Preparation method of copper-silver bimetallic nanocluster assembly and application thereof

CN122299002APending Publication Date: 2026-06-30SOUTHEAST UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTHEAST UNIV
Filing Date
2024-12-30
Publication Date
2026-06-30

Smart Images

  • Figure CN122299002A_ABST
    Figure CN122299002A_ABST
Patent Text Reader

Abstract

This invention discloses a method for preparing copper-silver bimetallic nanocluster assemblies and their applications. The preparation includes the following steps: dissolving copper and silver salts in water to form a mixed metal salt aqueous solution; dissolving 4,6-dimethylmercaptopyrimidine in water to form a 4,6-dimethylmercaptopyrimidine aqueous solution; adding the 4,6-dimethylmercaptopyrimidine aqueous solution to the mixed metal salt aqueous solution; centrifuging the mixed solution, discarding the supernatant, and washing the precipitate to obtain the copper-silver bimetallic nanocluster assemblies. This invention provides a method for preparing copper-silver bimetallic nanocluster assemblies, which has the advantages of simple preparation process and large-scale preparation. The prepared copper-silver bimetallic nanocluster assemblies are a novel nanomaterial that can be applied in fluorescence (imaging) sensing, electrochemiluminescence (imaging) sensing, catalysis, light-emitting diodes, photoelectric conversion materials, and biomedicine, especially in the detection of human epidermal growth factor receptor 2 and Ag. + middle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of novel nanomaterial preparation technology, specifically relating to a method for preparing copper-silver bimetallic nanocluster assemblies and their applications. Background Technology

[0002] Metal nanoclusters are a class of core-shell structured, ultrasmall metal nanoparticles with a size less than 2 nm. Their core typically consists of several to hundreds of metal atoms, possessing unique molecular-like electronic structures and distinctive optical and electrochemical properties. They also exhibit low toxicity and good biocompatibility, thus attracting widespread attention in fields such as luminescence, catalysis, sensing, and biomedicine. The performance of metal nanoclusters is often closely related to their particle size and aggregate structure. Compared to monodisperse nanoclusters, assembled metal nanoclusters possess superior optical properties and good stability, making them suitable for applications such as electrochemiluminescence and sensor devices. However, the high synthesis cost of noble metal nanoclusters hinders large-scale production, significantly limiting their applications. Therefore, the development of low-cost alternatives is necessary. Copper nanoclusters are relatively inexpensive and abundant, making them a promising nanocluster material.

[0003] Heteroatom doping can effectively modulate the electronic and geometric structures of doped nanoclusters by introducing synergistic effects, thereby enhancing their optical, electrical, magnetic, and structural properties. This correlation provides an opportunity to understand structure-function relationships. Silver and copper are in the same group, possessing similar electron configurations and physicochemical properties, making them ideal heteroatom dopants. However, there are few methods for synthesizing silver-doped copper nanoclusters, especially silver-doped copper nanocluster assemblies, and the synthesis conditions are demanding, posing challenges to the large-scale production of doped copper nanocluster assemblies.

[0004] Chinese Patent 2024112516467 discloses a novel method for preparing copper nanoclusters, specifically a method for preparing self-assembled copper nanoclusters. This method addresses the limited availability of existing methods for synthesizing copper nanoclusters, particularly self-assembled ones, and offers advantages such as a simple preparation process and the ability to produce large quantities. However, the synthesis of self-assembled copper nanoclusters in this patent requires a two-step process and utilizes an organic solvent. Furthermore, the fluorescence quantum efficiency and electrochemiluminescence efficiency of the prepared materials require further improvement. Additionally, existing copper-silver bimetallic nanoclusters are not assemblies. Summary of the Invention

[0005] Purpose of the invention: To address the problems existing in the prior art, this invention proposes a novel method for preparing copper-silver bimetallic nanoclusters, and specifically a method for preparing cluster assemblies. This method solves the problem of the limited number of existing methods for synthesizing copper-silver bimetallic nanoclusters or copper-silver bimetallic nanocluster assemblies, and has the advantages of simple preparation process and large-scale preparation capability.

[0006] The present invention also provides a copper-silver bimetallic nanocluster and its application. The copper-silver bimetallic nanocluster prepared by the present invention is a novel nanomaterial. Due to the existence of the bimetallic synergistic effect, the structure of the material is significantly changed and the performance of the material is effectively improved.

[0007] Technical Solution: To achieve the above objectives, the present invention provides a method for preparing copper-silver bimetallic nanoclusters, comprising the following steps:

[0008] (1) Dissolve copper salt and silver salt in water separately to form a mixed metal salt aqueous solution; or dissolve copper salt and silver salt in water separately and then mix them to form a mixed metal salt aqueous solution;

[0009] (2) Dissolve 4,6-dimethylmercaptopyrimidine in water to form an aqueous solution of 4,6-dimethylmercaptopyrimidine;

[0010] (3) Add the aqueous solution of 4,6-dimethylmercaptopyrimidine to the aqueous solution of the mixed metal salt and stir to obtain a mixed solution;

[0011] (4) Centrifuge the mixed solution, discard the supernatant, wash the precipitate, and obtain the copper-silver bimetallic nanocluster assembly;

[0012] In step (1), the copper salt is copper nitrate, copper sulfate, copper chloride or copper carbonate, and the silver salt is silver nitrate, silver fluoride, silver chlorate, silver perchlorate or silver sulfate.

[0013] Preferably, the copper salt in step (1) is copper nitrate trihydrate and the silver salt is silver nitrate.

[0014] In step (1), 3 to 10 mg of copper salt powder and 0.05 to 2 mg of silver salt powder are mixed with 3 mL of water to form a mixed metal salt aqueous solution.

[0015] Preferably, 7.2 mg of copper nitrate trihydrate powder, 0.36 mg of silver nitrate powder, and 3 mL of water are mixed to form a mixed metal salt aqueous solution for later use.

[0016] In step (2), 1 to 15 mg of 4,6-dimethylmercaptopyrimidine powder is mixed with 6 mL of water to form an aqueous solution of 4,6-dimethylmercaptopyrimidine.

[0017] Preferably, 7 mg of 4,6-dimethylmercaptopyrimidine powder is mixed with 6 mL of water to form an aqueous solution of 4,6-dimethylmercaptopyrimidine.

