Molecular marker of ascosphaera australis and detection method and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- PEKING UNION MEDICAL COLLEGE HOSPITAL
- Filing Date
- 2026-05-25
- Publication Date
- 2026-06-26
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the STR molecular markers of Trichosporium azadirachtinum and their detection methods and applications. Background Technology
[0002] Assassinia spores ( Trichosporon asahii *Ichthyophthirius multifiliis* (Ichthyophthirius multifiliis) is an important opportunistic pathogenic fungus widely distributed in the natural environment. It can cause invasive infections in immunocompromised patients, especially those with hematologic disorders and those in intensive care units, exhibiting high morbidity and mortality rates. In recent years, with the increase in cases of invasive fungal infections, the role of this fungus in nosocomial transmission and outbreaks has gradually attracted attention. Therefore, establishing high-resolution typing methods is of great significance for its epidemiological research.
[0003] Currently, the main typing method for *Trichoderma assamica* is based on sequence analysis of the ribosomal DNA spacer 1 (IGS1) region. Sugita et al. proposed a typing system based on the IGS1 region in 2002, and this method has been widely used in molecular epidemiological studies of this bacterium. However, existing studies have shown that this method has significant limitations. Its resolution is low, it can only distinguish a limited number of genotypes, and it is difficult to differentiate closely related strains, especially in hospital infection surveillance where it cannot effectively distinguish between sporadic infections and clonal transmission events. Furthermore, this method lacks sufficient polymorphic marker sites, making it difficult to meet the needs of refined epidemiological analysis.
[0004] Among other clinically important fungi, such as Candida albicans ( Candida albicans ) and Candida auris ( Candida auris Microsatellite-based (Short Tandem Repeat, STR) typing methods have been proven to have higher resolution and better epidemiological application value. de Valk et al. established an STR typing system for Candida albicans in 2005, significantly improving strain differentiation; de Groot et al. established a microsatellite typing method for Candida auris in 2020, which can be used for tracking globally prevalent strains. Therefore, it is necessary to develop STR molecular markers for Trichosporium asahi. Summary of the Invention
[0005] The first aspect of the present invention is to provide a molecular marker for Trichosporium assassini.
[0006] A second aspect of the present invention is to provide a reagent.
[0007] A third aspect of the present invention is to provide a reagent kit.
[0008] The fourth aspect of this invention aims to provide a method for detecting the STR molecular marker of Trichosporium assamica, which is the subject of the first aspect of this invention.
[0009] The fifth aspect of this invention aims to provide a method for typing Assassiniosis trichosporum.
[0010] The sixth aspect of this invention aims to provide an Assassiniosis typing system.
[0011] The seventh aspect of this invention aims to provide the application of the *Trichoderma assahi* STR molecular marker of the first aspect of this invention, the reagent of the second aspect, the kit of the third aspect, the method for detecting the *Trichoderma assahi* STR molecular marker of the first aspect of this invention, the *Trichoderma assahi* typing method of the fifth aspect, and the *Trichoderma assahi* typing system of the sixth aspect.
[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a molecular marker for *Trichosporium azadirachtinum* STR, comprising: a molecular marker at site P29, a molecular marker at site P42, a molecular marker at site P61, a molecular marker at site P71, a molecular marker at site P78, and / or a molecular marker at site P84. The P29 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:1; the P42 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:2; the P61 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:3; the P71 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:4; the P78 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:5; and the P84 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:6.
[0013] In some embodiments, the P29 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:7; the P42 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:8; the P61 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:9; the P71 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:10; the P78 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:11; and / or, the P84 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:12.
[0014] In some embodiments, the Asahi Trichosporium STR molecular markers include: a molecular marker at site P29, a molecular marker at site P42, a molecular marker at site P61, a molecular marker at site P71, a molecular marker at site P78, and a molecular marker at site P84.
[0015] A second aspect of the present invention provides a reagent comprising: the Asahi Trichosporium STR molecular marker of the first aspect of the present invention, and / or a substance for detecting the Asahi Trichosporium STR molecular marker of the first aspect of the present invention.
[0016] In some embodiments, the reagent comprises: the Asahi Trichosporium STR molecular marker of the first aspect of the present invention, and optionally a substance for detecting the Asahi Trichosporium STR molecular marker of the first aspect of the present invention.
[0017] In some embodiments, the reagent comprises: a substance for detecting the Asahi Trichosporium STR molecular marker of the first aspect of the present invention, and optionally the Asahi Trichosporium STR molecular marker of the first aspect of the present invention.
[0018] In some embodiments, the substance used to detect the Asahi Trichosporium STR molecular marker of the first aspect of the present invention includes substances selected from one or more detection techniques or methods chosen from the group consisting of: Northern blotting, PCR, and nucleic acid sequencing.
[0019] In some embodiments, the substance used to detect the Asahi Trichosporium STR molecular marker of the first aspect of the present invention includes primers for amplifying the Asahi Trichosporium STR molecular marker of the first aspect of the present invention.
