SNP locus related to oil content trait on soybean chromosome 1, detection primer and application

Abstract

This invention relates to the field of soybean genetic breeding technology, and particularly to SNP loci located on soybean chromosome 1 associated with oil content traits, detection primers, and applications. The nucleotide sequence of the SNP molecular marker provided by this invention is shown in SEQ ID NO.1, where the base at position 121 is G or A. Using the aforementioned SNP molecular marker and its primer pair, the oil content of soybean seeds can be predicted rapidly and accurately. By detecting this SNP molecular marker, the oil content of seeds can be quickly and effectively determined in the early stages of soybean seedling cultivation, shortening the breeding cycle of breeding materials, generating good economic value, and providing support for the construction of a soybean molecular marker-assisted breeding technology system. This invention provides important technical support for a soybean molecular marker-assisted breeding technology system, is easy to operate, and is suitable for large-scale production applications, possessing significant value and broad prospects in accelerating the breeding of new high-oil soybean varieties.

Description

Technical Field

[0001] This invention relates to the field of soybean genetics and breeding technology, and in particular to SNP loci located on soybean chromosome 1 that are associated with oil content traits, detection primers, and applications. Background Technology

[0002] Soybeans Glycine max (L.) Merr. is a classic dual-purpose crop for both grain and oil, and a high-quality raw material for extracting vegetable oil. The fatty acid content of soybeans is an important characteristic indicator for measuring the oil yield of soybean seeds; therefore, breeding high-oil soybean varieties is one of the important research directions at present.

[0003] Molecular marker technology offers significant advantages over traditional morphological and biochemical markers. These markers are abundant and distributed throughout the genome, often exhibiting co-dominant inheritance. Detection is unaffected by biological developmental stages, tissues, or the environment, and they directly reflect DNA variations. Detection methods are simple and rapid. Its development has progressed through three generations, from enzyme-digestion-based RFLP technology to mainstream technologies like RAPD and SSR based on PCR, and finally to SNP technology supported by high-throughput sequencing, with continuously improving accuracy and efficiency. Today, this technology is widely used in genetic breeding, gene mapping, species kinship identification, disease diagnosis, and forensic individual identification, making it one of the core technologies for life science research and related industrial applications. Currently, there are still significant shortcomings in the genetic analysis of high-oil-content traits in soybean germplasm resources. The number of SNP markers closely linked to high-oil-content traits in soybean that have been identified is relatively small, and there is a lack of practical markers that can be directly used for molecular marker-assisted breeding, failing to meet the industry's demand for rapid breeding of high-oil-content soybean varieties. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention provides SNP loci located on soybean chromosome 1 that are associated with oil content traits, detection primers, and applications.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an SNP molecular marker related to soybean oil content, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the base at position 121 is G or A.

[0006] In this invention, the SNP molecular marker corresponds to the SNP site located at base 1406697 of soybean chromosome 1, with alleles of G or A. The version number of soybean chromosome 1 is Wm82.a4.v1. In soybean seed materials, G is the dominant allele when oil content is high, and A is the dominant allele when oil content is low.

[0007] Preferably, soybean individuals with the SNP molecular marker genotype GG have a higher seed oil content than soybean individuals with the genotype AA.

[0008] The present invention also provides the use of the SNP molecular markers associated with soybean oil content traits in soybean selection and / or breeding.

[0009] Preferably, the genotype of the SNP molecular marker in the soybean sample is detected, and soybean individuals with the genotype GG are considered as dominant individuals with high oil content.

[0010] The present invention also provides the use of the SNP molecular markers associated with soybean oil content traits in the identification or prediction of soybean seed oil content.

[0011] Preferably, soybean individuals with the SNP molecular marker genotype GG have a higher seed oil content than soybean individuals with the genotype AA.

[0012] The present invention also provides detection primers for the SNP molecular markers related to the soybean oil content trait, wherein the nucleotide sequences of the detection primers include those shown in SEQ ID NO. 2-3.

[0013] Preferably, the detection primers include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer includes the sequence shown in SEQ ID NO.2; and the downstream primer includes the sequence shown in SEQ ID NO.3.

[0014] More preferably, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2 or as the reverse complementary sequence to the sequence shown in SEQ ID NO.2.