[0018] In step (3), the aqueous solution of 4,6-dimethylmercaptopyrimidine is added to the aqueous solution of mixed metal salts at a constant speed under magnetic stirring, and the magnetic stirring is continued for 40 to 120 minutes to obtain a mixed solution. The mass ratio of copper salt, silver salt and 4,6-dimethylmercaptopyrimidine is 3 to 10: 0.05 to 2: 1 to 15.

[0019] Preferably, an aqueous solution of 4,6-dimethylmercaptopyrimidine is added to the aqueous solution of the mixed metal salt under magnetic stirring at a uniform rate, and the mixture is stirred magnetically for 90 minutes to obtain a mixed solution.

[0020] Preferably, the mass ratio of the copper salt, silver salt, and 4,6-dimethylmercaptopyrimidine is 7.2:0.36:7.

[0021] In step (6), the mixed solution is centrifuged at 6000–12000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed to obtain copper-silver bimetallic nanocluster assemblies (CuAgNCs). Assy ) suspension.

[0022] Preferably, the mixed solution is centrifuged at 11,000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed with water to obtain copper-silver bimetallic nanocluster assemblies (CuAgNCs). Assy ) suspension.

[0023] The copper-silver bimetallic nanocluster assembly prepared by the method of the present invention.

[0024] The copper-silver bimetallic nanocluster assemblies prepared by the method described in this invention have applications in fluorescence (imaging) sensing, electrochemiluminescence (imaging) sensing, catalysis, light-emitting diodes, photoelectric conversion materials, and biomedicine.

[0025] Preferably, the copper-silver bimetallic nanocluster assembly is used in the preparation of an electrochemiluminescence sensor for detecting human epidermal growth factor receptor 2 (HER2).

[0026] Preferably, the copper-silver bimetallic nanocluster assembly is used in the preparation of quantitative detection of Ag. + Applications in electrochemiluminescence sensors. Specifically, the electrochemiluminescence sensor utilizes a copper-silver bimetallic nanocluster assembly as the electrochemiluminescence reagent, combined with Ag... + The electrode composition was co-modified after the reaction.

[0027] Furthermore, the copper-silver bimetallic nanocluster assembly serves as an electrochemiluminescent reagent, Ag + Triethylamine, as an electrochemiluminescence signal quencher and a co-reactant in the electrochemiluminescence reaction, is used in the preparation of an electrochemiluminescence sensor for detecting human epidermal growth factor receptor 2 (HER2).

[0028] This invention employs two reaction mechanisms. In the presence of a reducing agent, silver acts as a dopant to synthesize copper-silver bimetallic nanocluster assemblies. In the absence of a reducing agent, silver, as part of the copper-silver bimetallic nanocluster assemblies, serves as a quencher for electrochemiluminescence signals.

[0029] In this invention, CuAgNCs are produced in the absence of a reducing agent. Assy For Ag + Exhibiting high sensitivity, the newly introduced Ag + It will replace the original Cu + This leads to the formation of new ECL-inactive products, resulting in CuAgNCs Assy The ECL signal intensity decreases; when the target HER2 is present, the HER2 aptamer modified on the surface of the magnetic sphere can specifically recognize HER2 and initiate a hybridization chain reaction, and its amplification product can amplify Ag in solution. + Ag enriched on the surface of magnetic spheres, free in the solution + The content subsequently decreased; then, the free Ag in the solution was analyzed using the electrochemiluminescence sensor of this invention. + The content is quantitatively detected, ultimately achieving the goal of indirect quantitative detection of HER2. In this invention, a copper-silver bimetallic nanocluster assembly is used as the electrochemiluminescence reagent, and triethylamine is used as the co-reactant in the electrochemiluminescence reaction. The copper-silver bimetallic nanocluster assembly has advantages such as low toxicity, good stability, and high electrochemiluminescence intensity, and also has the advantages of simple preparation process and large-scale preparation. The sensor system of this invention has the advantages of good specificity, high sensitivity, and wide linear range for the quantitative detection of human epidermal growth factor receptor 2 in human serum. The electrochemical sensor prepared using the copper-silver bimetallic nanocluster assembly of this invention has high sensitivity, solving the problem of low sensitivity in existing commercially available human epidermal growth factor receptor 2 detection (limit of detection is 15 ng / mL).

[0030] Preferably, the quantitative Ag method described in this invention + The steps for detecting human epidermal growth factor receptor 2 are as follows:

[0031] (1) Couple carboxylated magnetic beads with sDNA (sequence: ACGCACCATACTCACGTTCGAATGCCCTTTTTT-NH2), then add aptamer (sequence: GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC), shake at room temperature, magnetically separate, and discard the supernatant.

[0032] (2) Add HER2, shake at 37°C, and use magnetic suction to clean and remove detached aptamer and free HER2;

[0033] (3) Add H1-C (sequence: GGGCATTCGAACGTGAGTATGGTGCGTAGCCCGCACGCACCATACTCACGTTCGAAACTCTCTCTTTTTCTCTCTCTC) and H2-C (sequence: CTCTCTCTTTTTCTCTCTCAAACGCACCATACTCACGTTCGAATGCCCTCGAACGTGAGTATGGTGCGTGCGGGCT), shake at room temperature, wash three times with water using magnetic adsorption, discard the supernatant, add AgNO3 solution, shake at room temperature, magnetically separate, and collect the supernatant (containing free Ag). + );

[0034] (4) Polish the working electrode and then clean it with ultrasonic cleaning;

[0035] (5) Containing free Ag + The supernatant and CuAgNCs Assy The suspension was mixed, and after the reaction, the mixture was dropped onto the surface of the working electrode. The electrode was then allowed to dry at room temperature to obtain the Ag sample. + An electrochemiluminescent sensor for human epidermal growth factor receptor 2, for future use;

[0036] (6) The electrochemiluminescence sensor in step (5) is used to collect the ECL signal intensity, and the corresponding human epidermal growth factor receptor 2 concentration is calculated based on the value of the electrochemiluminescence signal.

[0037] In step (5), the electrochemiluminescence sensor is connected to the ECL instrument. Using PBS solution with pH = 6 to 10 as the electrolyte and 10 to 150 μM triethylamine as the co-reactant, the ECL signal intensity is collected, and the corresponding human epidermal growth factor receptor 2 concentration is calculated based on the value of the electrochemiluminescence signal.