[0020] In some embodiments, the primers for amplifying the *Assahi* *Trichosporium* STR molecular marker of the first aspect of the present invention include: primers for amplifying the P29 site molecular marker, primers for amplifying the P42 site molecular marker, primers for amplifying the P61 site molecular marker, primers for amplifying the P71 site molecular marker, primers for amplifying the P78 site molecular marker, and / or primers for amplifying the P84 site molecular marker; further including: primers for amplifying the P29 site molecular marker, primers for amplifying the P42 site molecular marker, primers for amplifying the P61 site molecular marker, primers for amplifying the P71 site molecular marker, primers for amplifying the P78 site molecular marker, and primers for amplifying the P84 site molecular marker.
[0021] In some embodiments, the primers for amplifying the P29 site molecular marker include a P29-forward primer and a P29-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:13-14, respectively. The primers for amplifying the molecular marker at the P42 site include a P42-forward primer and a P42-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:15-16, respectively. The primers for amplifying the molecular marker at the P61 site include a P61-forward primer and a P61-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:17-18, respectively. The primers for amplifying the molecular marker at the P71 site include a P71-forward primer and a P71-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:19-20, respectively. The primers for amplifying the P78 site molecular marker include a P78-forward primer and a P78-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:21-22, respectively; and / or The primers for amplifying the molecular marker at the P84 site include a P84-forward primer and a P84-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:23-24.
[0022] In some embodiments, one end (preferably the 5' end) of the P29-forward primer, P42-forward primer, P61-forward primer, P71-forward primer, P78-forward primer, and P84-forward primer is labeled with a fluorescent group.
[0023] In some embodiments, the fluorescent group includes any one of FAM, HEX, ROX, and NED; more specifically, FAM.
[0024] In some embodiments, the reagent is used in any one of (1)-(3): (1) Detection of the STR molecular marker of Trichosporium azadirachtinum in the first aspect of this invention; (2) Typing of Trichosporium azadirachtinum; (3) Molecular origin tracing, hospital infection monitoring, population genetics or phylogenetic analysis of Trichosporium azadirachtinum.
[0025] A third aspect of the present invention provides a reagent kit comprising the reagents of the second aspect of the present invention.
[0026] In some embodiments, the kit also includes PCR amplification reagents.
[0027] In some embodiments, the PCR amplification reagents include DNA polymerase, dNTPs, PCR buffer, and Mg2+. 2+ At least one of them.
[0028] In some embodiments, the kit also includes DNA extraction reagents.
[0029] In some embodiments, the kit is used for any one of (1)-(3): (1) Detection of the STR molecular marker of Trichosporium azadirachtinum in the first aspect of this invention; (2) Typing of Trichosporium azadirachtinum; (3) Molecular origin tracing, hospital infection monitoring, population genetics or phylogenetic analysis of Trichosporium azadirachtinum.
[0030] A fourth aspect of the present invention provides a method for detecting the STR molecular marker of Trichosporium azadirachtinum according to the first aspect of the present invention, comprising the steps of using the reagent of the second aspect of the present invention or the kit of the third aspect of the present invention.
[0031] In some embodiments, the method includes the following steps: Using the genomic DNA of *Trichoderma assamica* as a template, PCR amplification was performed using primers from the second aspect of the present invention for amplifying the *Trichoderma assamica* STR molecular marker of the first aspect of the present invention (preferably using primers from the second aspect of the present invention for amplifying the *Trichoderma assamica* STR molecular marker of the first aspect of the present invention for PCR amplification). Polymorphism detection is performed on target fragments (e.g., fluorescently labeled DNA fragments in PCR amplification products) in PCR amplification products.
[0032] In some embodiments, the genomic DNA of the *Trichosporium assassini* is extracted using a DNA extraction reagent (preferably the DNA extraction reagent of the third aspect of the present invention).
[0033] In some embodiments, the PCR amplification system further includes: PCR amplification reagents (preferably the PCR amplification reagents of the third aspect of the present invention).
[0034] In some implementations, the polymorphism detection is length polymorphism detection.
[0035] In some embodiments, the polymorphism detection is to detect the allele length of the *Trichosporium assassini* STR molecular marker.
[0036] In some implementations, the polymorphism is detected by capillary electrophoresis.
[0037] In some implementations, the method does not involve the diagnosis or treatment of the disease.
[0038] A fifth aspect of the present invention provides a method for typing *Trichosporium assassini*, comprising the steps of the method of the fourth aspect of the present invention.
[0039] In some embodiments, the method further includes the following step: typing based on the results of the polymorphism detection to obtain the typing results of *Trichosporium azadirachtinum*.
[0040] In some embodiments, the genotyping rule is as follows: based on the allele lengths of the *Trichoderma assahi* STR molecular markers (e.g., P29, P42, P61, P71, P78, and P84 molecular markers), they are arranged in a fixed order to form a combination of the lengths of the *Trichoderma assahi* STR molecular markers (e.g., six sites: P29, P42, P61, P71, P78, and P84).
[0041] In some implementations, the method does not involve the diagnosis or treatment of the disease.