[0015] More preferably, the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3 or as the reverse complementary sequence to the sequence shown in SEQ ID NO.3.

[0016] Reagents or kits containing the aforementioned detection primers should also be within the scope of protection of this invention.

[0017] The use of the detection reagent for SNP molecular markers related to soybean oil content traits in soybean selection and / or breeding should also be within the scope of protection of this invention.

[0018] Preferably, the detection reagent includes the detection primers.

[0019] The present invention also provides the use of the detection primers for the SNP molecular markers associated with the soybean oil content trait in identifying or predicting the oil content of soybean seeds.

[0020] The use of the detection primers for the SNP molecular markers related to soybean oil content traits in soybean-assisted breeding should also be within the scope of protection of this invention.

[0021] The use of the detection primers for the SNP molecular markers related to soybean oil content traits in predicting or identifying the level of soybean seed oil content should also be within the scope of protection of this invention.

[0022] The present invention also provides a method for predicting or identifying the oil content of soybean seeds, comprising the following steps: detecting the genotype of SNP molecular markers in soybeans using PCR and / or sequencing methods, and determining the oil content trait of soybeans based on the genotype of the SNP molecular markers; the nucleotide sequence of the SNP molecular markers is shown in SEQ ID NO.1, wherein the base at position 121 is G or A.

[0023] Preferably, soybean seeds with the SNP molecular marker genotype GG have a higher oil content than soybean seeds with the genotype AA.

[0024] The present invention also provides a method for breeding soybeans using SNP molecular markers, the method comprising the following steps: detecting the genotype of the SNP molecular marker in soybeans using PCR and / or sequencing methods, and determining the oil content trait of soybeans based on the genotype of the SNP molecular marker; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 121 is G or A.

[0025] Preferably, the method further includes the following step: performing PCR using soybean genomic DNA as a template.

[0026] More preferably, the primers used for PCR include the detection primers for the SNP molecular markers associated with the soybean oil content trait.

[0027] Furthermore, the working concentration of the primer with the nucleotide sequence shown in SEQ ID NO.2 is 0.2 μmol / L to 0.3 μM, and the working concentration of the primer with the nucleotide sequence shown in SEQ ID NO.3 is 0.2 μmol / L to 0.3 μM.

[0028] In some specific embodiments, the working concentrations of primers with nucleotide sequences such as SEQ ID NO.2 are 0.2 μmol / L, 0.21 μmol / L, 0.22 μmol / L, 0.23 μmol / L, 0.24 μmol / L, 0.25 μmol / L, 0.26 μmol / L, 0.27 μmol / L, 0.28 μmol / L, 0.29 μmol / L, or 0.3 μmol / L.

[0029] In some specific embodiments, the working concentrations of primers with nucleotide sequences such as SEQ ID NO.3 are 0.2 μmol / L, 0.21 μmol / L, 0.22 μmol / L, 0.23 μmol / L, 0.24 μmol / L, 0.25 μmol / L, 0.26 μmol / L, 0.27 μmol / L, 0.28 μmol / L, 0.29 μmol / L, or 0.3 μmol / L.

[0030] Furthermore, the working concentration of the primer with the nucleotide sequence shown in SEQ ID NO.2 is 0.25 μmol / L, and the working concentration of the primer with the nucleotide sequence shown in SEQ ID NO.3 is 0.25 μmol / L.

[0031] Preferably, soybean individuals with the SNP molecular marker genotype GG have a higher seed oil content than soybean individuals with the genotype AA.

[0032] The present invention also provides a method for breeding soybeans with high oil content, the method comprising the following steps: using soybean individuals with a genotype of GG for the SNP molecular marker as parents, increasing the frequency of the allele G of the SNP molecular marker in the offspring; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 121 is G or A.