[0038] The application of the electrochemiluminescence sensor for measuring human epidermal growth factor receptor 2 described in this invention in the preparation of tools or reagents for quantitative detection of human epidermal growth factor receptor 2.

[0039] More preferably, the detection procedure for the quantitative human epidermal growth factor receptor 2 is as follows:

[0040] (1) Couple carboxylated magnetic beads with 50-200 μL of 0.5-2 μM sDNA, then add 50-200 μL of 0.5-3 μM aptamer, shake at room temperature for 0.5-2 h, separate magnetically, and discard the supernatant;

[0041] (2) Add 100-400 μL of HER2 at different concentrations, shake at 37°C for 0.5-2 h, and magnetically clean to remove detached aptamer and free HER2;

[0042] (3) Add 50–200 μL of 0.5–2 μM H1-C and 50–200 μL of 0.5–2 μM H2-C, shake at room temperature for 0.5–2 h, then wash three times with water using magnetic adsorption, discard the supernatant, add 100–400 μL of 100–400 μM AgNO3 solution, shake at room temperature for 0.5–2 h, separate magnetically, and collect the supernatant (containing free Ag). + );

[0043] (4) Polish the working electrode with 0.3μm and 0.05μm Al2O3 powder in sequence, and then clean it with water, ethanol and water in sequence for 2 to 10 minutes.

[0044] (5) Take 2–10 μL of the magnetically adsorbed solution and 2–10 μL of 0.4–1.6 mg / mL CuAgNCs. Assy The suspension was reacted for 10–30 min. After the reaction, 2–10 μL of the mixture was added dropwise to the surface of the working electrode. The mixture was then allowed to stand and dry at room temperature to obtain the Ag assay result. + An electrochemiluminescent sensor for human epidermal growth factor receptor 2, for future use;

[0045] (6) The electrochemiluminescence sensor in step (5) is used to collect the ECL signal intensity. PBS solution with pH = 6 to 10 is used as the electrolyte and triethylamine with 30 to 150 μM is used as the co-reactant. The corresponding human epidermal growth factor receptor 2 concentration is calculated by the value of the electrochemiluminescence signal.

[0046] Most preferably, the detection procedure for the quantitative human epidermal growth factor receptor 2 is as follows:

[0047] (1) Couple carboxylated magnetic beads with 100 μL of 1 μM sDNA, then add 100 μL of 1.5 μM aptamer, shake at room temperature for 1 h, separate magnetically, and discard the supernatant;

[0048] (2) Add 200 μL of HER2 at different concentrations, shake at 37°C for 1 h, and magnetically clean to remove detached aptamer and free HER2.

[0049] (3) Add 100 μL of 1 μM H1-C and 100 μL of 1 μM H2-C, shake at room temperature for 1 h, then wash three times with water using magnetic adsorption, discard the supernatant, add 200 μL of 200 μM AgNO3 solution, shake at room temperature for 1 h, separate magnetically, and collect the supernatant (containing free Ag). + );

[0050] (4) Polish the working electrode with 0.3μm and 0.05μm Al2O3 powder in sequence, and then clean it with water, ethanol and water in sequence for 5 min.

[0051] (5) Take 5 μL of the magnetically adsorbed solution and 5 μL of 0.8 mg / mL CuAgNCs Assy The suspension was reacted for 20 min, and then 5 μL of the mixture was added dropwise to the surface of the working electrode. After drying at room temperature, the Ag was obtained. + An electrochemiluminescent sensor for human epidermal growth factor receptor 2, for future use;

[0052] (6) Connect the electrochemiluminescence sensor after the reaction in step (5) to the ECL instrument, use PBS solution with pH=7.4 as electrolyte and 75μM triethylamine as co-reactant to collect the ECL signal intensity, and calculate the corresponding human epidermal growth factor receptor 2 concentration through the value of the electrochemiluminescence signal.

[0053] The photomultiplier voltage (PMT) used to acquire the electrochemiluminescence signal intensity is 300–800V, and the test range is 0.2–1.3V.

[0054] Preferably, the PMT is 500V when collecting the electrochemiluminescence signal intensity, and the test range is 0.2-1.3V.

[0055] The electrochemical sensor prepared in this invention employs a copper-silver bimetallic nanocluster assembly (CuAgNCs). Assy When used as an electrochemiluminescence reagent, Ag is employed. + As CuAgNCs Assy The electrochemiluminescence signal quencher of the luminescent agent was selected, and triethylamine was used as a co-reactant in the electrochemiluminescence reaction. The electrochemiluminescence signal was detected by an electrochemiluminescence workstation.

[0056] This invention also provides an electrochemiluminescence composition system, including CuAgNCs. Assy As an electrochemiluminescent reagent, Ag +CuAgNCs as a luminescent agent Assy The electrochemiluminescence signal quencher, triethylamine as a co-reactant in the electrochemiluminescence reaction, and a three-electrode system.

[0057] Preferably, the electrochemiluminescence composition system includes CuAgNCs. Assy As an electrochemiluminescent agent, Ag + As CuAgNCs Assy The luminescent agent is used as an electrochemiluminescence signal quencher, triethylamine is used as a co-reactant in the electrochemiluminescence reaction, glassy carbon electrode is used as the working electrode, silver-silver chloride electrode is used as the reference electrode, and platinum wire electrode is used as the auxiliary electrode.

[0058] In this invention, CuAgNCs are produced in the absence of a reducing agent. Assy For Ag + Exhibiting high sensitivity, the newly introduced Ag + It will replace the original Cu + This leads to the formation of new electrochemiluminescent products, resulting in CuAgNCs Assy The electrochemiluminescence signal intensity decreases; when the target HER2 is present, the HER2 aptamer modified on the surface of the magnetic sphere can specifically recognize HER2 and initiate a hybridization chain reaction, and its amplification product can carry Ag in solution. + Ag enriched on the surface of magnetic spheres, free in the solution + The content decreases accordingly, thereby reducing the effect on CuAgNCs. Assy The quenching effect of the electrochemiluminescence signal; subsequently, the free Ag in the solution is detected by the electrochemiluminescence sensor of this invention. + The content was quantitatively detected, ultimately achieving the goal of indirect quantitative detection of HER2. The content of the target HER2 protein was positively correlated with the electrochemiluminescence signal of the system.