[0042] A sixth aspect of the present invention provides an assassiniosis typing system, comprising: The detection module is used to detect the STR molecular marker of *Trichosporium azadirachtinum* according to the first aspect of this invention, and to obtain polymorphic results; and The typing module is used to perform typing based on the results of the polymorphism detection to obtain the typing results of *Trichosporium azadirachtinum*.
[0043] In some embodiments, the classification system further includes an output module that outputs information based on the results obtained by the classification module.
[0044] The seventh aspect of the present invention provides the application of the *Trichoderma assamica* STR molecular marker of the first aspect of the present invention, the reagent of the second aspect, the kit of the third aspect, the method for detecting the *Trichoderma assamica* STR molecular marker of the first aspect of the present invention, the *Trichoderma assamica* typing method of the fifth aspect, or the *Trichoderma assamica* typing system of the sixth aspect in the molecular typing, molecular tracing, hospital infection monitoring, population genetics, or phylogenetic analysis of *Trichoderma assamica*.
[0045] In some implementations, the application does not involve the diagnosis or treatment of diseases.
[0046] The beneficial effects of this invention are: This invention provides STR molecular markers for Trichosporium azadirachtinum, which can be used for molecular typing, molecular tracing, hospital infection monitoring, population genetics or phylogenetic analysis of Trichosporium azadirachtinum.
[0047] Furthermore, this invention provides a multi-site typing method (system) applicable to *Trichosporium axosterum*, which demonstrates significantly superior overall technical performance compared to existing technologies in practical applications. Firstly, regarding typing resolution, the method (system) of this invention, through analysis of 121 clinical isolates, identified 52 different microsatellite types (MT types), achieving an overall discriminant power (DP value) of 0.9523. This indicates that the method (system) has high resolution and can effectively distinguish closely related strains that are difficult to differentiate using traditional IGS1 typing methods, thereby significantly improving the precision of strain typing.
[0048] Secondly, regarding epidemiological analysis capabilities, the typing method (system) provided by this invention can reveal the genetic structure and distribution characteristics of bacterial strains. Minimum spanning tree analysis revealed the existence of multiple dominant MT types, with the most common MT8 type containing 21 clinical strains. These strains originated from different hospitals, departments, patients of different age groups, and different specimen types, with at least three strains detected in both PU and WZ hospitals, suggesting that this method (system) can identify potential nosocomial transmission or regional epidemic clones. Simultaneously, some MT types exhibited a pattern of outward diffusion from a central type, while others showed sporadic distribution, indicating that this method (system) can effectively distinguish between clustered and sporadic infections, providing reliable molecular evidence for hospital infection surveillance.
[0049] Furthermore, in comparison with existing technologies, traditional IGS1 typing of the same batch of strains can only classify them into 6 types, and there are cases where strains from different sources are classified into the same type, indicating its limited resolution capability. In contrast, the method (system) of this invention can achieve higher-level typing resolution within the same dataset and can reflect the phylogenetic relationships between strains, thus significantly outperforming existing methods in terms of typing accuracy and information content.
[0050] Furthermore, at the technical implementation level, this invention can complete genotyping based on PCR amplification and fragment analysis technology, featuring simple operation, good reproducibility, and low detection cost, making it suitable for large-scale testing under routine clinical laboratory conditions. Compared with high-cost methods such as whole-genome sequencing, this invention significantly lowers the technical threshold while maintaining high resolution, demonstrating good practicality and promotional value.
[0051] In summary, this invention not only significantly outperforms existing technologies in terms of typing resolution, but also demonstrates clear advantages in hospital transmission identification, epidemiological analysis, and clinical application feasibility. It can provide strong technical support for the monitoring and control of Asaxacinthiasis infection and has important practical application value. Attached Figure Description
[0052] Figure 1 The diagram shows a representative capillary electrophoresis peak at the P84 site.
[0053] Figure 2 The diagram shows a representative capillary electrophoresis peak at the P29 site.
[0054] Figure 3 The diagram shows a representative capillary electrophoresis peak at the P61 site.
[0055] Figure 4 The diagram shows a representative capillary electrophoresis peak at the P71 site.
[0056] Figure 5 The diagram shows a representative capillary electrophoresis peak at the P78 site.
[0057] Figure 6 The diagram shows a representative capillary electrophoresis peak at the P42 site.
[0058] Figure 7 The results of typing Assassiniosis strains using the 6-site microsatellite typing system established based on the present invention are shown: The figure lists the number of strains, source information, and allele length combinations of each microsatellite locus (P61, P71, P78, P84, P29, and P42) corresponding to different microsatellite types (MT types). Each MT type is uniquely determined by the allele combination of the 6 loci. Detailed Implementation
[0059] The present invention will be further described in detail below through specific embodiments.
[0060] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0061] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.
[0062] Example 1: Transcriptome Sequence Acquisition and Microsatellite Locus Screening of *Trichosporium asahi* This embodiment illustrates the process of obtaining microsatellite loci for Assassiniosis and screening candidate loci.