[0033] Compared with the prior art, the beneficial effects of the present invention are as follows: The SNP molecular marker and its primer pair provided by this invention can rapidly and accurately predict the oil content of soybean seeds. By detecting this SNP molecular marker, the oil content of seeds can be quickly and effectively determined in the early stages of soybean seedling cultivation, shortening the breeding cycle of breeding materials, generating good economic value, and providing support for the construction of a soybean molecular marker-assisted breeding technology system. After determining the oil content of soybean materials of different genotypes, the seed oil content can be gradually increased by selecting individuals with the G allele of this SNP molecular marker. This invention provides important technical support for the soybean molecular marker-assisted breeding technology system, is easy to operate, and is suitable for large-scale production applications, and has significant value and broad prospects in accelerating the breeding of new high-oil soybean varieties. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0035] Figure 1This is a sequencing peak diagram of PCR results of some soybean seeds provided in Example 3 of the present invention; 1 is a molecular marker (SEQ ID NO.1); 2 is the reverse complementary sequence of the molecular marker; 3 is a soybean seed with SNP site polymorphism of G; 4, 5 and 6 are three soybean seeds with SNP site polymorphism of A.

[0036] Figure 2 This is a box plot of oil content of soybean seeds with genotypes GG and AA at SNP loci provided in Example 3 of the present invention. There are 288 soybean seeds with genotype GG and 220 soybean seeds with genotype AA. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0038] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0039] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0040] The soybean seed material involved in the following examples was obtained from Gongzhuling, Changchun City, and is preserved at the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun City, Jilin Province. The public can obtain this biological material from the applicant.

[0041] Example 1: Treatment of soybean materials This invention selected 521 soybean plants from natural populations as research materials, mainly including varieties such as Dongsheng 112, Dongsheng 137, and Dongsheng 124.

[0042] Three replicate leaves were randomly selected from each soybean plant and placed in 2.0 mL centrifuge tubes, which were then immediately flash-frozen in liquid nitrogen.

[0043] Add grinding beads to the centrifuge tubes containing the quick-frozen samples, grind the samples into powder using a grinder, add 600 μL of 2×CTAB extraction buffer, vortex to mix, and heat in a 65℃ water bath for 30 min, shaking once every 10 min during this period; remove the samples from the water bath, add an equal volume of chloroform, vortex to mix, and centrifuge at 12000 rpm at room temperature for 10 min; transfer 500 μL of the supernatant to a new centrifuge tube, add an equal volume of isopropanol solution, incubate at -20℃ for 1 h, centrifuge at 12000 rpm at room temperature for 10 min, and discard the supernatant; add 500 μL of pre-cooled anhydrous ethanol solution to wash the precipitate, centrifuge at 12000 rpm for 5 min, discard the supernatant, and repeat once; dry the centrifuge tubes containing the precipitate with ethanol, add 100 μL of sterile ddH2O to dissolve the precipitate, thus obtaining the leaf genomic DNA samples of each soybean plant, and store at -20℃.

[0044] Example 2: Soybean Genome-Wide Association Analysis Whole-genome resequencing was performed on the leaf genomic DNA samples obtained in Example 1. Using the Glycine maxWm82.a4.v1 genome as a reference genome, a total of 21,752,494 SNP variant maps were obtained.

[0045] Genome-wide association study (GWAS) was conducted on the oil content of seeds from various soybean plants using rMVP software and the GLM model. The significance threshold for the GWAS analysis was calculated to be 0.0000000249 using the formula P = 0.05 / n (where n represents the number of effective SNPs in the population).

[0046] In this analysis, a highly significantly correlated SNP site (-log10(p) value greater than 8) was detected at position 1406697 (bp) on chromosome 1, located in the GmHD-Zip gene. This SNP site is position 121 of the nucleotide sequence shown in SEQ ID NO.1, with polymorphisms of G or A. Soybean oil content is lower when polymorphism A is present, and higher when polymorphism G is present.

[0047] The nucleotide sequence shown in SEQ ID NO.1 is as follows: GAAGACGTAAGGAGGCAGGAGGCGCGTGGGTGAGGAGTTGAGAGGAAAAAAAGGTTTGACTTTGGTGCGGGGTGTGGGAAACGTTTAGAATGGCCATTAAGAAAGCACCGCGTGGAACGTGACAGCCGATGTAGTAAGTGCTGCTGATCGGTTTCTGTCGACCCGCATTTACCATTCACAGTAAATTTTAAATTAACCCA TTTATTACAACACACTATGAATTGAATGAATATGTATGACCATTATATGAGGAGAGAGAGAGAAGAAAACTAGGATAAGGTAAAGGACTAAGGAAAAAGAGAAAGCCAGAGAGAGGGACCCTGTCCCCTTTTGTGTGCGTGTGTTGTGTCAACTGAGTGAACTCTCAAGTGAACTAAGATCACCAAAAACCACTCTCA.

