Engineered mitochondrial nanoshields, methods of making and using the same

CN122272642BActive Publication Date: 2026-08-11GENERAL HOSPITAL OF NUCLEAR IND
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610733234.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-26
Publication Date
2026-08-11
Estimated Expiration
2046-05-26

AI Technical Summary

Technical Problem

首先,分离后裸露的线粒体容易受到血液和细胞外环境中高浓度钙离子(Ca2+)的攻击,这使得其活性和结构完整性难以维持

Benefits of technology

[0017] Nanoscale engineered mitochondria can defend against high concentrations of calcium ions (Ca) of 2 mM in the extracellular environment. 2+ It can cause damage to BMMSCs, while also possessing the ability to target BMMSCs and the characteristics of ROS response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122272642B_ABST
    Figure CN122272642B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of cell engineering technology, specifically relating to an engineered mitochondrial nanoshield, its preparation method, and its applications. The engineered mitochondrial nanoshield can resist damage from high concentrations of calcium ions in the extracellular environment, and also possesses BMMSCs targeting ability and ROS-responsive characteristics. After intravenous injection, the engineered mitochondrial nanoshield can selectively target BMMSCs to alleviate cellular senescence and increase bone mass in aged mice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cell engineering technology, specifically relating to an engineered mitochondrial nanoshield, its preparation method, and its application. Background Technology

[0002] Bone marrow mesenchymal stem cells (BMMSCs) play a crucial role in maintaining bone regeneration and homeostasis due to their self-renewal capacity and multi-lineage differentiation potential. The pathogenesis of osteoporosis (SOP) in the elderly is closely related to the aging of BMMSCs. Mitochondria, as important organelles involved in energy metabolism, play a key role in cellular function and processes. Mitochondrial dysfunction is a marker of cellular aging, and improving mitochondrial function holds promise for improving aging.

[0003] Mitochondrial transplantation refers to the process of isolating healthy mitochondria from donor cells and transferring them to recipient cells to replace or repair dysfunctional mitochondria. This technology is considered an innovative strategy for rescuing mitochondrial dysfunction and alleviating cellular senescence. However, several key issues remain to be addressed in the application of mitochondrial transplantation. First, the isolated, naked mitochondria are susceptible to high concentrations of calcium ions (Ca) in the blood and extracellular environment. 2+ Mitochondria are susceptible to attack, making it difficult to maintain their activity and structural integrity. Secondly, due to a lack of targeting ability and electrostatic repulsion between cells and mitochondria, specific cells can only take up a very small portion of the exposed mitochondria. Furthermore, mitochondrial fusion is a highly regulated process requiring tight binding of mitochondria, mediated by the inner mitochondrial membrane (OPA1) and outer membrane proteins (MFN1 / MFN2), forming homo- or hetero-complexes. Therefore, it is necessary to develop a responsive engineering strategy for mitochondria that can maintain their activity in the extracellular environment and endow them with specific targeting capabilities, while also dissociating under specific intracellular environmental influences to promote the fusion of exogenous and endogenous mitochondria. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides an engineered mitochondrial nanoshield, its preparation method, and its application, which can be used to engineer and isolate naked mitochondria to treat osteoporosis in the elderly.

[0005] The technical solution provided by this invention is as follows:

[0006] A method for preparing an engineered mitochondrial nanoshield includes the following steps: linking TPP and PEG with a diselenylene bond to obtain TPP-SeSe-PEG-NH2; coupling a nucleic acid aptamer with high affinity for BMMSCs to the amino terminus of TPP-SeSe-PEG-NH2 to obtain an engineered mitochondrial nanoshield, wherein the sequence of the nucleic acid aptamer is shown in SEQ ID NO. 1.

[0007] Furthermore, the preparation method of the engineered mitochondrial nanoshield includes: reacting EDC / NHS with a nucleic acid aptamer containing -COOH in a shaking reaction to pre-activate the carboxyl group; after the reaction is completed, adding TPP-SeSe-PEG-NH2; reacting overnight in the dark; collecting the upper product by centrifugation; and lyophilizing to obtain the engineered mitochondrial nanoshield.