[0063] Transcriptome sequencing was performed on a representative strain of *Trichosporium asalpinx*, CBS 2479. First, total RNA was extracted from the strain using the RNAprepPure Polysaccharide-Polyphenol Plant Total RNA Extraction Kit (TIAGEN, DP441). The specific method was as follows: After collecting the bacterial cells, lysis buffer was added and thoroughly mixed to achieve cell lysis. β-mercaptoethanol was added during lysis to inhibit RNA degradation. After lysis, the cells were centrifuged at 12000 rpm for approximately 2 min, and the supernatant was collected. The supernatant was transferred to a filter for impurity removal, and centrifuged at 12000 rpm for approximately 2 min, and the filtrate was collected. An appropriate amount of anhydrous ethanol (specifically 0.4 times the volume of the supernatant) was added to the filtrate, mixed, and transferred to an adsorption column to adsorb RNA onto a silica membrane. The column was then centrifuged, and the eluent was discarded. The column was washed with protein-removing buffer, centrifuged, and the eluent was discarded. DNase I working solution was then prepared and added to the center of the adsorption column membrane. The column was incubated at room temperature for approximately 15 min to remove residual genomic DNA. After DNase treatment, the column was washed again with protein-free buffer, and then washed twice more with ethanol-containing wash buffer to remove residual impurities. After washing, residual liquid was removed by high-speed centrifugation. The column was then transferred to a new RNase-free centrifuge tube, and 50 μL of RNase-free water was added to the center of the membrane. After incubation at room temperature for approximately 2 min, the tube was centrifuged, and the eluent was collected to obtain purified total RNA. After extraction, RNA concentration and purity were detected using a spectrophotometer (OD260 / OD280: 1.8–2.1); RNA integrity was also detected using agarose gel electrophoresis.
[0064] After obtaining total RNA, mRNA was enriched using Oligo dT magnetic beads. The enriched mRNA was fragmented, and first-strand cDNA was synthesized using random hexamer primers, followed by second-strand cDNA synthesis. After end repair, A-tailing, adapter ligation, fragment selection, PCR amplification, and purification, a cDNA library was constructed. The constructed library concentration was quantified using a Qubit analyzer, and the effective concentration of the library was detected by real-time quantitative PCR. Simultaneously, a bioanalyzer was used to detect the fragment length distribution of the library to ensure that the library quality met sequencing requirements. After passing quality control, different libraries were mixed according to the effective concentration and target data volume requirements, and sequencing was performed using the Illumina high-throughput sequencing platform. Sequencing was performed in a sequencing-as-synthesis mode, acquiring sequencing sequence information through fluorescence signal acquisition. After obtaining the raw sequencing data, data quality control was performed using FASTP software, including removing adapter sequences, reads containing more than 10% N, and reads containing more than 50% low-quality bases (Q≤5), thereby obtaining high-quality clean reads. Simultaneously, Q20, Q30, and GC content were calculated for clean reads to assess data quality. Based on the high-quality clean reads, de novo assembly was performed using Trinity software to obtain the Assassination of Trichosporium transcriptome assembly sequence.
[0065] After obtaining the transcriptome assembly sequence, simple sequence repeat (SSR) sites were searched using MISA software. Dinucleotide repeats were the primary target for screening, with a dinucleotide repeat count ≥8 set as the candidate site screening threshold. Detected SSR sites were further screened based on factors such as repeat motif type, repeat count, flanking sequence integrity, sequence continuity, and expected amplified fragment length. Sites with clear flanking sequences, well-defined repeat unit boundaries, and expected amplified fragment lengths within the range of 100–300 bp were retained. Through this screening, a total of 93 candidate microsatellite sites were obtained for subsequent primer design and genotyping system construction.
[0066] Example 2: Candidate Primer Design and Initial Screening Primers were designed using Primer3 software for the 93 candidate microsatellite loci obtained in Example 1. The primer design parameters were: primer length 18–25 bp, annealing temperature (Tm) 55–65 °C, GC content 40%–60%, and expected amplified product length 100–300 bp. Primer pairs with a target amplification fragment greater than 110 bp and no obvious dimerization, hairpin structures, or non-specific binding risk in the upstream and downstream primers were retained.
[0067] After primer design, six representative *Trichosporium azadirachtinum* strains were selected as initial screening samples for amplification and verification of the candidate primers. These strains were sourced from Peking Union Medical College Hospital. Following PCR amplification, 1.5% agarose gel electrophoresis was used to check for the presence of a single, clear band in the amplification products. For primers producing clear amplification bands, 6% PAGE gel analysis was further performed to analyze for fragment differences between samples. If the same primer showed fragment length differences among different initial screening strains, the corresponding site of the primer was considered to have preliminary polymorphism and was retained for further fluorescent PCR screening. After initial screening, a total of 17 pairs of candidate primers were obtained, exhibiting stable amplification, clear bands, and a certain degree of polymorphism.
