Pseudomonas aeruginosa bpsr gene, bpsr protein and application thereof, engineered bacteria and medicine

Abstract

This application relates to a species of Pseudomonas aeruginosa. bpsR Genes, BpsR proteins and their applications, engineered bacteria, and drugs, among which bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1. This invention... bpsR Genes, through regulation in Pseudomonas aeruginosa bpsR Gene expression can regulate the virulence factors of Pseudomonas aeruginosa, such as biofilm production, pyocyanin production, motility, and elastase secretion levels. Furthermore, BpsR protein can be used as a new target for the development of drugs to prevent and treat Pseudomonas aeruginosa, which has important clinical significance for the prevention and control of Pseudomonas aeruginosa infection.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a strain of Pseudomonas aeruginosa. bpsR Genes, BpsR protein, expression bpsR The study also includes biomaterials for genes and their applications, as well as a drug for treating Pseudomonas aeruginosa infections. Background Technology

[0002] Pseudomonas aeruginosa ( Pseudomonas aeruginosa Carbapenem-resistant bacteria (CRB) are key Gram-negative opportunistic pathogens causing hospital-acquired infections. They are explicitly listed as high-priority pathogens in the 2024 WHO list of bacterial resistance priorities. Carbapenem-resistant strains continue to circulate globally, making them one of the leading causes of severe infections, treatment failures, and increased mortality. This bacterium can cause a variety of serious diseases, including pneumonia, bloodstream infections, urinary tract infections, wound infections, and ventilator-associated infections. The risk of infection and mortality is significantly increased in immunocompromised, burn, intensive care, and chronically infected patients, making it a critical challenge for global public health and anti-infective therapy.

[0003] The high pathogenicity and difficulty in treating *Pseudomonas aeruginosa* are primarily dependent on the synergistic effects of multiple virulence factors, including biofilm formation, swimming motility, pyocyanin, and elastase. Biofilms, community structures formed by bacteria adhering to surfaces and encapsulated by an extracellular polymer matrix, significantly enhance bacterial resistance to antibiotics, disinfectants, and the host's immune system, increasing drug tolerance by up to 1000 times and hindering host immune clearance. This is a core reason for persistent infections, recurrence, and implant-related infections. Swimming motility, a flagellated, single-cell movement, is the key driving force for bacterial adhesion to host surfaces, rapid spread, colonization, and the initiation of biofilm formation, directly determining the extent of bacterial invasion and the ability to spread infection. Pyocyanin, a characteristic phenazine-type virulence metabolite, can induce oxidative stress damage in host cells, suppress immune cell function, and regulate biofilm maturation and community stability. Elastases can degrade host tissue barrier proteins, exacerbate inflammatory damage and cell necrosis, and significantly enhance bacterial invasiveness and pathogenicity in vivo. These virulence phenotypes are interconnected and synergistically drive each other, jointly determining the infection process and pathogenic intensity of Pseudomonas aeruginosa.

[0004] Clinical isolates typically exhibit a highly pathogenic phenotype characterized by excessive biofilm formation, enhanced motility, and high expression of virulence factors. They are highly resistant to conventional antibiotic treatment, making effective eradication difficult with traditional antibacterial strategies. Existing antibacterial drugs are mostly bactericidal, which can exacerbate the selection and spread of drug-resistant strains. In contrast, antiviral strategies centered on virulence regulation, because they do not affect bacterial growth and are less likely to generate resistance pressure, have become an important direction for the development of novel anti-infective drugs. Although antiviral therapy has become a cutting-edge approach in combating multidrug-resistant Pseudomonas aeruginosa, currently reported regulatory targets mostly affect only one virulence phenotype. Regulatory genes capable of simultaneously regulating biofilm formation, motility, pyocyanin, elastase, and reducing host cell toxicity remain scarce, making it difficult to achieve synergistic attenuation of multiple virulence phenotypes.

[0005] Therefore, identifying and diagnosing key regulatory genes in Pseudomonas aeruginosa that can simultaneously regulate biofilm formation, swimming motility, pyocyanin synthesis, elastase, and cytotoxicity is of significant theoretical value and clinical application potential for developing highly effective, low-resistance antiviral drugs and overcoming refractory infections caused by multidrug-resistant Pseudomonas aeruginosa. Summary of the Invention