[0008] Furthermore, the preparation method of TPP-SeSe-PEG-NH2 includes: dissolving TPP-COOH and NH2-SeSe-NH2 in DMF respectively, adding EDC and DMAP, reacting fully under nitrogen protection, removing DMF by rotary evaporation under reduced pressure, washing with saturated brine to remove EDC and DMAP, washing with water to remove NH2-SeSe-NH2, drying with anhydrous magnesium sulfate, filtering, rotary drying the filtrate, adding diethyl ether to precipitate the product, obtaining intermediate TPP-SeSe-NH2; then adding intermediate TPP-SeSe-NH2 to DMF, adding succinic anhydride and triethylamine, stirring to react, removing succinic anhydride and triethylamine; drying with anhydrous magnesium sulfate, filtering, adding NH2-PEG-NH2, pyBOP and triethylamine to the filtrate to dissolve completely, stirring to react at room temperature, concentrating under reduced pressure, adding acetone to dissolve completely, and freezing to precipitate TPP-SeSe-PEG-NH2.

[0009] The present invention also provides an engineered mitochondrial nanoshield, which is prepared by the above method.

[0010] The present invention also provides the application of the above-mentioned engineered mitochondrial nanoshields in the preparation of drugs for osteoporosis in the elderly.

[0011] Furthermore, the engineered mitochondria's nanoshield is used to protect against damage from calcium ions in the extracellular environment.

[0012] Furthermore, the engineered mitochondrial nanoshields are used to selectively target BMMSCs to alleviate cellular senescence.

[0013] Furthermore, the engineered mitochondrial nanoshields are used to promote bone regeneration and increase bone mass.

[0014] Furthermore, the engineered mitochondrial nanoshields possess ROS-responsive properties.

[0015] Furthermore, the engineered mitochondrial nanoshield is an injectable solution.

[0016] Beneficial effects

[0017] Nanoscale engineered mitochondria can defend against high concentrations of calcium ions (Ca) of 2 mM in the extracellular environment. 2+ It can cause damage to BMMSCs, while also possessing the ability to target BMMSCs and the characteristics of ROS response.

[0018] The nano-shield engineered mitochondria, after intravenous injection, can selectively target BMMSCs to alleviate cellular senescence and increase bone mass. Attached Figure Description

[0019] Figure 1 This is a flowchart of the present invention;

[0020] Figure 2 Isolation and characterization of mitochondria derived from mouse BMMSCs; Figure 2 In the image, 'a' represents a mitochondrial red fluorescent probe label; Figure 2 In Figure b, the purity of isolated mitochondria is verified by Western blotting.

[0021] Figure 3 The structure and proton NMR spectrum of TPP-SeSe-NH2;

[0022] Figure 4 The structure and 1H NMR spectrum of TPP-SeSe-PEG-NH2;

[0023] Figure 5 Synthesis and characterization of nanoshields; Figure 5 In the middle, 'a' represents a comparison of the spectra before and after oxidation; Figure 5 In the middle, b represents the non-denaturing polyacrylamide gel electrophoresis of Apt and TPP-SeSe-PEG-Apt; Figure 5 In the image, c represents the ultraviolet spectra of TPP-SeSe-PEG-NH2 and TPP-SeSe-PEG-Apt.

[0024] Figure 6 Characterization of the nanoshield; Figure 6 Image a in the image is a laser confocal microscope image of mitochondria, MTSePA, and their combination; Figure 6 In the middle b, the proportion of mitochondria and FITC-positive mitochondria in MTSePA is represented. Figure 6 In the middle, c represents a transmission electron microscope image of mitochondria and MTSePA;

[0025] Figure 7 Performance characterization of MTSePA; Figure 7 In the diagram, 'a' represents the mitochondrial fluorescence distribution peaks. Figure 7 In the figure, b represents the average intensity of mitochondrial fluorescence;

[0026] Figure 8 This demonstrates the mitochondrial fusion capability of MTSePA. Figure 8 In Figure a, mitochondria were labeled with green and red fluorescent probes and observed using laser confocal fluorescence microscopy to observe the extracellular fusion of mitochondria. Figure 8 In the middle b, the degree of co-localization / fusion between exogenous and endogenous mitochondria is represented.

[0027] Figure 9 This study aimed to demonstrate the specific targeting ability of MTSePA to BMMSCs in vivo. Twelve hours after intravenous injection of mitochondria or MTSePA into healthy mice, various cell types were extracted from bone marrow. Flow cytometry and quantitative fluorescence analysis were then performed using BMMSC-labeled antibodies (CD45-negative, CD44- and Sca-1-positive).