[0068] Based on 17 candidate primer pairs, their amplification and genotyping effects in expanded samples were further evaluated. Evaluation indicators included allele count (Na), polymorphism information content (PIC), discriminatory power (DP), and genetic diversity. After comprehensive evaluation, six core primer pairs were finally selected, corresponding to loci P29, P42, P61, P71, P78, and P84. The repeat motifs for these six loci are (AG)8, namely AGAGAGAGAGAGAGAG (SEQ ID NO:1), (CA), and AG84. 11 , namely CACACACACACACACACACACA (SEQ ID NO: 2), (AG) 13 , namely AGAGAGAGAGAGAGAGAGAGAGAG (SEQ ID NO: 3), (GT) 12 , namely GTGTGTGTGTGTGTGTGTGTGT (SEQ ID NO:4), (GA) 16 , namely GAGAGAGAGAGAGAGAGAGAGAGAGAGA (SEQ ID NO: 5) and (CT) 13That is, CTCTCTCTCTCTCTCTCTCTCTCTCTCT (SEQ ID NO:6), and its corresponding molecular marker is as follows: Molecular marker at P29 site: ACCTTAGCACCTTAGCGTCGCACAGGAGGACAACGAGCCACAAGAGAGAGAGAGAGAGAATGAATGAATGCGCCGAATGCGACGCCAAGCACAGGCCCACGGCCCATATCGGCGCACCCAAAGCCCTGACCACTCGGCTCCTAGCCTAGCCCCCAGCCCATACCGCACTCAGCCGCGAGATGCACACGACAACTTCCGCAACAAGCCGTATCGCTCGTTCGCAAGAGACATGCAGTTACACGCTCCAAGGGCTA (SEQ ID NO:6) NO:7), P42 site molecular marker: AGCAAGCTCAAGGAGAGCACGGTGCTCCTCGGCTCGCGCGGCGGAGCGGCCATCAACCTGCCCATCATTGGCAACATTCGCGCGCCCGACTTTGTCGTCGACCGGAAATCCCGCGACTTCC TTGCGGACAAGATCTTCTTCTCCCGCTTCCGCCAGCTCGGGTACACCGACAGCACTGTCAATCTCTAAAACCACACACACACACACACACAATCATTTGTTCAAACAACCACCACAATCGTTCCCGATCTCCTA(SEQ ID NO: 8), P61 site molecular marker: TCCGGGATATATTCTGCTGCTGAAGTGTAGAATGCATGGCGTACAACACAGTATGGAGCAGAATTACTCCCGATGCAGAGAGAGAGAGAGAGAGAGAGATACAAACACGGCAAGCAAGACGAGAAAGGCTGGTC (SEQ ID NO: 9), P71 site molecular marker: GAAGCGAAAAGCATAAACGCGTGAAGAGGTAGTGCGTGTGTGTGTGTGTGTGTGTGTCGACGAGACCATGTGTCTTTGTGTTGTTCCAGTGACGGTGTTCCT (SEQ ID NO: 10),P78 site molecular marker: TCCAGTCGTTAATGGAAGCCGAGCGAGCGAGCGTTGTTGGGGGTGAGGGCGGGAACAGCTGAGTCGGGCGGTGGGGAGGGCCGAGGGTCGAGCTGGGGAGAGAGAGAGAGAGAGAGAGAGAGGATGTCGACGAGGACGGGACAAGTGAGACGGAGGAAGGAGTATGATACGGAGGAGAAGTCAAAGACG (SEQ ID NO:11), P84 site molecular marker: GCTACGAAGTCTACGCCAGGTTGGCCTAGGGAACACACCCACTCGCTGACGGCTACGTTGACGCAAAGATGCATGGGGTCTTGTCGCACCGTTACGCCGGCGTTCGCGGCCCATACGAGCACCTTGCTC ...
[0069] Table 1
[0070] Note: The 5' end of the forward primer (F) is fluorescently labeled with FAM fluorescent dye.
[0071] Example 3: Genomic DNA extraction from *Trichosporium azadirachtinum* This embodiment illustrates the method for extracting template DNA used in PCR amplification in this invention. *Trichoderma assahi* was inoculated onto Sabouraud dextrose agar (SDA) plates and cultured at 35°C for 48–72 h. After fresh single colonies formed, the cells were picked for genomic DNA extraction. Genomic DNA was extracted using a nucleic acid extraction method based on magnetic bead adsorption (specifically, a magnetic bead-based plant genomic DNA extraction kit (TIAGEN, DP342) was used). The specific steps are as follows: First, an appropriate amount of bacterial cells (approximately 10 mg) was transferred to a 1.5 mL centrifuge tube, lysis buffer and RNase were added, and the mixture was thoroughly mixed. The tube was then incubated at 65°C for approximately 10 min to allow for complete cell lysis and release of nucleic acids. After lysis, the tube was centrifuged at 12,000 rpm for approximately 5 min, and the supernatant was collected. Binding buffer and isopropanol were added to the supernatant, and the mixture was thoroughly mixed. Then, magnetic bead suspension was added, and the tube was gently inverted to mix, ensuring that the DNA was fully bound to the magnetic beads. The tube was incubated at room temperature for approximately 5 min. Subsequently, the centrifuge tube was placed on a magnetic rack and allowed to stand for approximately 1 minute. After the magnetic beads have completely adsorbed, carefully discard the supernatant. Add protein-removing buffer to the magnetic beads, mix gently, and place them back on the magnetic rack to separate the beads, discarding the supernatant again. Add washing buffer (containing ethanol) to the magnetic beads, mix gently, and place them back on the magnetic rack to separate, discarding the supernatant. Repeat the washing step twice to thoroughly remove impurities. After washing, place the magnetic beads at room temperature to dry for about 5 minutes to remove residual ethanol. Then add 50 μL of elution buffer, mix well, and incubate at 65°C for about 5 minutes to elute the DNA from the magnetic beads. Place the centrifuge tube back on the magnetic rack and let it stand until the magnetic beads are completely adsorbed. Transfer the supernatant to a new centrifuge tube to obtain purified genomic DNA. After extraction, the DNA concentration and purity can be detected using a spectrophotometer (A260 / A280: 1.7–1.9); DNA integrity can also be detected using 1% agarose gel electrophoresis. Finally, store the DNA sample at -20°C for later use.