[0059] This invention addresses the current challenges of preparing silver-doped copper nanoclusters or the cumbersome preparation methods, proposing a novel method for this purpose. While the silver-doped copper nanoclusters prepared by this invention belong to the category of nanoclusters, they are novel copper-silver bimetallic nanocluster assemblies with superior performance. The copper-silver bimetallic nanocluster assemblies of this invention are prepared using silver as a heterometallic dopant and 4,6-dimethylthiopyrimidine (DMPM) as a ligand. The silver doping effect and self-assembly characteristics can be controlled and improved to enhance the material's performance. This method can replace traditional copper nanoclusters in applications such as fluorescence (imaging) sensing, electrochemiluminescence (imaging) sensing, catalysis, light-emitting diodes, photoelectric conversion materials, and biomedicine. Furthermore, the synthesis method is novel, and the resulting material exhibits high stability and good biocompatibility.

[0060] Metal doping can modulate the electronic and geometric structures of nanoclusters by introducing synergistic effects, thereby enhancing their optical, electrical, and catalytic properties. The choice of metal composition and ligands can regulate the number and position of dopant atoms, as well as the overall number of metal atoms and electronic structure of the nanoclusters. Silver and copper are elements in the same group, with similar electron configurations and physicochemical properties, making them ideal heteroatom dopants.

[0061] Self-assembly is one of the effective strategies for designing ideal building blocks to optimize the properties of nanoclusters. Appropriate self-assembled nanoclusters can generate ordered structures, which will improve electron / charge transfer, suppress the movement and rotation of nanocluster ligands, and reduce the oxidation of nanoclusters. Intermolecular interactions, especially those involving π-π stacking, are crucial for modulating molecular aggregation and material properties. The strong tendency of pyrimidine derivatives to form π-π stacked assemblies and their excellent electron transport properties have led us to use them as ligands in the synthesis of CuNCs to improve their stability and electron transport performance.

[0062] This invention employs a novel method to successfully synthesize copper-silver bimetallic nanocluster assemblies exhibiting high stability, significant fluorescence quantum efficiency, and remarkable electrochemiluminescence efficiency. The copper-silver bimetallic nanocluster assemblies (CuAgNCs) of this invention... Assy The doping mechanism is as follows: Single-crystal X-ray diffraction analysis shows that the crystal structure of the undoped copper nanoclusters belongs to the triclinic space group P-1, consisting of one hexanuclear Cu complex and two DMSO molecules as crystallization solvents, with the molecular formula [Cu6(DMMP)6·2DMSO]. CuAgNCs Assy A series of molecules with masses exceeding [Cu6(DMMP)6+H] were observed in the positive ion mode of electrospray mass spectrometry. + The peaks are distinct, with a spacing of m / z = 44 between each peak group, corresponding to the mass difference between individual Ag and Cu atoms. This observation indicates that Ag doping leads to the continuous substitution of Cu atoms in the original Cu6 by Ag atoms, forming [Cu... 6-x Ag x (DMMP)6+H] + , where x ranges from 1 to 3.

[0063] The copper-silver bimetallic nanocluster assembly (CuAgNCs) of this invention Assy The self-assembly mechanism is as follows: the π-π stacking and hydrophobic interactions of DMPM ligands lead to the self-assembly of the ligands, enabling [Cu] to... 6-x Ag x (DMMP)6+H] + The nanoclusters approached each other, eventually achieving assembly and generating a copper-silver bimetallic nanocluster assembly.

[0064] This invention proposes for the first time the assembly of copper-silver bimetallic nanoclusters, and synthesizes CuAgNCs with high stability, significant fluorescence quantum efficiency, and electrochemiluminescence efficiency simply at room temperature. Assy The novel preparation method of this invention is not only simple to implement, requiring no specific reaction vessel or additional conditions such as heating, but can also be easily and rapidly synthesized at room temperature and under normal pressure. Furthermore, compared to standalone self-assembled copper nanoclusters, the copper-silver bimetallic nanoclusters synthesized by this invention through a specific preparation method exhibit significantly improved fluorescence quantum efficiency and electrochemiluminescence efficiency.

[0065] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0066] 1. This invention prepares a copper-silver bimetallic nanocluster assembly (CuAgNCs). Assy Unlike traditional methods that involve doping assemblies, this invention achieves the doping and self-assembly synthesis of copper nanoclusters in a one-step process. Furthermore, while Chinese Patent 2024112516467 discloses a method for preparing self-assembled copper nanoclusters, this method requires two steps to synthesize the copper nanocluster assemblies and uses organic solvents; this patent, however, requires only a one-step process to directly synthesize copper-silver bimetallic nanocluster assemblies in water.

[0067] 2. This invention provides a novel method for preparing copper-silver bimetallic nanocluster assemblies, which solves the problems of limited synthesis methods and cumbersome steps in the prior art for copper-silver bimetallic nanocluster assemblies, and has the advantages of simple preparation process and large-scale preparation.

[0068] 3. In the prior art, Chinese Patent 2024112516467 discloses a self-assembled copper nanocluster with a fluorescence quantum efficiency of 39.3% and an electrochemiluminescence efficiency of 20%. The copper-silver bimetallic nanocluster assembly prepared in this invention is a novel nanomaterial with advantages such as good stability, higher fluorescence quantum efficiency (72.5%), and higher electrochemiluminescence efficiency (103%). Due to the effective doping of silver, the copper-silver bimetallic nanocluster assembly prepared in this invention significantly alters the material's structure and effectively improves its performance. Therefore, it has significant application value in related fields such as fluorescence (imaging) sensing, electrochemiluminescence (imaging) sensing, catalysis, light-emitting diodes, photoelectric conversion materials, and biomedicine.

[0069] 4. This invention provides a prepared copper-silver bimetallic nanocluster assembly (CuAgNCs). Assy This material is a new application of electrochemiluminescence reaction luminescent agent. As an electrochemiluminescence luminescent agent, it has good stability, high electrochemiluminescence efficiency, simple preparation process, and can be prepared in large quantities. It can be effectively applied to electrochemiluminescence sensors to achieve high-sensitivity sensing.