[0028] Figure 10 Micro-CT analysis results of the femur in MTSePA-treated senile osteoporosis mice. Figure 10 Image a is a representative Micro-CT three-dimensional reconstruction image of the distal femur of a mouse. Figure 10 In the middle b, the result of quantitative analysis of bone mineral density is shown. Detailed Implementation

[0029] 1. Laboratory animals

[0030] Fifty female C57 / B6J mice, aged 6-8 weeks and weighing 21-37g, SPF grade, were provided by Changzhou Cavens Laboratory Animal Co., Ltd. During the experiment, the housing temperature was 22±3.0℃, and the relative humidity was 60-70%, with free access to food and water. The animal experiments complied with relevant laws and were approved by the Institutional Animal Protection and Utilization Committee of Soochow University (Approval No.: ecsu-2019000198).

[0031] 2. Reagents

[0032] (3-Propylcarboxylic acid)triphenylphosphine bromide (TPP-COOH) is supplied by Xi'an Qiyue Biotechnology Co., Ltd., with product code Q-0368862.

[0033] Selenocysteine ​​(NH2-SeSe-NH2) is supplied by Merck Group of Germany, with product code S0520.

[0034] N,N-Dimethylformamide (DMF) is supplied by Merck Group of Germany, product code 319937.

[0035] 4-Dimethylaminopyridine (DMAP) is supplied by Merck Group of Germany, with product code 107700.

[0036] 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) is supplied by Merck Group of Germany, product code 39391.

[0037] Hydroxysuccinimide (NHS) is supplied by Merck Group of Germany, product code 130672.

[0038] Succinic anhydride is supplied by Merck Group of Germany, product code 8.00683.

[0039] Triethylamine was supplied by Merck Group of Germany, with product code 8.08352.

[0040] Benzotriazole-1-yl-oxytripyrrolidinephosphide hexafluorophosphate (PyBOP) is supplied by Merck Group of Germany, with product code 377848.

[0041] The Cell Mitochondria Isolation Kit was provided by Beyotime Biotechnology Co., Ltd., product code C3601.

[0042] The mitochondrial red fluorescent probe (MitoTracker Red CMXRos) was provided by Shanghai Beyotime Biotechnology Co., Ltd., with product code C1032.

[0043] The mitochondrial green fluorescent probe (MitoTracker Green) was provided by Shanghai Beyotime Biotechnology Co., Ltd., with product code C1048.

[0044] 3. Instruments

[0045] The transmission electron microscope (TEM, brand: FEI) is made in the United States and provided by the Institute of Functional Nano & Soft Materials, Soochow University.

[0046] The confocal microscope (brand: ZEISS) is made in Germany and provided by the Institute of Functional Nano & Soft Materials, Soochow University.

[0047] The ELISA reader (multifunctional microplate reader, brand: bio-tek) is made in the United States and provided by the Institute of Functional Nano & Soft Materials, Soochow University.

[0048] The C6 flow cytometer (brand: BD Biosciences) is manufactured in the United States and provided by the Institute of Functional Nano & Soft Materials, Soochow University.

[0049] The ultrasensitive multifunctional gel imaging system (brand: bio-tek) is made in the United States and provided by the Institute of Functional Nano & Soft Materials, Soochow University.

[0050] Example 1

[0051] Isolation and characterization of mitochondria derived from BMMSCs in young mice:

[0052] BMMSCs from young (4-month-old) mice, passages 3-8, were selected as mitochondrial donor cells. Mitochondria were isolated from BMMSC homogenates labeled with the mitochondrial red fluorescent probe (Mitotracker Red) using a cell-mitochondrial isolation kit via low-temperature differential centrifugation. Figure 2 (a) The purity of isolated mitochondria was verified by Western blot assay. The results showed that mitochondrial marker proteins (mitochondrial fusion protein 1 and voltage-dependent anion channel protein 1) were highly enriched in the isolated product, while cytoplasmic marker proteins (β-actin) and cell membrane marker proteins (sodium potassium ATPase protein A1) were present in trace amounts, confirming the high purity of the isolated mitochondria. Figure 2 (b)

[0053] Synthesis of nano-shield (TPP-SeSe-PEG-Apt, TSePA):