[0072] Example 4: Fluorescent PCR Amplification System and Temperature Program This embodiment illustrates the fluorescent PCR amplification method for six STR sites of Trichosporium assassini in this invention.
[0073] Using the genomic DNA extracted in Example 3 as a template, each microsatellite locus was amplified using the core primers determined in Example 2. The PCR reaction system was 25 μL, specifically including: 17.5 μL of 2×Taq PCR premixed reagent, 1.0 μL of 10 μmol / L forward primer, 1.0 μL of 10 μmol / L reverse primer, 1.0 μL of genomic DNA template, and 4.5 μL of ddH2O.
[0074] The PCR amplification program employed a two-stage annealing mode. First, pre-denaturation was performed at 94℃ for 5 min; followed by 10 cycles, each consisting of 94℃ denaturation for 30 s, 63℃ annealing for 40 s, and 72℃ extension for 50 s; then 27 cycles, each consisting of 94℃ denaturation for 30 s, 58℃ annealing for 40 s, and 72℃ extension for 50 s; finally, a final extension at 72℃ for 5 min was performed. After amplification, a small amount of the PCR product was first subjected to 1.5% agarose gel electrophoresis to check for successful amplification, and then used for capillary electrophoresis analysis after successful amplification.
[0075] Example 5: Capillary electrophoresis detection and fragment length interpretation This embodiment illustrates the capillary electrophoresis detection method and fragment length analysis method for PCR amplification products in this invention.
[0076] PCR amplification products were detected by capillary electrophoresis using an ABI 3730XL. The loading system consisted of 0.5 μL of molecular weight internal standard, 9.5 μL of Hi-Di formamide, and 1.0 μL of PCR product. After mixing the above components, the mixture was denatured at 95°C for 5 min, immediately cooled in an ice bath, and then placed in a sample plate for analysis. Capillary electrophoresis separation was performed using an ABI 3730XL sequencer.
[0077] After electrophoresis, GeneMarker software was used to read the peak diagram and determine the fragment length at each site. Specifically, the molecular weight internal standard peak in each lane was used as a reference; the fragment length was automatically read by comparing the position of the internal standard peak with the sample peak position. For sites with clear peak shape, a prominent main peak, and a peak height reaching the interpretation threshold, the allele length was recorded. For samples with two peaks, the lengths of both fragments were recorded. For samples with tailed peaks, shoulder peaks, or mixed peaks, manual verification was performed based on repeated testing results. Finally, allele length information for each strain at six sites—P61, P71, P78, P84, P29, and P42—was obtained.
[0078] Figure 1-6 The figures show representative capillary electrophoresis peaks for the six loci mentioned above. The horizontal axis represents fragment length (bp), the vertical axis represents fluorescence signal intensity, and the peak position represents the length of the corresponding allele. The fragment analysis directly yields the length polymorphism results for each microsatellite locus in *Trichoderma assassini*.
[0079] Example 6: Definition and Classification Rules of Microsatellite Type (MT Type) This embodiment is used to illustrate the definition of microsatellite types of *Assahi* in this invention.
[0080] Based on the fragment length results obtained in Example 5, the allele lengths of each strain at six loci (P61, P71, P78, P84, P29, and P42) were arranged in a fixed order to form a six-locus length combination. Each unique six-locus length combination was defined as a microsatellite type (MT type). If the length results of any strain differed from those of another strain at any locus, they were determined to be different MT types.
[0081] For example, when a strain has fragment length combinations of 137 / 137, 99 / 99, 193 / 193, 262 / 262, 256 / 256, and 260 / 260 at sites P61, P71, P78, P84, P29, and P42, respectively, it can be defined as an independent MT type. If another strain has the same fragment length combination as the previous strain, but differs only in that its P42 site is 258 / 260, it should be classified as another independent MT type. Using these rules to uniformly name and number all strains can form a complete microsatellite typing system for *Trichosporium asaxiense*.