[0006] To address the aforementioned technical challenges, it is necessary to identify novel drug targets for treating infections caused by Pseudomonas aeruginosa, as well as genes influencing biofilm production, pyocyanin production, motility, and elastase secretion levels in Pseudomonas aeruginosa. Based on this, research should be conducted on their key functions and applications in regulating the virulence, pathogenicity, and drug resistance of Pseudomonas aeruginosa.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a Pseudomonas aeruginosa strain. bpsR Genes, the ones mentioned bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0008] Secondly, the present invention provides a method for knocking out Pseudomonas aeruginosa. bpsR The application of genes, the bpsR The gene is the nucleotide sequence shown in SEQ ID No. 1 or an equivalent mutant gene, and the application is any one of F11)-F16): Application of F11 in increasing the biofilm yield of Pseudomonas aeruginosa; Application of F12 in reducing the motility of Pseudomonas aeruginosa; Application of F13 in reducing the production of pyocyanin by Pseudomonas aeruginosa; F15) in enhancing Pseudomonas aeruginosa pelA gene , pelC gene , pelD gene , pelE Application in the expression level of at least one gene in a gene; F16) in reducing Pseudomonas aeruginosa phzA1 Gene, phzC1 Gene, phzD1 Genes and phzE1 Application at the transcriptional level of at least one gene in a gene; Application of F14 in reducing elastase secretion levels in Pseudomonas aeruginosa.

[0009] Thirdly, the present invention provides a strain of Pseudomonas aeruginosa overexpressing. bpsR The application of genes, the bpsR The gene is the nucleotide sequence shown in SEQ ID No. 1 or an equivalent mutant gene, and the application is any one of F21)-F26): Application of F21 in reducing the biofilm production of Pseudomonas aeruginosa; Application of F22 in enhancing the motility of Pseudomonas aeruginosa; Application of F23 in increasing the production of pyocyanin by Pseudomonas aeruginosa; F25) in reducing Pseudomonas aeruginosa pelA gene , pelC gene , pelD gene , pelE Application in the expression level of at least one gene in a gene; F26) in increasing Pseudomonas aeruginosa phzA1 Gene, phzC1 Gene, phzD1 Genes and phzE1 Application at the transcriptional level of at least one gene in a gene; Application of F24 in increasing the secretion level of elastase in Pseudomonas aeruginosa.

[0010] Fourthly, the present invention provides a method for expressing Pseudomonas aeruginosa. bpsR Gene-based biological materials, wherein the biological materials are selected from any one of the following: comprising the first aspect bpsR Gene expression cassettes, containing the aforementioned bpsR Recombinant plasmids containing the gene bpsR Microorganisms that regenerate genes.

[0011] Fifthly, the present invention provides a BpsR protein, wherein the amino acid sequence of the BpsR protein is shown in SEQ ID No. 2, and the BpsR protein is composed of... bpsR Gene expression was obtained, the aforementioned bpsRThe nucleotide sequence of the gene is shown in SEQ ID No. 1. More preferably, the BpsR protein consists of 689 amino acid residues, has a molecular weight of 75.87 kDa, and a theoretical isoelectric point of 5.12.

[0012] In a sixth aspect, the present invention provides another BpsR protein, which is one of the following proteins: a functionally equivalent mutant of the BpsR protein according to the fifth aspect, a fusion protein comprising the functionally equivalent mutant, and a fusion protein comprising the amino acid sequence of the BpsR protein according to the fifth aspect. A further preferred embodiment is that the functionally equivalent mutant is a protein whose amino acid sequence is modified by substitution, deletion, or addition of amino acid residues as shown in SEQ ID No. 2, exhibiting ≥85% homology with the amino acid sequence of the BpsR protein according to the fifth aspect, and still possessing the function of regulating the virulence of *Pseudomonas aeruginosa* (regulating at least one of *Pseudomonas aeruginosa* biofilm production, *Pseudomonas aeruginosa* motility, pyocyanin production, and elastase secretion levels); the fusion protein refers to a fusion protein obtained by attaching a tag sequence (such as a His tag or a Flag tag) to the N-terminus and / or C-terminus of the BpsR protein according to the fifth aspect or the functionally equivalent mutant, and the fusion protein retains the regulatory function of the original protein.

[0013] In a seventh aspect, the present invention provides a target protein for an anti-Pseudomonas aeruginosa infection drug, wherein the target protein is the BpsR protein described in the fifth or sixth aspect.

[0014] Eighthly, the present invention provides the use of BpsR protein in the preparation of drugs against Pseudomonas aeruginosa infection, characterized in that the BpsR protein is the BpsR protein described in the fifth or sixth aspect.

[0015] Ninthly, the present invention provides an anti-Pseudomonas aeruginosa infection drug, wherein the drug's target is selected from at least one of the following targets: those described in the first aspect. bpsR The drug comprises the gene, the BpsR protein described in the fifth aspect, and the BpsR protein described in the sixth aspect; the drug is capable of inhibiting the activity of the BpsR protein. In a further preferred embodiment, the drug further comprises an antibiotic.

