InDel molecular marker closely linked to the first female flower node gene of benincasa cerifera and application thereof

CN122279083APending Publication Date: 2026-06-26GUANGXI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGXI UNIV
Filing Date
2026-04-21
Publication Date
2026-06-26

Smart Images

  • Figure CN122279083A_ABST
    Figure CN122279083A_ABST
Patent Text Reader

Abstract

This invention discloses an InDel molecular marker closely linked to the gene at the first female flower node of wax gourd. The InDel molecular marker uses wax gourd genomic DNA as a template and is amplified using an InDel molecular marker primer pair. The upstream primer nucleotide sequence is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO. 2. The nucleotide sequences amplified using the InDel molecular marker primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4. Using the molecular marker of this invention, it can be used for the identification and screening of high / low phenotypes at the first female flower node of wax gourd, and can rapidly, accurately, and effectively breed wax gourd varieties with high / low first female flower node characteristics, accelerating the crop breeding process and improving breeding efficiency and success rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to an InDel molecular marker closely linked to the first female flower node gene of Cucurbita japonica and its application. Background Technology

[0002] Winter melon ( Benincasa hispida Cogn. var. chieh-qua The winter melon (also known as the small winter melon) is widely cultivated in my country and is a specialty vegetable of South my country. It is one of the main melon crops in the south and a major vegetable variety transported from the south to the north. Therefore, the ripening and market timing of its fruit are particularly important. Consequently, winter melon breeding has significant economic and social value for the future development of my country's vegetable industry.

[0003] Flowering marks the transition of a plant from the vegetative growth stage to the reproductive growth stage and is crucial for plant reproduction. Breeding practice has shown that the lower the position of the first female flower node, the earlier the fruit reaches the market. The position of the first female flower node in wax gourd directly affects important agronomic traits such as fruit maturity and yield. Therefore, targeted breeding based on the first female flower node is crucial in wax gourd breeding. If the key regulatory genes for the first female flower node can be obtained, targeted selection of the first female flower node in wax gourd can be carried out according to market demand characteristics. This can not only stagger market entry, thereby increasing fruit prices and farmers' income, but also shorten the breeding cycle and improve breeding efficiency. However, due to the lack of genomic information and related molecular biology research in the early stages, key regulatory genes and applied molecular markers for the first female flower node in wax gourd have not yet been reported, and progress in molecular design breeding is slow.

[0004] Molecular marker-assisted breeding, as an important auxiliary tool in current molecular design breeding, hinges on the development of highly efficient functional markers. Functional markers that are tightly linked to and stable with the target trait, and are easy and quick to detect, can directly select for genotypes, greatly improving the accuracy and efficiency of selection in breeding and significantly shortening the breeding cycle. Therefore, cloning key regulatory genes for the first female flower node of wax gourd, analyzing their functions, establishing a related molecular marker identification system, and developing functional molecular markers that co-segregate or are tightly linked to the first female flower node trait of wax gourd have significant theoretical and applied value for achieving targeted molecular breeding of the first female flower node of wax gourd.

[0005] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] The purpose of this invention is to provide an InDel molecular marker closely linked to the gene of the first female flower node in wax gourd and its application. This molecular marker can be used to quickly and accurately identify the high and low phenotypes of the first female flower node in wax gourd.

[0007] To achieve the above objectives, the present invention provides an InDel molecular marker closely linked to the first female flower node gene of wax gourd, wherein the InDel molecular marker is amplified using wax gourd genomic DNA as a template and InDel molecular marker primer pair.

[0008] The upstream primer nucleotide sequence of the InDel molecular marker primer pair is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO. 2; the nucleotide sequences obtained by amplification of the InDel molecular marker primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0009] A kit containing the InDel molecular marker or the InDel molecular marker primer pair described above.

[0010] The application of the above-described InDel molecular marker primer pair, the above-described InDel molecular marker, or the above-described kit includes:

[0011] (1) Application in identifying the position of the first female flower node in wax gourd;

[0012] (2) Application of molecular marker-assisted breeding in the high and low node position of the first female flower of wax gourd.

[0013] A method for determining the position of the first female flower node in a wax gourd includes the following steps:

[0014] (1) Using the DNA of the wax gourd material to be tested as a template, PCR amplification was performed using InDel molecular marker primers to obtain SEQ ID NO. 1-2, and PCR products were obtained; the InDel molecular marker was amplified using wax gourd genomic DNA as a template and InDel molecular marker primers; the nucleotide sequences amplified by InDel molecular marker primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4;

[0015] (2) Perform gel electrophoresis on the amplification products and observe the electrophoresis results.

[0016] Preferably, in the above technical solution, step (1) PCR reaction system: in a 12μl reaction system, 2μL of DNA template solution, 5μL of 2×Taq Mix, 1μL each of forward and reverse primers, with a concentration of 10uM / L, and 3μL of ddH2O to make up the total volume to 12μL;

[0017] PCR amplification reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.