[0070] 5. This invention comprises a copper-silver bimetallic nanocluster assembly (CuAgNCs). Assy This material is used as a luminescent agent in an electrochemiluminescence sensor to detect human epidermal growth factor receptor 2 (HER2) in serum. Simultaneously, this invention targets the binding specificity of the target analyte HER2 to its aptamer, binding Ag... + By incorporating the signal quenching effect generated by post-processing and the signal amplification strategy of hybridization chain reaction, an electrochemiluminescence aptamer sensor was designed. The sensor of this invention successfully realized the quantitative detection of HER2 in human serum, and has advantages such as good specificity, high sensitivity, wide linear range, low cost, and ease of use. Attached Figure Description

[0071] Figure 1 CuAgNCs Assy Transmission electron microscope image.

[0072] Figure 2 CuAgNCs Assy (a) High-angle annular dark field diagram and (b) Energy dispersive X-ray spectral elemental distribution diagram.

[0073] Figure 3 CuAgNCs Assy Electrospray ionization mass spectrometry in positive ion mode.

[0074] Figure 4 CuAgNCs Assy High-resolution transmission electron microscopy image.

[0075] Figure 5 CuAgNCs Assy (a) Fluorescence emission spectrum and (b) fluorescence decay curve.

[0076] Figure 6 CuAgNCs Assy (a) Ampere-Qt curve and (b) wavelength-resolved ECL spectrum of the electrochemiluminescence reaction with Ru(bpy)3Cl2.

[0077] Figure 7 CuAgNCs Assy (a) Photostability under UV irradiation and its oxidative stability after storage at room temperature for 30 days; (b) Fluorescence stability under different acid and alkaline conditions; (c) Thermogravimetric diagram and (d) UV-Vis absorption spectra over time (1 day to 6 months).

[0078] Figure 8 CuAgNCs Assy Scanning electron microscopy images of the membrane before (a) and after (b) electrochemiluminescence scanning; (c) CuAgNCsAssy / GCE continuous scan electrochemiluminescence signal; (d)CuNCs Assy / GCE electrochemiluminescence signal after storage at room temperature.

[0079] Figure 9 For (a)CuAgNCs Assy The electrochemiluminescence response intensity and the added Ag + The relationship between concentration and (b) ECL intensity and the subsequent addition of Ag + Standard curves between concentrations (0-100 μM).

[0080] Figure 10 This is a schematic diagram of the detection process of an electrochemiluminescence biosensor used for sensing human epidermal growth factor receptor 2.

[0081] Figure 11 This is a diagram illustrating the feasibility analysis of PAGE electrophoresis for hybridization chain reactions.

[0082] Figure 12 This is a graph showing the linear relationship between the intensity of the sensor's electrochemiluminescence signal and the logarithm of human epidermal growth factor receptor 2.

[0083] Figure 13 This is a sensor selectivity map.

[0084] Figure 14 The image shows the results of the serum spiked recovery test. Detailed Implementation

[0085] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0086] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. The aptamer, sDNA, H1-C, and H2-C nucleic acid sequences involved in this invention were synthesized by Shanghai Sangon Biotech (Shanghai) Co., Ltd. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0087] Aptamer:

[0088] GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC

[0089] sDNA: ACGCACCATACTCACGTTCGAATGCCCTTTTTT-NH2

[0090] H1-C:

[0091] GGGCATTCGAACGTGAGTATGGTGCGTAGCCCGCACGCACCATACTCACGTTCGAAAACTCTCTCTTTTTCTCTCTC

[0092] H2-C:

[0093] CTCTCTCTTTTTCTCTCTCAAACGCACCATACTCACGTTCGAATGCCCTCGAACGTGAGTATGGTGCGTGCGGGCT

[0094] Carboxylated magnetic beads were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., i-Quip TM Product code: S8038-A300nm-1EA, 300nm, 50mg / ml.

[0095] Example 1

[0096] A copper-silver bimetallic nanocluster assembly (CuAgNCs) Assy The preparation method of CuAgNCs includes the following steps: S1, 3 mg of copper nitrate trihydrate powder, 0.05 mg of silver nitrate powder, and 3 mL of ultrapure water are ultrasonically mixed evenly to form an aqueous solution of the metal salt; S2, 1 mg of 4,6-dimethylmercaptopyrimidine powder is ultrasonically mixed evenly with 6 mL of ultrapure water to form a pale yellow aqueous solution of 4,6-dimethylmercaptopyrimidine; S3, the aqueous solution of 4,6-dimethylmercaptopyrimidine is evenly added to the mixed aqueous solution of the metal salt under magnetic stirring at 500 rpm, and stirred for 40 min to obtain a mixed solution; S4, the mixed solution is centrifuged at 6000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed with water to obtain CuAgNCs. Assy .

[0097] Example 2

[0098] A copper-silver bimetallic nanocluster assembly (CuAgNCs) Assy The preparation method of CuAgNCs includes the following steps: S1, 5 mg of copper nitrate trihydrate powder, 0.2 mg of silver nitrate powder, and 3 mL of ultrapure water are ultrasonically mixed evenly to form an aqueous solution of the metal salt; S2, 4 mg of 4,6-dimethylmercaptopyrimidine powder and 6 mL of ultrapure water are ultrasonically mixed evenly to form a pale yellow aqueous solution of 4,6-dimethylmercaptopyrimidine; S3, the aqueous solution of 4,6-dimethylmercaptopyrimidine is evenly added to the mixed aqueous solution of the metal salt under magnetic stirring at 1000 rpm, and stirred for 60 min to obtain a mixed solution; S4, the mixed solution is centrifuged at 8000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed with water to obtain CuAgNCs. Assy .

[0099] Example 3

[0100] A copper-silver bimetallic nanocluster assembly (CuAgNCs) Assy The preparation method of CuAgNCs includes the following steps: S1, 7.2 mg of copper nitrate trihydrate powder, 0.36 mg of silver nitrate powder, and 3 mL of ultrapure water are ultrasonically mixed evenly to form a blue copper nitrate aqueous solution; S2, 7 mg of 4,6-dimethylmercaptopyrimidine powder and 6 mL of ultrapure water are ultrasonically mixed evenly to form a pale yellow 4,6-dimethylmercaptopyrimidine aqueous solution; S3, the 4,6-dimethylmercaptopyrimidine aqueous solution is evenly added to the mixed metal salt aqueous solution under magnetic stirring at 1500 rpm, and stirred for 90 min to obtain a mixed solution; S4, the mixed solution is centrifuged at 11000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed with water to obtain CuAgNCs. Assy .