[0016] In a tenth aspect, the present invention provides an engineered strain of *Pseudomonas aeruginosa*, wherein the engineered strain is a recombinant strain constructed by the following method M1) or M2): M1) uses genetic engineering technology to knock out Pseudomonas aeruginosa. bpsR Genes, Acquisition bpsR Gene deletion strains; M2) will include bpsR The gene expression vector was transformed into Pseudomonas aeruginosa to obtain bpsRGene overexpression strains; The bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0017] In this invention, a further preferred embodiment is that the Pseudomonas aeruginosa is Pseudomonas aeruginosa LYSZa7.

[0018] In this invention, a further preferred embodiment is that the motility of the *Pseudomonas aeruginosa* is a swimming motility.

[0019] Technical effects of the present invention: This invention, through research, discovered that the gene of *Pseudomonas aeruginosa* contains... bpsR Genes play a crucial role in regulating factors such as virulence factors in Pseudomonas aeruginosa. Specifically, genes in Pseudomonas aeruginosa... bpsR Genes affecting "biofilm production", "motility of Pseudomonas aeruginosa", and "pyophyte production" in Pseudomonas aeruginosa. pelA gene , pelC gene , pelD gene , pelE Gene, phzA1 Gene, phzC1 Gene, phzD1 Genes and phzE1 It has a regulatory effect on the expression level of genes and the secretion level of elastase. Specifically, it affects the biofilm production and secretion level of Pseudomonas aeruginosa. pelA gene , pelC gene , pelD gene , pelE The expression level of genes is negatively regulated, affecting the motility of *Pseudomonas aeruginosa*, the production of pyocyanin, and other genes in *Pseudomonas aeruginosa*. phzA1 Gene, phzC1 Gene, phzD1 Genes and phzE1 Gene expression levels and elastase secretion levels have a positive regulatory effect; in addition, overall, knocking out Pseudomonas aeruginosa... bpsR The gene can reduce its toxicity; thus, it provides a new target protein for the research and development / preparation of drugs against Pseudomonas aeruginosa infection, offering a new technical direction for solving the infection control challenges caused by the high drug resistance and strong virulence of Pseudomonas aeruginosa in clinical practice. This has significant practical implications and application prospects for improving the treatment efficacy and clinical medication of Pseudomonas aeruginosa infection; furthermore, the gene constructed in this invention... bpsR Gene-deleted engineered bacteria and overexpression engineered bacteria exhibit significant phenotypic differences and genetic stability, and can be directly used for high-throughput screening of small molecule inhibitors, antibody drugs, or gene drugs targeting BpsR protein, providing a simple and efficient model for new drug development.

[0020] Other features and aspects of this disclosure will become clear from the following detailed description of exemplary embodiments with reference to the accompanying drawings. Attached Figure Description

[0021] The accompanying drawings, which are included in and form part of this specification, illustrate exemplary embodiments, features, and aspects of this disclosure together with the specification and serve to explain the principles of this disclosure.

[0022] Figure 1 As in Example 2 bpsR Gene deletion mutant (Δ) bpsR PCR identification of mutant strains (agarose gel electrophoresis pattern); Figure 2 In Example 3 bpsR Deletion mutant (Δ) bpsR mutant strains), replacement strains (Δ) bpsR ( bpsR )) and overexpression strain (LYSZa7 ( bpsR PCR identification of agarose gel electrophoresis patterns of experimental groups such as )); Figure 3 As in Example 4 bpsR The graph shows the test data on the regulatory role of genes in biofilm formation of Pseudomonas aeruginosa; Part A shows the biofilm formation data in each strain group; Part B shows the test data on the expression levels (relative mRNA level changes) of genes related to biofilm synthesis in each strain group. Figure 4 As in Example 5 bpsR The graph shows the test data on the regulatory role of genes in the synthesis of pyocyanin in Pseudomonas aeruginosa; Part A shows the test data on the production of pyocyanin in each strain group; Part B shows the test data on the expression level (relative mRNA level change) of genes related to pyocyanin synthesis in each strain group. Figure 5 For example 6 bpsR Graphs showing the regulatory effect of genes on the swimming motility of Pseudomonas aeruginosa; Part A shows photos of each strain group after static culture; Part B shows the swimming diameter test data for each strain group. Figure 6 For example 7 bpsR Graph showing the effect of genes on elastase production in Pseudomonas aeruginosa. Figure 7 For example 8 bpsR Graph of test data on the regulatory effect of genes on the pathogenicity of Pseudomonas aeruginosa (percentage of cell viability); Among them, "LYSZa7 (EV)" indicates the "clinical isolate of Pseudomonas aeruginosa LYSZa7" group, "Δ bpsR "(EV)" indicates the "gene deletion mutant" group, "Δ" bpsR ( bpsR )"express" bpsR The "gene-replenishing strain" group, "LYSZa7 ( bpsR ")" indicates the "overexpression strain" group. Detailed Implementation

