient groups of proteinase K, SDS and sodium carboxymethyl cellulose in the nucleic acid extraction reagent were prepared according to Table 3, with 3 parallel test tubes in each group. The grouping is shown in Table 3.
[0064] Table 3. Concentration gradients of proteinase K, SDS, and sodium carboxymethyl cellulose
[0065] Add the prepared nucleic acid extraction reagent to the above-mentioned test tube, insert the above-mentioned rectal swab sample, gently rotate the swab several times, remove the swab, cover the tube, shake well, and insert it into the compatible instrument.
[0066] The pyrolysis program was: 60℃ for 20 min, 95℃ for 10 min.
[0067] The experimental results are shown in Table 4.
[0068] Table 4. Results of the amplification region
[0069] Experimental conclusion: The working concentration of the nucleic acid extraction reagent sodium carboxymethyl cellulose is 0.2~0.8 mg / mL, preferably 0.6 mg / mL; the working concentration of proteinase K is 0.2~2 mg / mL, preferably 1 mg / mL; the working concentration of SDS is 0.1%~0.5%, preferably 0.3%.
[0070] Experimental Example 2: Compatibility Test of the Reagent Kit of the Present Invention Bioinformatics analysis: Primer and probe design: All OXA (1285 subtypes), KPC (232 subtypes), VIM (90 subtypes), IMP (101 subtypes), NDM (75 subtypes), and GES (64 subtypes) subtype sequences were downloaded from NCBI and homology comparisons were performed. Highly conserved regions were identified for KPC, VIM, IMP, NDM, and GES genes, and primers and probes were designed accordingly. Degenerate bases were used to improve inclusion. The primers and probes were compared on the BLAST website, and the comparison results are shown in Table 6. OXA lacks highly conserved regions, making it impossible to design primers and probes using existing conventional methods. Homology analysis was performed on all known OXA sequences. Based on OXA homology, OXA sequences were grouped, with the OXA-48 family showing high conservation, the OXA-23 family showing high conservation, and the OXA-51 and OXA-213 families showing high conservation. Primers and probes were designed for the conserved regions of these three families, using degenerate bases to improve inclusiveness. The primers and probes were aligned using a BLAST database, and the alignment results are shown in Table 6. Internal standard primers are shown in SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.27, and the internal standard sequence is an MS2 sequence, as shown in SEQ ID NO.28.
[0071] Primer and probe sequences: Primers and probes for the NDM gene: SEQ ID NO.1: 5'-CCATATTTTTGCTACAGTGAA; SEQ ID NO.2: 5'-ATTO425-AACCCCGCAAATGCGAGGCCTAGT-BHQ1; SEQ ID NO.3: 5'-TGAATAAAAGGAAAACTTGATG; Primers and probes for the KPC gene: SEQ ID NO.4: 5'-TTCTGCCACCGCGCTGACCAA; SEQ ID NO.5: 5'-FAM-CGTCGCGGAACCATTCGCTAAAACTC-BHQ1; SEQ ID NO.6: 5'-ATCGGTGTGTACGCGATGGA; Primers and probes for the VIM gene: SEQ ID NO.7: 5'-CGCGTCGGYGGMGWTGATG; SEQ ID NO.8: 5'-HEX-ACGTTTGCCACYCCAGCCGCCCGAAG; SEQ ID NO.9: 5'-TCTCTARAAGSRCTCICMTCG; Primers and probes for the IMP gene: SEQ ID NO.10: 5'-GTGGGTCGATGTTTGATGT; SEQ ID NO.11: 5'-ROX-TGGAGCAGCAACGATGTTACGCA-BHQ2; SEQ ID NO.12: 5'-GGRMRRGTATGARMAAGTTATC; Primers and probes for the OXA gene: SEQ ID NO.13: 5'-TTTACCCGCATCKACCTTTAA; SEQ ID NO.14: 5'-Cy5-ACTTGRTGYTCATCCTTMAC-BHQ2; SEQ ID NO.15: 5'-GTCTGTCCATCCCAYTTAAA; SEQ ID NO.16: 5'-GTTTAATTAAGGAAGAGGCT; SEQ ID NO.17: 5'-Cy5-CTATTGATCTGGTGTTTAAAATGA-BHQ2; SEQ ID NO.18: 5'-GCTGARCCGTACAACCAGAAA; SEQ ID NO.19: 5'-ACCCAAGTMGATRAATTTTTGG; SEQ ID NO.20: 5'-Cy5-CAAGARGCMCARTTTGCTTAC-BHQ2; SEQ ID NO.21: 