[0101] Example 3 Preparation of copper-silver bimetallic nanocluster assemblies (CuAgNCs) Assy Transmission electron microscopy image as shown below Figure 1 As shown. CuAgNCs Assy It possesses unique morphological characteristics, with its structural unit being a square structure assembled from multiple layers of layered nanosheets in a spiral. Energy-dispersive X-ray spectroscopy (EDS) Figure 2 Elemental distribution showed that Cu, Ag, S, and N elements were uniformly distributed throughout the nanosheet assembly. Electrospray ionization mass spectrometry (ESIMS) Figure 3 Analysis showed that CuAgNCs Assy In positive ion mode, a series of molecules with masses exceeding [Cu6(DMMP)6+H] appeared. + The peaks are distinct, with a spacing of m / z = 44 between each peak group, corresponding to the mass difference between individual Ag and Cu atoms. This observation indicates that Ag doping leads to the continuous substitution of Cu atoms in the original Cu6 NCs by Ag atoms, forming [Cu... 6-x Agx(DMMP)6+H] + Where x ranges from 1 to 3. Therefore, Ag atoms are doped into individual Cu6 NCs, rather than into assemblies of CuNCs. Assy In the nanosheet, this structure corresponds to the high-resolution transmission electron microscopy image ( Figure 4 This is consistent with the disordered arrangement of NCs observed in [the study]. Figures 1 to 4 This invention demonstrates the successful synthesis of copper-silver bimetallic nanocluster assemblies. For example... Figure 5 As shown, CuAgNCs under 350 nm excitation... AssyThe CuAgNCs exhibited strong fluorescence emission at 662 nm, with an absolute quantum yield of 72.5% and a lifetime of 12.51 μs. In contrast, the fluorescence quantum efficiency of the self-assembled copper nanoclusters disclosed in Chinese Patent 2024112516467 was only 39.3%, with a lifetime of 11.50 μs, indicating significantly lower performance than the copper-silver bimetallic nanocluster assembly of this invention. Wavelength-resolved electrochemiluminescence spectroscopy was used to determine the fluorescence quantum yield of CuAgNCs. Assy The relative electrochemiluminescence efficiency is 103% ( Figure 6 This is significantly higher than the relative electrochemiluminescence efficiency (39.3%) of the self-assembled copper nanoclusters disclosed in Chinese Patent 2024112516467 in the prior art. The specific calculation process is as follows:

[0102]

[0103] Where “ECL” and “Current” represent the integrated ECL photon count obtained from the corrected ECL spectrum based on the counting sensitivity of the photomultiplier tube at different light wavelengths and Faraday electrochemical current values, respectively, and “st” represents the Ru(bpy)3Cl2 standard sample and “x” represents CuAgNCs. Assy Sufficient stability is a fundamental requirement for practical applications. For example... Figure 7 As shown in a, CuAgNCs Assy The aqueous suspension exhibited excellent stability after 4000 seconds of continuous UV irradiation and after 30 days of storage under ambient conditions, with no significant decrease in fluorescence intensity. Furthermore, CuAgNCs... Assy Its fluorescence intensity is unaffected under acidic conditions of 1M HCl or 6M HOAc and alkaline conditions of 1M NaOH or 7M TEA. Figure 7 b) exhibits excellent acid-base stability. This stability is mainly attributed to the chemical inertness of the hydrophobic methyl functional groups on the ligands, and the compact and ordered assembly structure formed by the π-π stacking interactions between the pyrimidine derivative ligands. Thermogravimetric analysis (TGA) Figure 7 c) shows that CuAgNCs Assy Its decomposition temperature is approximately 357℃, indicating moderate thermal stability. The UV-Vis spectrum varies over time. Figure 7 d) indicates CuAgNCs Assy The characteristic peaks remained unchanged over 6 months, further confirming its strong structural stability. Furthermore, due to its excellent film-forming properties (… Figure 8 a and 8b)CuAgNCs Assy Modified glassy carbon electrode (CuAgNCs) Assy / GCE) exhibits excellent long-term stability and scan stability. Figure 8(c and 8d) After 40 consecutive scans in 0.01M PBS solution containing 75mM TEA, the relative standard deviation was only 0.36%. This exceptional stability is ideal for practical electrochemiluminescence applications. The above experiments effectively demonstrate that the CuAgNCs prepared in this invention are... Assy It can be used as a luminescent agent and has excellent performance.

[0104] Example 4

[0105] A copper-silver bimetallic nanocluster assembly (CuAgNCs) Assy The preparation method of CuAgNCs includes the following steps: S1, 8.5 mg of copper nitrate trihydrate powder, 1 mg of silver nitrate powder, and 3 mL of ultrapure water are ultrasonically mixed evenly to form a mixed metal salt aqueous solution; S2, 12 mg of 4,6-dimethylmercaptopyrimidine powder and 6 mL of ultrapure water are ultrasonically mixed evenly to form a pale yellow 4,6-dimethylmercaptopyrimidine aqueous solution; S3, the 4,6-dimethylmercaptopyrimidine aqueous solution is evenly added to the mixed metal salt aqueous solution under magnetic stirring at 1500 rpm, and stirred for 100 min to obtain a mixed solution; S4, the mixed solution is centrifuged at 12000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed with water to obtain CuAgNCs. Assy .

[0106] Example 5

[0107] A copper-silver bimetallic nanocluster assembly (CuAgNCs) Assy The preparation method of CuAgNCs includes the following steps: S1, 10 mg of copper nitrate trihydrate powder, 2 mg of silver nitrate powder, and 3 mL of ultrapure water are ultrasonically mixed evenly to form a mixed metal salt aqueous solution; S2, 15 mg of 4,6-dimethylmercaptopyrimidine powder and 6 mL of ultrapure water are ultrasonically mixed evenly to form a pale yellow 4,6-dimethylmercaptopyrimidine aqueous solution; S3, the 4,6-dimethylmercaptopyrimidine aqueous solution is evenly added to the mixed metal salt aqueous solution under magnetic stirring at 1500 rpm, and stirred for 120 min to obtain a mixed solution; S4, the mixed solution is centrifuged at 12000 rpm for 10 min, the supernatant is discarded, and the precipitate is washed with water to obtain CuAgNCs. Assy .