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0028] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0029] In a first aspect, the present invention provides a Pseudomonas aeruginosa strain. bpsR Genes, the ones mentioned bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0030]

[0031] Secondly, the present invention provides a method for knocking out Pseudomonas aeruginosa. bpsR The application of genes, the bpsR The gene is the nucleotide sequence shown in SEQ ID No. 1 or an equivalent mutant gene, and the application is any one of F11)-F16): Application of F11 in increasing the biofilm yield of Pseudomonas aeruginosa; Application of F12 in reducing the motility of Pseudomonas aeruginosa; Application of F13 in reducing the production of pyocyanin by Pseudomonas aeruginosa; F15) in enhancing Pseudomonas aeruginosa pelA gene , pelC gene , pelD gene , pelE Application in the expression level of at least one gene in a gene; F16) in reducing Pseudomonas aeruginosa phzA1 Gene, phzC1 Gene, phzD1 Genes and phzE1 Application at the transcriptional level of at least one gene in a gene; Application of F14 in reducing elastase secretion levels in Pseudomonas aeruginosa.

[0032] Thirdly, the present invention provides a strain of Pseudomonas aeruginosa overexpressing. bpsR The application of genes, the bpsR The gene is the nucleotide sequence shown in SEQ ID No. 1 or an equivalent mutant gene, and the application is any one of F21)-F26): Application of F21 in reducing the biofilm production of Pseudomonas aeruginosa; Application of F22 in enhancing the motility of Pseudomonas aeruginosa; Application of F23 in increasing the production of pyocyanin by Pseudomonas aeruginosa; F25) in reducing Pseudomonas aeruginosa pelA gene , pelC gene , pelD gene , pelE Application in the expression level of at least one gene in a gene; F26) in increasing Pseudomonas aeruginosa phzA1 Gene, phzC1 Gene, phzD1 Genes and phzE1 Application at the transcriptional level of at least one gene in a gene; Application of F24 in increasing the secretion level of elastase in Pseudomonas aeruginosa.

[0033] Fourthly, the present invention provides a method for expressing Pseudomonas aeruginosa. bpsR Gene-based biological materials, wherein the biological materials are selected from any one of the following: comprising the first aspect bpsR Gene expression cassettes, containing the aforementioned bpsR Recombinant plasmids containing the gene bpsR Microorganisms that regenerate genes.

[0034] Fifthly, the present invention provides a BpsR protein, wherein the amino acid sequence of the BpsR protein is shown in SEQ ID No. 2, and the BpsR protein is composed of... bpsR Gene expression was obtained, the aforementioned bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1. More preferably, the BpsR protein consists of 689 amino acid residues, has a molecular weight of 75.87 kDa, and a theoretical isoelectric point of 5.12.

[0035] The specific amino acid sequence of the SEQ ID No. 2 sequence (also referred to as Sequence 2) is: MDMTSLMPLLLGVGLVVLLVVGLLALFKAFYIKVPQGTALIVNDMSSTPKVHFTGALVYPVIHLKEFMRISLITLEVDRRGKDGLICRDNMRADITVAFYLRVNETQDDVLKVAKAIGVDRASDRSAVNELFNAKFSEALKTVGKQFDFVQLFENRQDFRDRIIEVIGNDLNGYVLEDVAIDYLEQTAKNSLDPSNILDAEGIRKITELTATQNVITNELERNEELAIKKKNVETREAALALERQQADAEARQKREIETIRAREEAETARVKEEERLKAEQARIQAQQEIDVRTENHQREVEVAQQNRQRAVVIEVEKVTRAKDLEIVAREREVELQKIEKEKALEEQRKNIANVIRERVAVEKTVAQEEERIKEVREVSEAERVKQVILLQAQAEAEQELVRQVKQAEADEARSKHKAVEINTMAQAELEAASKQAEAKKRLAEGIEAERAAPGLADARVLEVTAAAKEKDGLAAARVRAEQLIAEARGDEERGLADARVLEAQAAAKEKDGLAEAKVLAEKLGAQARGEEQLGAAKAKATKDQGSAEAEVLLQRLNAEAEGLGKKFGALDALSDSARQHEEFRMQLEKSFEEAMAAIAANKDIAKDQAEVLATALGKANIEIVGGEGDFFNSFAKSLSVGKAIEGVVGKSPVVQDVLARLLNGRGSAAAVVPERKSGHENEPAAEV.