[0054] We used diselenylene (SeSe) bonds to link TPP and PEG, giving it ROS responsiveness. Specifically, the steps included: Weighing TPP-COOH (1.0 eq.) and dissolving it in DMF, adding NH2-SeSe-NH2 (5.0 eq.), EDC (3.0 eq.), and DMAP (0.1 eq.) dissolved in DMF, and reacting at 40°C under nitrogen protection for 1 h. The DMF was removed by rotary evaporation under reduced pressure, and then reconstituted. The mixture was washed three times with saturated brine to remove EDC and DMAP. It was then washed three times with deionized water to remove excess NH2-SeSe-NH2. The mixture was dried over anhydrous magnesium sulfate, filtered, and the filtrate was evaporated to dryness. Diethyl ether was added to precipitate the product, yielding the intermediate TPP-SeSe-NH2. The intermediate TPP-SeSe-NH2 was then placed in a flask, DMF was added, and succinic anhydride (1.2 eq.) and triethylamine (3.0 eq.) were added. The mixture was stirred at room temperature for 2 h. Wash twice with 10% sodium carbonate solution and twice with deionized water to remove succinic anhydride and triethylamine. Dry with anhydrous magnesium sulfate, filter, and add NH2-PEG-NH2 (1.0 eq.), pyBOP (2.0 eq.), and triethylamine (3.0 eq.) to the filtrate until completely dissolved. Stir the reaction at room temperature for 30 min, concentrate under reduced pressure, add acetone to dissolve completely, and freeze to precipitate the product TPP-SeSe-PEG-NH2. Characterize the product using 1H NMR and Fourier transform infrared spectroscopy.

[0055] like Figure 4As shown, a strong and broad multiplet appears in the δ3.6-3.8 ppm region of the 1H NMR spectrum of TPP-SeSe-PEG-NH2 (corresponding to the methylene proton of the -OCH2CH2- unit in the PEG chain). The peak area in this region should be significantly larger than that of TPP-SeSe-NH2 (the control sample without PEG). Figure 3 Furthermore, TPP-SeSe-PEG-NH2 retains the characteristic peaks of TPP (porphyrin ring meso-H: δ 7.5-8.5 ppm). Fourier transform infrared spectroscopy (FTIR) further confirms the successful synthesis of TPP-SeSe-PEG-NH2, with peaks at 665 cm⁻¹. -1 The nearby Se-Se characteristic peaks indicate the presence of diselenylene bonds in the target polymer. Further characterization of the polymer after oxidation with 100 μM H₂O₂ was performed to assess the effect of oxidation on the diselenylene bonds. Compared to the characteristic peaks before oxidation, the characteristic peaks in the infrared spectrum after oxidation show a significant difference at 880 cm⁻¹. -1 The presence of characteristic peaks belonging to selenite groups (SeOOH) nearby confirms the formation of selenite groups. This oxidation process can cause some degree of breakage in the polymer structure. Figure 5 (a)

[0056] To enhance the targeting of mitochondria to BMMSCs, we further coupled a nucleic acid aptamer (Apt) with high affinity for mouse BMMSCs to the amino terminus of TPP-SeSe-PEG-NH2, with the sequence: 5'-COOH GAATTCAGTCGGACAGCGACGACGGTGATATGTCAAGGTCGTATGCACGAGT CAGAGGGATGGACGAATATCGTCTCCC-3' (SEQ ID NO.1), thus forming TPP-SeSe-PEG-Apt. Specifically: EDC / NHS (10 mg / mL) was reacted with Apt containing -COOH at room temperature for 15 min using a constant temperature shaker at 400 rpm to pre-activate the carboxyl groups. After the reaction, 10 times the excess of TPP-SeSe-PEG-NH2 was added, the mixture was wrapped in aluminum foil to protect it from light, and the reaction was allowed to proceed overnight. The next day, the solution was transferred to a 10 K ultrafiltration tube and centrifuged at 5000 rpm for 5 min. The lower layer of the ultrafiltration tube was discarded, and this process was repeated twice. Unconnected TPP-SeSe-PEG-NH2 was discarded, and the upper layer of the ultrafiltration tube was collected. After lyophilization, the final product TPP-SeSe-PEG-Apt (TSePA) was obtained. The product was characterized by native-pAGE electrophoresis and UV-Vis spectrophotometry.