[0082] Example 7: Typing Results and Polymorphism Parameter Analysis This embodiment is used to illustrate the resolution capability of the classification system established in this invention and the evaluation results of the polymorphism at each point.
[0083] DNA extraction, fluorescent PCR amplification of 6 STR loci, allele length information acquisition, and genotyping analysis were performed on 121 clinically isolated *Trichoderma assamica* strains using the methods described in Examples 3-6. A total of 52 different microsatellite types (MT types) were identified. The number of alleles at each locus ranged from 5 to 8, and the PIC values ranged from 0.457 to 0.654, indicating that all 6 loci exhibited high polymorphism.
[0084] Further statistical analysis of the genotyping results was performed using genetic diversity analysis software. Data format conversion was performed using Convert software, and then genetic diversity parameters for each locus were calculated using R Studio software, including allele count (Na), effective allele count (Ne), observed heterozygosity (Ho), expected heterozygosity (He), polymorphism information content (PIC), and Shannon information index (I). The discriminative power of the overall genotyping system was calculated using Simpson's diversity index. The results showed that the overall DP value of the 6-locus microsatellite genotyping system of this invention was 0.9523, indicating high resolution.
[0085] Figure 7The 52 MT types obtained in this invention, along with their corresponding strain numbers, source information, and allele length combinations at six loci, are listed. The results show that a total of 121 strains were classified into 52 types, indicating that the 6-locus typing system established in this invention (corresponding to P29, P42, P61, P71, P78, and P84 loci, respectively) can efficiently distinguish clinical isolates of *Trichosporium axolotliferum*, demonstrating high typing resolution.
[0086] Example 8: Analysis of Group Relationships and Propagation Patterns This embodiment illustrates the application of the present invention in the molecular epidemiological analysis of Trichosporium assassini.
[0087] Based on the six-site typing results obtained in Example 7, the microsatellite types and source hospital information of different strains were input into BioNumerics 7.6 software to construct a minimum spanning tree (MST) for analyzing the genetic relationships and potential transmission patterns among strains. The results showed that some MT types were dominant, including MT4, MT8, MT25, MT28, and MT48. Among them, MT8 was the most common type, containing 21 clinical isolates from different departments, patients of different ages, and different specimen types. At least three strains were detected in both PU and WZ hospitals, suggesting that this type may have cross-hospital distribution and regional prevalence trends. Meanwhile, some types showed a central-to-outward diffusion relationship, while other types were only found in single or small numbers of strains, exhibiting a sporadic distribution. By combining the typing results with the strain source information, the distribution differences and potential transmission relationships of different MT types in different hospitals could be observed. These results demonstrate that the present invention can identify potential nosocomial transmission or regional epidemic clones and is suitable for hospital infection surveillance and molecular epidemiological studies. The 6-site microsatellite typing system constructed in this invention can not only achieve high-resolution typing, but also be used to identify the transmission patterns and epidemiological characteristics of strains, which has important application value in hospital infection monitoring and molecular epidemiology research.
[0088] Comparative Example 1: IGS1 Classification Method This comparative example is used to illustrate the resolving power of the existing traditional IGS1 classification method.
[0089] 121 *Trichosporon assamica* strains, identical to those in Example 7, were selected and analyzed using the IGS1 typing method. Genomic DNA was first extracted from each strain using the same method as in Example 3, and PCR amplification was performed using IGS1 region-specific primers (Sugita T, Nakajima M, Ikeda R, Matsushima T, Shinoda T. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of *Trichosporon* species. J ClinMicrobiol. 2002 May;40(5):1826-30. doi: 10.1128 / JCM.40.5.1826-1830.2002.PMID: 11980969; PMCID: PMC130926.). The amplified products were purified and then subjected to Sanger sequencing. The obtained sequences were compared with reference databases or reported type sequences, and the strains were typed according to the IGS1 sequence type.
[0090] The results showed that the traditional IGS1 typing method only classified 121 strains into 6 types, and there were cases where strains from different hospitals, different regions and different specimen types were classified into the same type. It was impossible to further distinguish closely related strains and it was difficult to clearly indicate potential transmission relationships.
[0091] The 6-site microsatellite typing system of this invention was compared with the traditional IGS1 typing method. The results showed that the method of this invention could classify 121 strains of *Trichoderma assamica* into 52 different microsatellite types, with an overall discrimination power (DP) of 0.9523; while the IGS1 typing method could only classify them into 6 types, showing significantly lower discrimination power. In terms of application effectiveness, the microsatellite typing system established by this invention can not only effectively distinguish between sporadic and clustered infections, but also reflect the phylogenetic relationships between strains and identify the dominant type and its diffusion pattern across hospitals. In contrast, the IGS1 typing method has limited information and cannot meet the needs of *Trichoderma assamica* hospital infection monitoring, molecular tracing, and fine epidemiological studies. Therefore, this invention has significant technical advantages and application value in *Trichoderma assamica* molecular typing, hospital infection monitoring, molecular tracing, population genetics, and phylogenetic analysis.
[0092] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.