[0036] In a sixth aspect, the present invention provides another BpsR protein, which is one of the following proteins: a functionally equivalent mutant of the BpsR protein according to the fifth aspect, a fusion protein comprising the functionally equivalent mutant, and a fusion protein comprising the amino acid sequence of the BpsR protein according to the fifth aspect. A further preferred embodiment is that the functionally equivalent mutant is a protein whose amino acid sequence is modified by substitution, deletion, or addition of amino acid residues as shown in SEQ ID No. 2, exhibiting ≥85% homology with the amino acid sequence of the BpsR protein according to the fifth aspect, and still possessing the function of regulating the virulence of *Pseudomonas aeruginosa* (regulating at least one of *Pseudomonas aeruginosa* biofilm production, *Pseudomonas aeruginosa* motility, pyocyanin production, and elastase secretion levels); the fusion protein refers to a fusion protein obtained by attaching a tag sequence (such as a His tag or a Flag tag) to the N-terminus and / or C-terminus of the BpsR protein according to the fifth aspect or the functionally equivalent mutant, and the fusion protein retains the regulatory function of the original protein.

[0037] In a seventh aspect, the present invention provides a target protein for an anti-Pseudomonas aeruginosa infection drug, wherein the target protein is the BpsR protein described in the fifth or sixth aspect.

[0038] Eighthly, the present invention provides the use of BpsR protein in the preparation of drugs against Pseudomonas aeruginosa infection, characterized in that the BpsR protein is the BpsR protein described in the fifth or sixth aspect.

[0039] Ninthly, the present invention provides an anti-Pseudomonas aeruginosa infection drug, wherein the drug's target is selected from at least one of the following targets: those described in the first aspect. bpsR The drug comprises the gene, the BpsR protein described in the fifth aspect, and the BpsR protein described in the sixth aspect; the drug is capable of inhibiting the activity of the BpsR protein. In a further preferred embodiment, the drug further comprises an antibiotic.

[0040] In a tenth aspect, the present invention provides an engineered strain of *Pseudomonas aeruginosa*, wherein the engineered strain is a recombinant strain constructed by the following method M1) or M2): M1) uses genetic engineering technology to knock out Pseudomonas aeruginosa. bpsR Genes, Acquisition bpsR Gene deletion strains; M2) will include bpsR The gene expression vector was transformed into Pseudomonas aeruginosa to obtain bpsR Gene overexpression strains; The bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0041] In this invention, a further preferred embodiment is that the Pseudomonas aeruginosa is Pseudomonas aeruginosa LYSZa7.

[0042] In this invention, a further preferred embodiment is that the motility of the *Pseudomonas aeruginosa* is a swimming motility.

[0043] Specific experimental statistics in the embodiments of this invention: All experiments (each embodiment) of this invention were performed with at least three independent biological replicates. Experimental results are expressed as mean ± standard deviation (Mean ± SD). Statistical analysis of the data was performed using two-tailed paired data. t Test (Two-tailed paired Student's) t -test). Annotation notes: P < 0.05 P < 0.01, P < 0.001, ns indicates no significant difference; P < 0.05 is used as the criterion for statistical significance.

[0044] Example 1: Pseudomonas aeruginosa LYSZa7 bpsR Gene acquisition and sequence analysis Using the genomic DNA of the clinical isolate *Pseudomonas aeruginosa* LYSZa7 as a template, and based on sequencing results from NCBI and our laboratory, we designed an amplification... bpsR Full-length gene-specific primers P1 / P2 were used. PCR amplification yielded the target fragment, which was then verified by sequencing. bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1; the amino acid sequence of the BpsR protein it encodes is shown in SEQ ID No. 2, consisting of 689 amino acid residues, with a predicted molecular weight of 75.87 kDa and a theoretical isoelectric point of 5.12.

[0045] The primer sequences for P1 and P2 are as follows: P1: GAATCAAGGAGAACTGCTGCT; P2: GAGGAGGCTGCGGGTCGAC.