5'-AAGMGTTTTAKRGCTAGYT; Primers and probes for the GES gene: SEQ ID NO.22: 5'-CAGCTCAGATCGGTGTTG; SEQ ID NO.23: 5'-ATTO430LS-TCCGGCCCATATGAAAG-BHQ1; SEQ ID NO.24: 5'-CGCTCGGTGCCTGAGTCAATTCT; Internal standard primer: SEQ ID NO.25: 5'-CGATGGTCCATACCTTAGA; SEQ ID NO.26: 5'-Cy5.5-AGCATTAATCAGGCAACGGCTCTC-BHQ2; SEQ ID NO.27: 5'-ACGAGAACGAACTGAGTAA; Internal standard sequence: SEQ ID NO.28: 5'-TCCTTTCTCGATGGTCCATACCTTAGATGCGTTAGCATTAATCAGGCAACGGCTCTCTAGATAGAGCCCTCAACCGGAGTTTGAAGCATGGCTTCTAACTTTACTCAGTTCGTTCCGTCGACAATGGC; The primers and probes mentioned above have fluorescent labeling groups and fluorescence quenching groups added to their 5' and 3' ends, respectively. In some embodiments, the fluorescent labeling group is a common fluorescent labeling group known to those skilled in the art, such as FAM, Alexa Fluor series, VIC, HEX, JOE, TET, TAMRA, ROX, etc. Fluorescence quenching groups are common fluorescence quenching groups well known to those skilled in the art. For example, they can be 6-carboxyfluorescein, tetrachloro-6-carboxyfluorescein, 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein, hexachloro-6-methylfluorescein, CY3, 6-carboxytetramethylrhodamine, ROX, LC RED640, etc.
[0072] Experimental verification: Samples: The engineered bacteria shown in Table 5 were mixed evenly with the fecal matrix, and a portion was collected using a rectal swab as the sample to be tested; Table 5. Sample Information
[0073] Instrument: Fully automated medical PCR analysis system (Hangzhou Ustar Biotechnology Co., Ltd.)
[0074] Reagent: Detection tubes (Hangzhou Ustar Biotechnology Co., Ltd.)
[0075] Testing: Insert the above-mentioned sample into the test tube, gently rotate the swab several times, remove the swab, cover the tube, shake well, and insert it into the compatible instrument. The results are shown in Table 7.
[0076] Table 6. BLAST results of NDM, KPC, VIM, IMP, OXA and GES primers and probes
[0077] Table 7. Experimental results of the amplified region
[0078] Experimental conclusions: The POCT detection method for carbapenem resistance genes disclosed in this invention can detect all 232 known subtypes of engineered bacteria of KPC, 90 known subtypes of engineered bacteria of VIM, 101 known subtypes of engineered bacteria of IMP, 75 known subtypes of engineered bacteria of NDM, 67 known subtypes of engineered bacteria of the OXA-48 family, 53 known subtypes of engineered bacteria of OXA-23, 384 known subtypes of engineered bacteria of OXA-51, and 115 known subtypes of engineered bacteria of OXA-213. It can also detect 60 subtypes of the 64 known subtypes of engineered bacteria of GES, demonstrating good inclusiveness.
[0079] Experimental Example 3: Sensitivity Test of the Reagent Kit of the Present Invention Materials: The engineered bacteria shown in Table 8 were mixed evenly with the fecal matrix, and a portion was collected using a rectal swab as the test sample; Table 8. Sample Information
[0080] Instrument: Fully automated medical PCR analysis system (Hangzhou Ustar Biotechnology Co., Ltd.)
[0081] Reagent: Detection tubes (Hangzhou Ustar Biotechnology Co., Ltd.)
[0082] Testing: Insert the above-mentioned sample into the test tube, gently rotate the swab several times, remove the swab, cover the tube, shake well, and insert it into the compatible instrument. The results are shown in Table 9.
[0083] Table 9. Experimental Results
[0084] Experimental conclusion: The POCT detection method for carbapenem resistance genes disclosed in this invention has a sensitivity of 50 CFU / mL for detecting carbapenem resistance genes OXA-48, KPC-2, VIM-2, NDM-5, IMP-4 and GES-5.