[0018] Step (2) The gel is an 8% non-denaturing polyacrylamide gel.

[0019] Preferably, in the above technical solution, the method for judging the electrophoresis detection result in step (2) is as follows:

[0020] The InDel molecular marker primers amplified a 115bp fragment, indicating that the tested wax gourd sample was a low-node variety with the first female flower.

[0021] The InDel molecular marker primers amplified a 106bp fragment, indicating that the tested wax gourd sample was a high-node variety with the first female flower.

[0022] The InDel molecular marker primers simultaneously amplified fragments of 115 bp and 106 bp, indicating that the sample to be tested was heterozygous.

[0023] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention relates to the InDel molecular marker closely linked to the gene for the first female flower node in wax gourd and its application. The developed InDel marker (FFFN2.2) was screened for polymorphism using the parents YMY-24-1-6-1 and YN-1-1 and their F1 hybrids. Screening revealed that the molecular marker FFFN2.2 exhibits stable polymorphism between the parents. Combined with the F1 detection results, FFFN2.2 was determined to be a co-dominant marker, and the amplified bands from this marker were clear and showed significant differences between the parents. Based on the InDel molecular marker, InDel primer sequences were designed for PCR amplification, and the detection results were observed to identify the high / low phenotype of the first female flower node in wax gourd. Using the molecular marker of this invention, it can be used for the identification and screening of the high / low phenotype of the first female flower node in wax gourd, and can rapidly, accurately, and effectively breed wax gourd varieties with high / low first female flower node characteristics, accelerating the crop breeding process and improving breeding efficiency and success rate. Attached Figure Description

[0024] Figure 1 This is an electrophoresis diagram of the amplification results of the InDel molecular marker FFFN2.2 according to the present invention in the low-node inbred line YMY-24-1-6-1, the high-node inbred line YN-1-1, and the F1 generation hybrids of the two; in the figure, P1 is YMY-24-1-6-1; P2 is YN-1-1; F1 is the first generation hybrid of YMY-24-1-6-1 and YN-1-1;

[0025] Figure 2 This is an electrophoresis diagram showing the verification results of the InDel molecular marker FFFN2.2 according to the present invention in 10 germplasm materials of Cucurbita moschata with known high and low first female flower node positions. Detailed Implementation

[0026] The following detailed description of specific embodiments is provided in conjunction with the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.

[0027] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.

[0028] Unless otherwise specified, all raw materials and reagents used in the examples are commercially available.

[0029] I. Obtaining the Functional Marker FFFN2.2

[0030] 1. Targeting the construction of the target audience

[0031] Using inbred lines YMY-24-1-6-1 (P1, lower nodes: 9-17) and YN-1-1 (P2, higher nodes: 30-35) as experimental materials, an F2 population was constructed. An F2 population containing 2000 individual plants was obtained.

[0032] 2. Development of functional tags

[0033] Indel markers were developed near the candidate gene BchFFFN2.2 sequence at the high / low node of the first female flower of *Cucumis melo*, which was previously finely mapped. Primers were designed and PCR amplification was performed at some stable sites (generally 15 bp or more with ≥3 bp differential bases).

[0034] 3. Obtaining the functional marker WP-1

[0035] Polymorphism screening of the developed Indel marker was performed using parental lines YMY-24-1-6-1 and YN-1-1, as well as F1 assays. Screening revealed that the functional marker FFFN2.2 exhibited stable polymorphism between the parents. Combined with F1 assay results, FFFN2.2 was determined to be a co-dominant marker, and the amplified bands produced by this marker were clear and showed significant differences between the parents. Figure 1 ).

[0036] like Figure 1 The results show that the functional marker FFFN2.2 contains a 115 bp fragment in the low-node inbred line YMY-24-1-6-1 with the first female flower, and a 106 bp fragment in the genomic DNA amplification product of the high-node inbred line YN-1-1 with the first female flower. The genomic DNA amplification product of the F1 generation from these two lines contains both 115 bp and 106 bp fragments. The nucleotide sequences of the primer pairs for marker FFFN2.2, SEQ ID NO. 1 and SEQ ID NO. 2, are shown below:

[0037] SEQ ID NO.1, F: 5'-TCAGTATAATATTCTTGTGCCTTGC-3';

[0038] SEQ ID NO. 2, R: 5'-TTCTCTAACTTTGTTTTCCTCTCCCT-3'.

[0039] The nucleotide sequence of YMY-24-1-6-1 (115 bp), SEQ ID NO. 3, is shown below:

[0040] TCAGTATAATATTCTTGTGCCTTGCAAAGAAACTAAAGTTTCATATAGAGAAATATTTAGTATATTTAGTATCGAAATCAGAAAGTGTTTAGGGAGAGGAAACAAAGTTAGAGAA.