[0046] Example 2: Pseudomonas aeruginosa LYSZa7 Δ bpsR Construction of gene mutant strains LYSZa7 was constructed using homologous recombination knockout technology. bpsR Gene deletion strains: (1) Design primers P2-F / P2-R and P3-F / P3-R for PCR amplification. bpsRUpstream homology arm (approximately 500 bp) and downstream homology arm (approximately 500 bp) of the gene. (2) The upstream and downstream homologous arms were fused by overlap PCR using primers P2-F and P3-R and ligated into the knockout vector pK18mobsacB to construct the recombinant knockout plasmid pK18- bpsR ; (3) Through triparental hybridization (LYSZa7, pRK2013, pK18- bpsR The recombinant plasmid was introduced into Pseudomonas aeruginosa LYSZa7. (4) Double-exchange recombinant strains were obtained by forward screening with gentamicin sulfate (purchased from Shanghai Maclean Biotechnology Co., Ltd., item number: 768500) and reverse screening with 10% sucrose (purchased from Shanghai Maclean Biotechnology Co., Ltd., item number: S6212); (5) Primers P4-F / P4-R were designed and verified by colony PCR and sequencing to obtain Δ bpsR mutant strain ( Figure 1 ).

[0047] The nucleotide sequence of the primer is as follows: P2-F: agctcggtacccggggatccCTGCTGGCGAAGCTGAAACT; P2-R:gtcgacGAACAGGGGCCAGCAGGCC; P3-F: tgctggccctgttcGTCGACCCGCAGCCTCCT; P3-R: cgacggccagtgccaagcttCTCGTAGCCTTCGCTGCCC; P4-F: GGAAAGCACCAGCAGCAAGTC; P4-R:CAACGGCCTTGTCCAATACG.

[0048] Example 3: bpsR Construction of gene complementation and overexpression strains 1. Design primers P5-F / P5-R for amplification. bpsR Full-length sequence, followed by bpsR The full-length gene was cloned into a broad-host expression vector to construct complement / overexpression plasmids; 2. The recombinant plasmids were transformed into Δplasmosomes by electric shock (2.5 kV). bpsR The missing strain and the wild-type LYSZa7; 3. After antibiotic selection, PCR identification (primer P6-F / P6-R), and sequencing verification, the following results were obtained: Replacement strains (Δ bpsR ( bpsR )) and overexpression strain (LYSZa7 ( bpsR Simultaneously, control strains containing empty vectors were constructed: LYSZa7 (EV), Δ bpsR (EV) Figure 2 ).

[0049] The nucleotide sequence of the primer is as follows: P5-F:gagctcggtacccggggatccATGGATATGACGTCGCTGATGC; P5-R: acgacggccagtgccaagcttTCAGACTTCCGCCGCCGG; P6-F: CAGCTTGGCACGACAGGTTTC; P6-R:TCTTCGCTATTACGCCAGCTG.

[0050] Example 4: bpsR Effects of genes on biofilm formation in Pseudomonas aeruginosa Quantitative detection of biofilms was performed using crystal violet staining. 1. LYSZa7(EV), Δ bpsR (EV), Δ bpsR ( bpsR ), LYSZa7 bpsR The bacteria were activated on LB agar plates (Tryptone: 10 g / L, Yeast Extract: 5 g / L, NaCl: 10 g / L, Agar: 15 g / L), and single colonies were picked and inoculated into LB liquid medium (Tryptone: 10 g / L, Yeast Extract: 5 g / L, NaCl: 10 g / L) and cultured at 37 °C with shaking until the logarithmic growth phase. 2. Adjust the OD of each bacterial strain using fresh LB medium. 600 The value was adjusted to 0.002. 120 μL of diluted bacterial solution was added to a 96-well plate, with 3 replicates per group. The plate was then incubated at 37 °C for 4 h. 3. Discard the bacterial solution in the well, and gently wash three times with sterile water to remove any unadhered bacteria; 4. Add 150 μL of 0.1% (m / v) crystal violet solution to each well and let it stand at room temperature for 20 min to stain; 5. Discard the staining solution, wash with sterile water until no free dye remains, air dry at room temperature, add 200 μL of 95% (v / v) ethanol, and let stand for 20 min to fully dissolve the crystal violet; 6. Use a multi-functional microplate reader to measure the absorbance at 570 nm, and set up at least three independent biological replicates for the experiment.

[0051] Meanwhile, RT-qPCR was used to detect genes related to biofilm synthesis in the four strains. pelA , pelC , pelD , pelE Transcription level: Logarithmic growth phase cells of each strain were collected, and total RNA was extracted using a total RNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 19301ES50). The integrity and concentration of RNA were detected by agarose gel electrophoresis and nucleic acid quantification. The total RNA was reverse transcribed into cDNA using a reverse transcription kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 11139ES60) and stored at -20 ℃ for later use. Nanjing Novizan ChamQ TM Universal SYBR ® The qPCR Master Mix kit (catalog number: Q331-02) is used to prepare the qPCR reaction system. rplU For internal reference genes, pelA , pelC , pelD , pelE For the target gene; rplU Internal reference gene sequence: rplU -F:AGGCGAATTCCTCAAGGTCG rplU -R:AGCGGTAACCTTCGCACCTT qPCR reaction conditions: 95 ℃ for 30 s; 95 ℃ for 10 s, 60 ℃ for 30 s, 40 cycles; melting curve phase: 95 ℃ for 15 s, 60 ℃ for 60 s, 95 ℃ for 15 s; Use 2 -ΔΔCt The relative expression level of the target gene was calculated using a method with three independent biological replicates and three technical replicates per replicate.