[0085] Experimental Example 4: Specificity Test of the Reagent Kit of the Present Invention To further determine the specificity of this kit, experimental validation is needed to detect common clinical pathogens, specifically including: Proteus, Edwardsiella, Citrobacter, Salmonella, Lactobacillus acidophilus, Enterobacter aerogenes, Citrobacter freundii, Stenotrophomonas maltophilia, Clostridium difficile, Bifidobacterium, Helicobacter pylori, Staphylococcus aureus, Enterococcus faecalis, Lactobacillus, Hepatitis A virus, Streptococcus pyogenes, Staphylococcus epidermidis, Candida albicans, Streptococcus pneumoniae, Mycoplasma pneumoniae, Chlamydia pneumoniae, Staphylococcus epidermidis, Bordetella pertussis, and Narcissus, at a concentration of E6 CFU / mL; Epstein-Barr virus, Varicella-zoster virus, Herpes simplex virus type I, Human cytomegalovirus, Enteroadenovirus, and Norovirus, at a concentration of E6 copies / mL.
[0086] Materials and Methods: Instrument: Fully automated medical PCR analysis system (Hangzhou Ustar Biotechnology Co., Ltd.)
[0087] Reagent: Detection tubes (Hangzhou Ustar Biotechnology Co., Ltd.)
[0088] Detection: Each clinically common pathogen was tested on a fully automated medical PCR analysis system.
[0089] Experimental results: The results of the detection of 30 common pathogenic bacteria are shown in Table 10.
[0090] Experimental conclusion: The POCT detection method for carbapenem resistance genes disclosed in this invention has no cross-reactivity with 30 common clinical pathogens.
[0091] Table 10. Detection results of 30 common pathogenic bacteria
[0092] Experimental Example 5: Clinical Sample Testing of the Reagent Kit of the Present Invention I. Materials and Methods: Samples: 300 clinical samples, of which 23 were negative, 68 were NDM positive, 72 were KPC positive, 32 were VIM positive, 44 were IMP positive, 45 were OXA positive, and 16 were GES positive.
[0093] Instrument: Fully automated medical PCR analysis system (Hangzhou Ustar Biotechnology Co., Ltd.)
[0094] Reagent: Detection tubes (Hangzhou Ustar Biotechnology Co., Ltd.)
[0095] Testing: The above clinical samples were tested on a fully automated medical PCR analysis system.
[0096] The test results showed that one clinically negative sample tube tested positive for KPC, and one clinically negative sample tube tested positive for NDM; the remaining results were consistent. The experimental results are shown in Table 11.
[0097] Table 11. Statistical Results
[0098] The accuracy assessment of this kit showed the following consistency with clinical diagnostic results: positive concordance rate 99.28%; negative concordance rate 100%; overall concordance rate 99.33%; Kappa value 0.951, indicating good consistency.
[0099] Experimental conclusion: The POCT detection method for carbapenem resistance genes provided in this experiment can accurately detect carbapenem resistance genes from clinical samples and has good feasibility for clinical application.
[0100] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent variations made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and variations made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A primer and probe set for POCT detection of carbapenem resistance genes, characterized in that, The carbapenem resistance genes include: NDM, KPC, VIM, IMP, OXA, and GES; The primer pairs for the NDM gene are shown in SEQ ID NO.1 and SEQ ID NO.3, and the probe is shown in SEQ ID NO.2; The primers for the KPC gene are shown in SEQ ID NO.4 and SEQ ID NO.6, and the probe is shown in SEQ ID NO.5; The primers for the VIM gene are shown in SEQ ID NO.7 and SEQ ID NO.9, and the probe is shown in SEQ ID NO.8; The primers for the IMP gene are shown in SEQ ID NO.10 and SEQ ID NO.12, and the probe is shown in SEQ ID NO.11; Primers for the OXA gene are shown in SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.21, and probes are shown in SEQ ID NO.14, SEQ ID NO.17, and SEQ ID NO.
20. The primers for the GES gene are shown in SEQ ID NO.22 and SEQ ID NO.24, and the probe is shown in SEQ ID NO.
23.
2. The primer and probe set for POCT detection of carbapenem resistance genes according to claim 1, characterized in that, Also includes: The internal standard primers and internal standard probes are shown in SEQ ID NO.25 and SEQ ID NO.27, and the internal standard probes are shown in SEQ ID NO.
26.
3. A kit for POCT detection of carbapenem resistance genes, characterized in that, include: A primer and probe set and DNA extraction and purification system for POCT detection of carbapenem resistance genes as described in claim 1 or 2; The DNA extraction and purification system includes: nucleic acid extraction reagents and magnetic beads; Nucleic acid extraction reagents include: isopropanol, guanidine hydrochloride, proteinase K, sodium dodecyl sulfate, Tween 80, ethylenediaminetetraacetic acid, and sodium carboxymethyl cellulose.