[0108] Comparative Example 1

[0109] The method of Example 3 differs in that water in any step of Example 3 is replaced with organic solvents such as N,N-dimethylformamide, methanol, dimethyl sulfoxide, hexanilide, acetone, chloroform, ethyl acetate, tetrahydrofuran, n-butanol, toluene, cyclohexane, and ethane. In such cases, the target product cannot be synthesized. For example, if hexanilide is replaced, the product will not have fluorescence.

[0110] Furthermore, replacing 4,6-dimethylmercaptopyrimidine (DMPM) with 4-amino-6-hydroxy-2-mercaptopyrimidine, 6-amino-2-mercaptopyrimidine, 4,6-diamino-2-mercaptopyrimidine, etc., failed to successfully synthesize the target product.

[0111] Example 6

[0112] Determination of Ag + The detection process of the electrochemiluminescence sensing system includes the following steps: S1, the glassy carbon working electrode (d = 3 mm) is polished sequentially with 0.3 μm and 0.05 μm Al2O3 powder, and then ultrasonically cleaned with water, ethanol, and water sequentially for 5 min; S2, 100 μL of silver nitrate aqueous solutions of different concentrations are prepared; S3, 5 μL of 0.8 mg / mL CuAgNCs prepared in Example 3 is taken. Assy The suspension (aqueous solution) was mixed with 5 μL of silver nitrate aqueous solution of different concentrations and reacted at room temperature for 5 min; S4, 5 μL of the reaction mixture was dropped onto the surface of the glassy carbon working electrode and allowed to dry at room temperature to obtain the Ag-determining solution. + The electrochemiluminescence sensor from step S4 is used as the working electrode, the silver-silver chloride electrode as the reference electrode, and the platinum wire electrode as the auxiliary electrode. PBS solution (pH 7.4) is used as the electrolyte, and 75 μM triethylamine is used as the co-reactant. ECL signal intensity is acquired at a PMT of 500 V and a potential range of 0.2–1.3 V. The electrochemiluminescence signal value is monitored, and the corresponding Ag is calculated based on the standard curve. + concentration.

[0113] Example 7

[0114] Determination of Ag + Electrochemiluminescence sensor system electrochemiluminescence intensity and Ag + The linear relationship between concentrations. The detection process of the electrochemiluminescence sensor system is the same as in Example 6.

[0115] Different concentrations of silver nitrate aqueous solutions were prepared: 15, 30, 45, 60, 75, 100, 150, 300, 600, and 1000 μM. Three parallel experimental groups were set up for each concentration, and the detection method of Example 6 was used. The electrochemiluminescence signal intensity was compared with Ag... + Linear relationship analysis was performed on the concentration, and the detection range results are shown in [link to results]. Figure 9 With Ag + With increasing concentration, CuAgNCs Assy The electrochemiluminescence signal intensity gradually decreased and showed a linear relationship in the range of 0 to 100 μM, indicating that the constructed sensing system can be used for Ag. + The quantitative and sensitive detection is suitable for the construction of subsequent sensors.

[0116] Example 8

[0117] The detection procedure of the electrochemiluminescence sensor system for determining human epidermal growth factor receptor 2 (HER2) was as follows: S1, 100 μL of carboxylated magnetic beads were coupled with 100 μL of 0.5 μM sDNA, and then 50 μL of 0.5 μM aptamer was added. The mixture was shaken at room temperature for 0.5 h, and magnetic separation was performed. The supernatant was discarded. S2, 100 μL of HER2 at different concentrations was added to the magnetically separated beads. The mixture was shaken at 37 °C for 0.5 h, and magnetic washing was performed to remove detached aptamer and free HER2. S3, 50 μL of 0.5 μM H2-C and 50 μL of 0.5 μM H2-C were added to the washed magnetic beads. The mixture was shaken at room temperature for 1 h, and then magnetically washed three times with water. The supernatant was discarded. Then 100 μL of 100 μM AgNO3 solution was added. The mixture was shaken at room temperature for 0.5 h, and magnetic separation was performed. The supernatant (containing free Ag) was collected. + S4. Polish the glassy carbon working electrode (d = 3 mm) sequentially with 0.3 μm and 0.05 μm Al2O3 powders, then ultrasonically clean it sequentially with water, ethanol, and water for 2 min; S5. Take 2 μL of the magnetically adsorbed solution (the supernatant collected in S3) and 2 μL of the 0.4 mg / mL CuAgNCs prepared in Example 3. Assy The suspension (aqueous solution) was reacted for 10 min, and then 2 μL of the mixture was dropped onto the surface of the working electrode. After drying at room temperature, an electrochemiluminescence sensor for measuring human epidermal growth factor receptor 2 was obtained and set aside. S6: The electrochemiluminescence sensor after the reaction in step S5 was connected to the ECL instrument. The silver-silver chloride electrode was used as the reference electrode and the platinum wire electrode was used as the auxiliary electrode. PBS solution with pH=6 was used as the electrolyte and 30 μM triethylamine was used as the co-reactant. The ECL signal intensity was collected. The PMT was 300 V and the potential range was 0.2-1.3 V. The corresponding concentration of human epidermal growth factor receptor 2 was calculated from the value of the electrochemiluminescence signal.