[0052] The results show that, compared with LYSZa7(EV), Δ bpsR (EV) strains showed a significantly increased biofilm formation rate. pelA , pelC , pelD , pelE Gene expression levels were significantly upregulated; complement strain Δ bpsR ( bpsRThis can restore biofilm production and related gene expression to wild-type levels; the overexpression strain LYSZa7 ( bpsR Biofilm formation ability and pelA , pelC , pelD , pelE Gene expression was further reduced. These results indicate that... bpsR Genes through negative regulation pelA , pelC , pelD , pelE Synthesize gene expression to inhibit biofilm formation in Pseudomonas aeruginosa ( Figure 3 ).

[0053] Example 5: bpsR Effects of genes on pyocyanin synthesis LYSZa7(EV), Δ bpsR (EV), Δ bpsR ( bpsR ), LYSZa7 bpsR The culture was incubated in 3 mL LB medium for 24 h. The bacterial suspension was centrifuged at 13800 g, and the supernatant was filtered through a 0.22 μm filter to remove residual cell debris. The absorbance was measured at 695 nm using a microplate reader, and the pyocyanin concentration was calculated based on the absorbance value. Simultaneously, RT-PCR was used... qPCR method for detecting wild-type control strains, Δ bpsR Genes related to Pseudomonas aeruginosa synthesis in mutant strains, complemented strains, and overexpressed strains phzA1 , phzC1 , phzD1 , phzE1 The transcriptional level.

[0054] The results showed that, compared with the wild-type control, Δ bpsR The mutant strain showed a significant reduction in pyocyanin synthesis. phzA1 , phzC1 , phzD1 , phzE1 The expression level of [a substance] was significantly downregulated; the replenished strain could restore the level of Pseudomonas aeruginosa synthesis and the expression level of related synthetic genes, indicating that [the substance]... bpsR Genes can positively regulate the synthesis of pyocyanin in Pseudomonas aeruginosa and the transcription of its synthesis gene. Figure 4 ).

[0055] Example 6: bpsR The influence of genes on swimming performance The semi-solid agar method was used to detect swimming ability.

[0056] The semi-solid culture medium used for the migration assay consisted of 5 g / L peptone, 3 g / L yeast extract, and 0.25% (w / v) agar. 15 mL of the above migration medium was poured into a 90 mm Petri dish, allowed to solidify, and then sealed to prevent moisture loss. 1 μL of overnight culture, or a single colony from overnight culture, was picked up with a sterile toothpick and spot-inoculated into the center of the migration plate. The plate was then sealed and incubated at 37°C for 14 h. After incubation, the diameter of bacterial migration diffusion was measured and recorded.

[0057] The results showed that, compared with the wild-type control strain, Δ bpsR The (EV) strain showed a significantly reduced motility diffusion diameter and a markedly weakened motility; the replenished strain Δ bpsR ( bpsR This can restore swimming ability to wild-type levels, while the expression strain LYSZa7 ( bpsR The swimming ability has further increased, indicating bpsR Genes positively regulate the swimming motility of Pseudomonas aeruginosa ( Figure 5 ).

[0058] Example 7: bpsR Effects of genes on elastase secretion in Pseudomonas aeruginosa Using elastin Congo red method for detecting elastase activity.

[0059] The test strains were activated on LB agar plates and incubated overnight at 37°C; single colonies were picked and inoculated into LB liquid medium and incubated overnight, adjusting the bacterial concentration to OD0.05. 600 The concentration was 0.02, and the culture was transferred to fresh LB liquid medium and incubated at 37 ℃ with shaking at 200 rpm for 16 h. After incubation, the bacterial culture was centrifuged at 14000 rpm, and the supernatant was filtered through a 0.22 μm filter membrane for sterilization. 500 μL of the supernatant was mixed with an equal volume of elastin. The Congo red reaction solution (0.5 M Tris-HCl, 5 mM CaCl2, pH 7.5, 40 mg / L Elatastin Congo Red) was thoroughly mixed and incubated at 37 °C and 200 rpm for 3 h. The reaction was terminated by adding 0.1 mL of 0.12 M EDTA solution. After standing on ice, the mixture was centrifuged at 5000 rpm and 4 °C to remove unreacted substrate. The absorbance at 495 nm was measured using a microplate reader. The relative activity of elastase was calculated by subtracting the background blank from the reaction absorbance. Each group was configured with three biological replicates, and the experiment was independently repeated three times.