[0048] Example 3: Gene sequencing verification of soybean SNP sites I. Experimental Methods To verify the reliability of the SNP sites in this invention, the primer sequences were designed using the nucleotide sequence shown in SEQ ID NO.1 as the molecular marker for target amplification: Upstream primer: 5'-GAAGACGTAAGGAGGCAGGAG-3' (SEQ ID NO.2); Downstream primer: 5'-TGAGAGTGGTTTTTGGTGATCTTAG-3' (SEQ ID NO.3).

[0049] Using the primers described above, genomic DNA was extracted from 508 soybean seeds (mainly varieties including Dongsheng 112, Dongsheng 137, and Dongsheng 124, etc., which did not overlap with the soybean plants in Example 1) and used as templates for PCR amplification. The PCR reaction system is shown in Table 1, and the PCR amplification reaction procedure is shown in Table 2.

[0050] Table 1 PCR reaction system

[0051] Table 2 PCR amplification reaction procedure

[0052] The amplification products obtained by PCR reaction were subjected to first-generation sequencing. The sequencing results were compared with the molecular marker (SEQ ID NO.1) to analyze the type of the 121st base of the amplification product.

[0053] Based on the sequencing results, each sample was assumed to be homozygous, and the genotype of each soybean seed was calculated.

[0054] The oil content of all soybean seeds was determined by Fourier transform near-infrared spectroscopy (based on crude fat content (dry basis), and the result is expressed as a percentage by mass (%)).

[0055] The T-test was used to analyze whether the differences in oil content among soybean genotypes reached statistical significance (p<0.05).

[0056] II. Experimental Results like Figure 1 As shown, soybean seeds exhibit two polymorphisms at SNP sites: G and A.

[0057] like Figure 2 As shown, 288 soybean seed samples had the GG genotype at their SNP loci, with an average oil content of 20.6%; 220 soybean seed samples had the AA genotype at their SNP loci, with an average oil content of 18.8%. Comparatively, soybean seeds with the GG genotype had significantly higher oil content (p=9×10⁻⁶). -7 .

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of an SNP molecular marker in identifying or predicting the oil content of soybean seeds, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 121 is G or A; The seed oil content of soybean individuals with the SNP molecular marker genotype GG was higher than that of soybean individuals with the genotype AA. The soybean varieties mentioned are Dongsheng 112, Dongsheng 137, or Dongsheng 124.

2. The use of a detection primer for an SNP molecular marker in identifying or predicting the oil content of soybean seeds, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 121 is G or A; The nucleotide sequences of the detection primers are shown in SEQ ID NO.2-3; The seed oil content of soybean individuals with the SNP molecular marker genotype GG was higher than that of soybean individuals with the genotype AA. The soybean varieties mentioned are Dongsheng 112, Dongsheng 137, or Dongsheng 124.

3. A method for breeding soybeans using SNP molecular markers, characterized in that, The method includes the following steps: The genotypes of SNP molecular markers in soybeans are detected by PCR and / or sequencing, and the oil content trait of soybeans is determined based on the genotypes of the SNP molecular markers. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 121 is G or A; The seed oil content of soybean individuals with the SNP molecular marker genotype GG was higher than that of soybean individuals with the genotype AA. The soybean varieties mentioned are Dongsheng 112, Dongsheng 137, or Dongsheng 124.

4. The method according to claim 3, characterized in that, The method further includes the following step: performing PCR using soybean genomic DNA as a template.

5. The method according to claim 4, characterized in that, The method further includes the following steps: after obtaining the PCR amplification product, the PCR amplification product is sequenced.

6. The method according to claim 3, characterized in that, The primers used for PCR include detection primers with nucleotide sequences as shown in SEQ ID NO. 2-3.

7. A method for cultivating soybeans with high oil content, characterized in that, The cultivation method includes the following steps: Using soybean individuals with the genotype GG of the SNP molecular marker as parents, the frequency of the allele G of the aforementioned SNP molecular marker in the offspring was increased; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 121 is G or A; The soybean varieties mentioned are Dongsheng 112, Dongsheng 137, or Dongsheng 124.

Images