[0057] like Figure 5As shown in Figure b, due to the increased molecular weight after coupling, the migration rate of TPP-SeSe-PEG-Apt in the non-denaturing polyacrylamide gel electrophoresis (Native-PAGE) lanes is significantly lower than that of Apt alone. Furthermore, in the ultraviolet spectrophotometer (…), Figure 5 In section c), TPP-SeSe-PEG-NH2 showed no obvious absorption peak at 260 nm (the PEG chain and amino group did not exhibit strong UV absorption), while TPP-SeSe-PEG-Apt showed a significant absorption peak at 260 nm, corresponding to the characteristic absorption of the conjugated structure of nucleic acid bases in Apt. In summary, we successfully synthesized the polymer TPP-SeSe-PEG-Apt (TSePA), also known as the "nanoshield".

[0058] Characterization of nano-shield engineered mitochondria (MTSePA):

[0059] Based on the high affinity of TPP for mitochondria, we attached a nanoshield to the mitochondrial surface. To verify PEG attachment, we engineered mitochondria using FITC-labeled TPP-SeSe-PEG-NH2. Laser confocal microscopy (LSCM) images showed obvious colocalization of green fluorescent signals on the mitochondrial surface. Figure 6 (a) indicates successful PEG engineering. Flow cytometry further confirmed the PEG modification, showing a significant increase in the fluorescence intensity of FITC channels after modification. Furthermore, the proportion of FITC-positive mitochondria was 96.0% ( Figure 6 (b) Transmission electron microscopy image shows ( Figure 6 (c) The nano-shield engineered mitochondria (MTSePA) have a rougher surface than naked mitochondria, with wavy or wrinkled edges.

[0060] Performance characterization of MTSePA

[0061] We evaluated the protective effect of nanoshield engineering on mitochondria exposed to high concentrations of calcium ions, such as... Figure 7 As shown, after incubation in 2 mM calcium ion buffer for 3 hours, the protective effect of the nano-shield on mitochondria was not significantly different from that of TPP-PEG-NH2 (abbreviated as MTP after engineered mitochondria) (P > 0.05).

[0062] Example 2

[0063] Assessment of mitochondrial fusion capacity of MTSePA:

[0064] To assess the promoting effect of MTSePA's ROS responsiveness on mitochondrial fusion, we labeled mitochondria with green and red fluorescent probes, respectively, and observed extracellular mitochondrial fusion using confocal laser fluorescence microscopy (CLSM). Figure 8 As shown in Figure a, the two types of naked mitochondria can effectively bind outside the cell, while the fusion ability of the nano-shield engineered mitochondria is significantly weakened. Furthermore, the fusion ability of the mitochondria is restored after the addition of 100 μM H2O2.

[0065] Furthermore, we evaluated the mitochondrial fusion capacity of MTSePA in senescent BMMSCs, labeling endogenous and exogenous mitochondria in senescent BMMSCs using green and red fluorescent mitochondrial probes, respectively. The r-value of Pearson correlation analysis represents the degree of colocalization / fusion between exogenous and endogenous mitochondria. Figure 8 As shown in Figure b, both naked exogenous mitochondria and MTSePA can effectively fuse with endogenous mitochondria, while the fusion ability of MTPA, which lacks ROS responsiveness, with endogenous mitochondria is significantly weaker than that of the other two. These results indicate that the ROS responsiveness of the nanoshield is crucial for the rapid fusion of exogenous engineered mitochondria with the endogenous mitochondrial network after entering the cell, thus enabling them to function effectively.

[0066] Example 3

[0067] MTSePA's in vivo bone (marrow) targeting capability:

[0068] To confirm the specific targeting ability of MTSePA to BMMSCs in vivo, mouse bone marrow cells were collected 12 h after injection of mitochondria engineered with different polymers labeled with red fluorescent probes. Subsequently, BMMSCs were stained and labeled with antibodies related to surface markers (CD45, CD44, and Sca-1) and analyzed by flow cytometry. Figure 9 As shown, the MTSePA group exhibited the strongest mitochondrial red fluorescence in CD45(-), CD44(+), and Sca-1(+) related cells (BMMSCs), significantly higher than that of the naked mitochondrial group (P < 0.0001). Furthermore, the fluorescence intensity of the MTSePA group was also significantly higher than that of the MTSeP group (P = 0.0108), further demonstrating the crucial role of Apt in mitochondrial-specific targeting of BMMSCs.