[0060] The results showed that, compared with the wild-type strain, bpsRThe elastase secretion level of the gene mutant strain was significantly reduced; the elastase activity of the complemented strain could be restored to the wild-type level; the overexpression strain LYSZa7 ( bpsR The level of elastase secretion in the elastase was further increased. Figure 6 The above results indicate that... bpsR Genes positively regulate the synthesis and secretion of elastase in Pseudomonas aeruginosa.

[0061] Example 8: bpsR Effects of genes on the cytotoxicity of Pseudomonas aeruginosa The LYSZa7 (EV) and ΔCytotoxicity assay kit were used to determine the levels of lactate dehydrogenase (LDH). bpsR (EV), Δ bpsR ( bpsR ), LYSZa7 bpsR ) Toxicity of human lung adenocarcinoma A549 cells.

[0062] A549 cells were seeded in 96-well cell culture plates and cultured until the cell density reached 80%–90%. They were then seeded with LYSZa7 (EV) and Δ... bpsR (EV), Δ bpsR ( bpsR ), LYSZa7 bpsR A549 cells were infected, with a control group of uninfected cells and a control group for maximum LDH release. After infection, the cells were cultured until the specified time point. One hour before the assay, cell lysis buffer was added to the control wells for maximum enzyme activity to fully lyse the cells.

[0063] Centrifuge the culture plate at 400 g for 5 min, and transfer 120 μL of the supernatant from each group to a new 96-well plate. Prepare LDH detection working solution fresh immediately before use, add 60 μL of the working solution to each well, and incubate at room temperature in the dark for 30 min. Measure the absorbance at 490 nm using a microplate reader, using 600 nm as a reference wavelength to eliminate background interference.

[0064] Calculate the cytotoxicity rate according to the kit formula: Cytotoxicity (%) = (OD value of treated sample) (OD value of sample control well) / (OD value of maximum enzyme activity in cells) (OD value of sample control well) × 100%.

[0065] The results showed that, compared with the wild-type strain, bpsR The mutant strain showed significantly reduced toxicity to A549 cells; Δ bpsR ( bpsR ) can restore cytotoxicity to wild-type levels; LYSZa7 ( bpsRThe damage to A549 cells was further enhanced. Figure 7 The above results indicate that... bpsR Genes can positively regulate the toxic effects of Pseudomonas aeruginosa on host cells.

[0066] The above embodiments merely illustrate several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications or improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.

Claims

1. A knockout Pseudomonas aeruginosa bpsR The application of genes is characterized by, The bpsR The gene is the nucleotide sequence shown in SEQ ID No. 1, and the application is any one of F11)-F14): Application of F11 in increasing the biofilm yield of Pseudomonas aeruginosa; Application of F12 in reducing the motility of Pseudomonas aeruginosa; Application of F13 in reducing the production of pyocyanin by Pseudomonas aeruginosa; Application of F14 in reducing elastase secretion levels in Pseudomonas aeruginosa; The application described is for purposes other than disease diagnosis and treatment.

2. A strain overexpressing Pseudomonas aeruginosa bpsR The application of genes, the bpsR The gene is the nucleotide sequence shown in SEQ ID No. 1, and the application is any one of F21)-F24): Application of F21 in reducing the biofilm production of Pseudomonas aeruginosa; Application of F22 in enhancing the motility of Pseudomonas aeruginosa; Application of F23 in increasing the production of pyocyanin by Pseudomonas aeruginosa; Application of F24 in increasing the secretion level of elastase in Pseudomonas aeruginosa; The application described is for purposes other than disease diagnosis and treatment.

3. An engineered strain of *Pseudomonas aeruginosa*, characterized in that, The engineered bacteria are recombinant strains constructed using the following method (M1) or (M2): M1) uses genetic engineering technology to knock out Pseudomonas aeruginosa. bpsR Genes, Acquisition bpsR The gene-deleted strain, namely *Pseudomonas aeruginosa*, contains... bpsR The gene of Pseudomonas aeruginosa LYSZa7; M2) will include bpsR The gene expression vector was transformed into Pseudomonas aeruginosa to obtain bpsR Gene overexpression strains; The bpsR The nucleotide sequence of the gene is shown in SEQ ID No. 1.

Images