4. The POCT kit for detecting carbapenem resistance genes according to claim 3, characterized in that, Nucleic acid extraction reagents include: isopropanol at a working concentration of 40%–60% (v / v), guanidine hydrochloride at a working concentration of 1–4 M, proteinase K at a working concentration of 0.2–2 mg / mL, sodium dodecyl sulfate at a working concentration of 0.1%–0.5% (w / v), Tween 80 at a working concentration of 1%–5% (w / v), ethylenediaminetetraacetic acid at a working concentration of 0.5–2 mM, and sodium carboxymethyl cellulose at a working concentration of 0.2–0.8 mg / mL.
5. The POCT kit for detecting carbapenem resistance genes according to claim 4, characterized in that, The magnetic beads are hydroxyl magnetic beads or carboxyl magnetic beads; and / or, the working concentration of the magnetic beads is 1% to 5% by mass-volume ratio.
6. The POCT kit for detecting carbapenem resistance genes according to claim 3, characterized in that, Also includes: The magnetic bead-nucleic acid washing reagent and the nucleic acid elution reagent are provided. The magnetic bead-nucleic acid washing reagent comprises 25-50 mM Tris-HCl, 10-25 mM EDTA, 150-300 mM NaCl, 0.8-1.5% aluminum ammonium sulfate (v / v), and 40-50% PEG6000 (v / v). The nucleic acid elution reagent comprises 10-20 mM Tris-HCl, 50-100 mM KCl, 5-20 mM MgSO4, 0.08-0.12% Triton-100 (v / v), and 0.08-0.12% tetramethylammonium chloride (v / v). And / or, the magnetic bead-nucleic acid cleaning reagent comprises 30mM Tris-HCl, 20mM EDTA, 200mM NaCl, 1% aluminum ammonium sulfate (w / v), and 50% PEG6000 (w / v). And / or, the nucleic acid elution reagent comprises 10 mM Tris-HCl, 50 mM KCl, 15 mM MgSO4, 0.1% Triton-100 (v / v), and 0.1% tetramethylammonium chloride (w / v).
7. A kit for detecting carbapenem resistance genes in POCT according to any one of claims 3-6, characterized in that, This is a POCT detection tube for detecting carbapenem resistance genes; the detection tube is arranged from top to bottom as follows: a cell lysis-nucleic acid binding magnetic bead region, a magnetic bead-nucleic acid washing region, and a nucleic acid elution-nucleic acid amplification region; The cell lysis-nucleic acid binding magnetic bead region is pre-loaded with a DNA extraction and purification system; The magnetic bead-nucleic acid cleaning area is pre-embedded with magnetic bead-nucleic acid cleaning reagent; The nucleic acid elution-nucleic acid amplification region is pre-embedded with nucleic acid elution reagent and a primer and probe set for detecting carbapenem resistance genes in POCT.
8. A method for detecting carbapenem resistance genes via point-of-care testing (POCT) for non-diagnostic purposes, characterized in that, The sample to be tested is detected using the primer and probe set for detecting carbapenem resistance genes by POCT as described in claim 1 or 2, and / or the kit for detecting carbapenem resistance genes by POCT as described in any one of claims 3-7.
9. A method for detecting carbapenem resistance genes in point-of-care testing (POCT) for non-diagnostic purposes according to claim 8, characterized in that, The steps include the following: S1. Place the sample to be tested in the bacterial cell lysis-nucleic acid binding magnetic bead zone of the detection tube and react for 30 min; S2. Close the cap of the test tube and place the test tube on the fully automated PCR analyzer to perform the lysis and amplification programs; And / or, the reaction refers to: agitation; And / or, the pyrolysis procedure is: 60℃ for 20 min, 95℃ for 10 min; And / or, the amplification program is: 94℃ for 5 min, with 94℃ for 5 s and 60℃ for 30 s as one cycle, for a total of 40 cycles; And / or, the sample to be tested is a rectal swab or a fecal sample.
Citation Information
Patent Citations
A fully automated PCR analyzer and nucleic acid detection method
CN114933963A
All-in-one POCT test kit, test tube and test system for 15 diarrhea pathogens
CN118667981B
Nucleic acid integrated detection multi-union tube
CN217838955U
Integrated POCT (point-of-care testing) kit, detection tube and detection system for detecting 15 diarrhea pathogens
CN118667981A