[0069] Micro-CT analysis of the femur in senile osteoporosis mice treated with MTSePA:

[0070] Age-related osteoporosis is a systemic disease, and MTSePA of this invention has been shown to have bone (marrow) targeting. Based on this, we further investigated the efficacy of MTSePA in vivo for the treatment of age-related osteoporosis via systemic administration (tail vein injection). Eighteen-month-old male C57BL / 6J mice were selected as an age-related osteoporosis model, and four-month-old mice were used as healthy controls. Each group of aged mice was injected via tail vein with PBS (100 μL, twice daily) and mitochondrial (Mito, 2 × 10⁻⁶) ... 7 One mitochondria, 150 μL, twice a day) or MTSePA (2×10⁶ ...). 7 150 μL of mitochondria was administered twice daily for 4 weeks. After treatment, mouse femurs were collected for micro-CT analysis. Three-dimensional reconstruction of the femur showed that MTSePA effectively promoted bone regeneration and increased bone mass in aged mice. Figure 10 It is worth noting that MTSePA's therapeutic effect is significantly better than that of naked mitochondria (Mito), a phenomenon that may be due to the protective and targeting effects provided by the nanoshield engineered for mitochondria.

Claims

1. A method of preparing an engineered nanoshield for mitochondria, characterized in that, The method includes the following steps: connecting TPP and PEG with diselenyl bonds to obtain TPP-SeSe-PEG-NH2, and coupling a nucleic acid aptamer with high affinity for BMMSCs to the amino terminus of TPP-SeSe-PEG-NH2 to obtain an engineered mitochondrial nanoshield. The sequence of the nucleic acid aptamer is shown in SEQ ID NO.

1.

2. The method of claim 1, wherein the engineered mitochondrial nanoshield is prepared by, The preparation method of the engineered mitochondrial nanoshield includes: reacting EDC / NHS with a nucleic acid aptamer containing -COOH in a shaking reaction to pre-activate the carboxyl group; after the reaction is completed, adding TPP-SeSe-PEG-NH2; reacting overnight in the dark; collecting the upper product by centrifugation; and lyophilizing to obtain the engineered mitochondrial nanoshield.

3. The method of claim 1, wherein the engineered mitochondrial nanoshield is prepared by, The preparation method of TPP-SeSe-PEG-NH2 includes: dissolving TPP-COOH and NH2-SeSe-NH2 in DMF, adding EDC and DMAP, reacting fully under nitrogen protection, removing DMF by rotary evaporation under reduced pressure, washing with saturated brine to remove EDC and DMAP, washing with water to remove NH2-SeSe-NH2, drying with anhydrous magnesium sulfate, filtering, rotary drying the filtrate, adding diethyl ether to precipitate the product, and obtaining intermediate TPP-SeSe-NH2; then adding intermediate TPP-SeSe-NH2 to DMF, adding succinic anhydride and triethylamine, stirring to react, removing succinic anhydride and triethylamine; drying with anhydrous magnesium sulfate, filtering, adding NH2-PEG-NH2, PyBOP and triethylamine to the filtrate to dissolve completely, stirring to react at room temperature, concentrating under reduced pressure, adding acetone to dissolve completely, and freezing to precipitate TPP-SeSe-PEG-NH2, wherein the DMAP is 4-dimethylaminopyridine.

4. An engineered mitochondrial nanoshield, characterized in that, It is prepared by the method described in any one of claims 1 to 3.

5. A nanoshield engineered mitochondria, characterized in that, The nanoshield engineered mitochondria is prepared by attaching the nanoshield of the engineered mitochondria described in claim 4 to the mitochondrial surface.

6. The use of the nano-shield engineered mitochondria as described in claim 5 in the preparation of a drug for treating osteoporosis in the elderly.

7. Use according to claim 6, characterized in that, The nano-shield engineered mitochondria are used to protect against damage from calcium ions in the extracellular environment.

8. Use according to claim 6, characterized in that, The nanoshield-engineered mitochondria are used to selectively target BMMSCs to alleviate cellular senescence.

9. Use according to claim 6, characterized in that, The nanoshield-engineered mitochondria are used to promote bone regeneration and increase bone mass.

10. Use according to claim 6, characterized in that, The engineered mitochondria of the nanoshield exhibit ROS-responsive properties.

11. Use according to claim 6, characterized in that, The engineered mitochondria of the nanoshield are an injection solution.

Citation Information

Patent Citations

  • CPI-613 mitochondrial targeting small-molecule prodrug, self-assembled nanoparticles thereof, preparation method and application of self-assembled nanoparticles

    CN115337297A

  • Polymer-functionalized mitochondrial compositions and methods of use in cellular transplantation and for altering metabolic phenotype

    WO2019028469A1