Claims
1. STR molecular markers for *Trichosporium azadirachtinum*, including: Molecular markers at sites P29, P42, P61, P71, P78, and / or P84; The P29 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:1; the P42 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:2; the P61 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:3; the P71 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:4; the P78 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:5; and the P84 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:
6.
2. The *Trichosporium asalpanicola* STR molecular marker according to claim 1, characterized in that, The P29 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:7; the P42 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:8; the P61 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:9; the P71 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:10; the P78 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:11; and / or, the P84 site molecular marker includes the nucleotide sequence shown in SEQ ID NO:12; Preferably, the Asahi Trichosporium STR molecular markers include: a molecular marker at site P29, a molecular marker at site P42, a molecular marker at site P61, a molecular marker at site P71, a molecular marker at site P78, and a molecular marker at site P84.
3. A reagent comprising: The Asahi Trichosporium STR molecular marker as described in any one of claims 1-2, and / or the substance for detecting the Asahi Trichosporium STR molecular marker as described in any one of claims 1-2.
4. The reagent according to claim 3, characterized in that, The substance used to detect the Asahi Trichosporium STR molecular marker according to any one of claims 1-2 includes substances selected from one or more detection techniques or methods chosen from the group consisting of: Northern blotting, PCR, and nucleic acid sequencing. Preferably, the substance for detecting the Asahi Trichosporium STR molecular marker according to any one of claims 1-2 includes primers for amplifying the Asahi Trichosporium STR molecular marker according to any one of claims 1-2; Preferably, the primers for amplifying the *Trichosporium asalpinx* STR molecular marker according to any one of claims 1-2 include: primers for amplifying the P29 molecular marker, primers for amplifying the P42 molecular marker, primers for amplifying the P61 molecular marker, primers for amplifying the P71 molecular marker, primers for amplifying the P78 molecular marker, and / or primers for amplifying the P84 molecular marker; further comprising: primers for amplifying the P29 molecular marker, primers for amplifying the P42 molecular marker, primers for amplifying the P61 molecular marker, primers for amplifying the P71 molecular marker, primers for amplifying the P78 molecular marker, and primers for amplifying the P84 molecular marker; Preferably, the primers for amplifying the molecular marker at the P29 site include a P29-forward primer and a P29-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:13-14, respectively. The primers for amplifying the molecular marker at the P42 site include a P42-forward primer and a P42-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:15-16, respectively. The primers for amplifying the molecular marker at the P61 site include a P61-forward primer and a P61-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:17-18, respectively. The primers for amplifying the molecular marker at the P71 site include a P71-forward primer and a P71-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:19-20, respectively. The primers for amplifying the P78 site molecular marker include a P78-forward primer and a P78-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:21-22, respectively; and / or The primers for amplifying the molecular marker at the P84 site include a P84-forward primer and a P84-reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:23-24. Preferably, one end of the P29-forward primer, P42-forward primer, P61-forward primer, P71-forward primer, P78-forward primer, and P84-forward primer is labeled with a fluorescent group; Preferably, the fluorescent group includes any one of FAM, HEX, ROX and NED; more preferably, it is FAM.
5. A kit comprising the reagents according to any one of claims 3-4.
6. The reagent kit according to claim 5, characterized in that, The kit also includes PCR amplification reagents; Preferably, the PCR amplification reagents include DNA polymerase, dNTPs, PCR buffer, and Mg2+. 2+ At least one of them; Preferably, the kit further includes a DNA extraction reagent.
7. A method for detecting the STR molecular marker of Trichosporium axosterum according to any one of claims 1-2, comprising the steps of using the reagent according to any one of claims 3-4 or the kit according to any one of claims 5-6; Preferably, the method includes the following steps: Using the genomic DNA of *Trichoderma assassini* as a template, PCR amplification was performed using the primers described in any one of claims 3-4 for amplifying the *Trichoderma assassini* STR molecular markers described in any one of claims 1-2. Polymorphism detection was performed on the target fragment in the PCR amplification product; Preferably, the polymorphism detection is length polymorphism detection.
8. A method for typing *Trichosporium azadirachtinum*, comprising the steps of the method of claim 7; Preferably, the method further includes the following step: performing typing based on the polymorphism detection results to obtain the typing results of *Trichosporium azadirachtinum*.
9. An assassinidia typing system, comprising: A detection module is used to detect the STR molecular marker of Trichosporium azadirachtinum as described in any one of claims 1-2, and obtain polymorphic results; and The typing module is used to perform typing based on the results of the polymorphism detection to obtain the typing results of *Trichosporium azadirachtinum*. Preferably, the classification system further includes an output module, which outputs information based on the results obtained by the classification module.
10. The application of the *Trichoderma assamica* STR molecular marker according to any one of claims 1-2, the reagent according to any one of claims 3-4, the kit according to any one of claims 5-6, the method for detecting the *Trichoderma assamica* STR molecular marker according to claim 7, the *Trichoderma assamica* typing method according to claim 8, or the *Trichoderma assamica* typing system according to claim 9 in molecular typing, molecular tracing, hospital infection monitoring, population genetics, or phylogenetic analysis of *Trichoderma assamica*.