[0041] The nucleotide sequence of YN-1-1 (106 bp), SEQ ID NO. 4, is shown below:

[0042] TCAGTATAATATTCTTGTGCCTTGCAAAGAAACTAAAGTTTCATATAGAGAAATATTTAGTATCGAAATCAGAAAGTGTTTAGGGAGAGGAAACAAAGTTAGAGAA.

[0043] II. Application of the functional marker FFFN2.2

[0044] 1. Test materials

[0045] This invention utilizes five accessions of wax gourd germplasm with the first female flower at a low node and five accessions with the first female flower at a high node to validate the functional marker FFFN2.2. The germplasm materials used were obtained from the College of Agriculture, Guangxi University.

[0046] 2. Test methods

[0047] Genotyping of the above-mentioned test materials was performed using the functional marker FFFN2.2, with the genomic DNA of the test materials as the template.

[0048] PCR reaction system (12 μl): 2 μl DNA template solution, 5 μl 2×Taq Mix, 1 μl each of forward and reverse primers (10 uM / L), and bring the total volume to 12 μl with 3 μl ddH2O.

[0049] PCR amplification reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.

[0050] Subsequently, the amplified products were subjected to 8% non-denaturing polyacrylamide gel electrophoresis, stained with 1% silver nitrate for 5 min, and then developed with a mixture of sodium hydroxide and formaldehyde. Finally, the samples were observed and photographed. When reading the electrophoretic gel images, bands identical to YMY-24-1-6-1 were marked as "a", bands identical to YN-1-1 were marked as "b", and hybrid bands containing both parental bands were marked as "h".

[0051] 3. Test Results

[0052] The genotypes of 10 *Cucurbita moschata* germplasms were detected by electrophoresis using the functional marker FFFN2.2. The results are as follows: Figure 2 As shown, the molecular marker FFFN2.2 contained a 115 bp fragment in the PCR amplification products of the low first female flower node phenotype germplasm (1-5), and a 106 bp fragment in the PCR amplification products of the high first female flower node phenotype germplasm (6-10), which is consistent with the results of the high / low first female flower node phenotype identification of the tested materials.

[0053] The phenotypes and genotypes of the first female flower node position of 10 wax gourd germplasm resources were statistically analyzed, and the results are shown in Table 1.

[0054] Table 1. Statistical analysis of the first female flower node position and genotype of 10 *Cucumis melo* germplasm resources.

[0055]

[0056] The above results demonstrate that the functional marker FFFN2.2 of the present invention has strong specificity and can be used for the identification and screening of the high and low node positions of the first female flower in Gastrodia elata.

[0057] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. An InDel molecular marker closely linked to the gene at the first female flower node of *Cucurbita stenoptera*, characterized in that, The InDel molecular marker was obtained by amplifying the sequence using the genomic DNA of Cucurbita moschata as a template and the InDel molecular marker primer pair. The upstream primer nucleotide sequence of the InDel molecular marker primer pair is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.

2. The nucleotide sequences obtained by amplification using InDel molecular marker primers are shown in SEQ ID NO. 3 and SEQ ID NO.

4.

2. A kit containing the InDel molecular marker as described in claim 1 or the InDel molecular marker primer pair as described in claim 1.

3. The application of an InDel molecular marker primer pair as described in claim 1, or an InDel molecular marker as described in claim 1, or a kit as described in claim 2, comprising: (1) Application in identifying the position of the first female flower node in wax gourd; (2) Application of molecular marker-assisted breeding in the high and low node position of the first female flower of wax gourd.

4. A method for identifying the position of the first female flower node in a wax gourd, characterized in that, Includes the following steps: (1) Using the DNA of the wax gourd material to be tested as a template, PCR amplification was performed using InDel molecular marker primers to obtain SEQ ID NO. 1-2, and PCR products were obtained; the InDel molecular marker was amplified using wax gourd genomic DNA as a template and InDel molecular marker primers; the nucleotide sequences amplified by InDel molecular marker primers are shown in SEQ ID NO. 3 and SEQ ID NO.

4. (2) Perform gel electrophoresis on the amplification products and observe the electrophoresis results.

5. The method according to claim 4, characterized in that, Step (1) PCR reaction system: In a 12μl reaction system, add 2 μL of DNA template solution, 5μL of 2×Taq Mix, 1μL each of forward and reverse primers, with a concentration of 10uM / L, and add 3 μL of ddH2O to bring the total volume to 12μL. PCR amplification reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min. Step (2) The gel is an 8% non-denaturing polyacrylamide gel.

6. The method according to claim 4, characterized in that, The method for judging the electrophoresis detection results in step (2) is as follows: The InDel molecular marker primers amplified a 115bp fragment, indicating that the tested wax gourd sample was a low-node variety with the first female flower. The InDel molecular marker primers amplified a 106bp fragment, indicating that the tested wax gourd sample was a high-node variety with the first female flower. The InDel molecular marker primers simultaneously amplified fragments of 115 bp and 106 bp, indicating that the sample to be tested was heterozygous.