[0118] Example 9

[0119] Detection procedure of the electrochemiluminescence sensor system for human epidermal growth factor receptor 2 (HER2): S1, 100 μL of carboxylated magnetic beads were coupled with 100 μL of 1 μM sDNA, followed by 100 μL of 1.5 μM aptamer. The mixture was shaken at room temperature for 1 h, followed by magnetic separation, and the supernatant was discarded. S2, 200 μL of HER2 at different concentrations were added to the magnetically separated beads, and the mixture was shaken at 37 °C for 1 h. The beads were then magnetically washed to remove detached aptamer and free HER2. S3, 100 μL of 1 μM H1-C and 100 μL of 1 μM H2-C were added to the washed beads, and the mixture was shaken at room temperature for 1 h. The beads were then magnetically washed three times with water, and the supernatant was discarded. 200 μL of 200 μM AgNO3 solution was added, and the mixture was shaken at room temperature for 1 h. The mixture was then magnetically separated, and the supernatant (containing free Ag) was collected. + S4. Polish the glassy carbon working electrode (d = 3 mm) sequentially with 0.3 μm and 0.05 μm Al2O3 powders, then ultrasonically clean it sequentially with water, ethanol, and water for 5 min; S5. Take 5 μL of the magnetically adsorbed solution (the supernatant collected in S3) and 5 μL of the 0.8 mg / mL CuAgNCs prepared in Example 3. Assy The suspension (aqueous solution) was reacted for 20 min, and then 5 μL of the mixture was dropped onto the surface of the working electrode. After drying at room temperature, an electrochemiluminescence sensor for measuring human epidermal growth factor receptor 2 was obtained and set aside. S6: The electrochemiluminescence sensor after the reaction in step S5 was connected to the ECL instrument. The silver-silver chloride electrode was used as the reference electrode and the platinum wire electrode was used as the auxiliary electrode. PBS solution with pH=7.4 was used as the electrolyte and 75 μM triethylamine was used as the co-reactant. The ECL signal intensity was collected. The PMT was 500 V and the potential range was 0.2-1.3 V. The corresponding concentration of human epidermal growth factor receptor 2 was calculated from the value of the electrochemiluminescence signal.

[0120] Example 9: A schematic diagram of the detection process of the electrochemiluminescence sensor system is shown below. Figure 10 As shown. To demonstrate the successful construction of the proposed biosensor, the hybridization chain reaction was verified using PAGE electrophoresis. Figure 11When sDNA was mixed with aptamer, the original aptamer band completely disappeared, and a new band with a larger molecular weight appeared (lane 3), indicating that aptamer can bind to sDNA. When hairpin DNA H1 and H2 were mixed, only low-to-high molecular weight bands were observed in the lane, indicating that the two do not interact. However, when sDNA was added to the above mixture, a bright high molecular weight band appeared in the lane (lane 4), indicating that sDNA can open the hairpin structure and initiate the HCR reaction to form long double-stranded DNA. In lane 5, because sDNA and aptamer were pre-reacted for 1 hour before the addition of H1 and H2, the complementary binding sites of H1 in sDNA were occupied by aptamer, hindering the initiation of the HCR reaction, so only a low molecular weight band was observed. To verify whether the HER2 protein can successfully recognize aptamer and expose sDNA to initiate the HCR reaction, this study pre-incubated sDNA and aptamer in the reaction solution, and then added HER2, H1, and H2 for mixing. PAGE electrophoresis analysis revealed a high-molecular-weight band (lane 6) consistent with lane 4, indicating that HER2 successfully interacted with aptamer, leading to sDNA exposure and initiating the HCR reaction. In summary, the hybridization chain reaction amplification strategy of this invention can be successfully implemented and is suitable for the subsequent construction of sensors.

[0121] Example 10

[0122] Detection procedure of electrochemiluminescence sensor system for human epidermal growth factor receptor 2: S1, 100 μL of carboxylated magnetic beads were coupled with 150 μL of 1.5 μM sDNA, and then 150 μL of 2.25 μM aptamer was added. The mixture was shaken at room temperature for 1.5 h, magnetically separated, and the supernatant was discarded; S2, 300 μL of HER2 at different concentrations was added to the magnetically separated beads, and the mixture was shaken at 37 °C for 1.5 h. The beads were then magnetically washed to remove detached aptamer and free HER2.

[0123] S3. Continue adding 150 μL of 1.5 μM H1-C and 150 μL of 1.5 μM H2-C to the cleaned magnetic beads, shake at room temperature for 1.5 h, then wash three times with water using magnetic adsorption, discard the supernatant, add 300 μL of 300 μM AgNO3 solution, shake at room temperature for 1.5 h, magnetic separation, and collect the supernatant (containing free Ag). + S4. Polish the glassy carbon working electrode (d = 3 mm) sequentially with 0.3 μm and 0.05 μm Al2O3 powders, then ultrasonically clean it sequentially with water, ethanol, and water for 8 min; S5. Take 7 μL of the magnetically adsorbed solution (the supernatant collected in S3) and 7 μL of the 1.2 mg / mL CuAgNCs prepared in Example 3.Assy The suspension (aqueous solution) was reacted for 25 min, and then 7 μL of the mixture was added dropwise to the surface of the working electrode. After drying at room temperature, the Ag was obtained. + An electrochemiluminescence sensor for human epidermal growth factor receptor 2 (HFR2) is prepared for use. S6: Connect the electrochemiluminescence sensor from step S5 to the ECL instrument. Use a silver-silver chloride electrode as the reference electrode and a platinum wire electrode as the auxiliary electrode. Use PBS solution (pH 8.5) as the electrolyte and 100 μM triethylamine as the co-reactant to acquire the ECL signal intensity. The PMT is 500 V, and the potential range is 0.2–1.3 V. Calculate the corresponding HFR2 concentration based on the electrochemiluminescence signal value.

[0124] Example 11

[0125] Detection procedure of the electrochemiluminescence sensor system for human epidermal growth factor receptor 2 (HER2): S1, 100 μL of carboxylated magnetic beads were coupled with 200 μL of 3 μM sDNA, followed by 200 μL of 3 μM aptamer. The mixture was shaken at room temperature for 2 h, followed by magnetic separation, and the supernatant was discarded. S2, 400 μL of HER2 at different concentrations were added to the magnetically separated beads, and the mixture was shaken at 37 °C for 2 h. The beads were then magnetically washed to remove detached aptamer and free HER2. S3, 200 μL of 2 μM H1-C and 200 μL of 2 μM H2-C were added to the washed beads, and the mixture was shaken at room temperature for 2 h. The beads were then magnetically washed three times with water, and the supernatant was discarded. 400 μL of 400 μM AgNO3 solution was added, and the mixture was shaken at room temperature for 2 h. The mixture was then magnetically separated, and the supernatant (containing free Ag) was collected. + S4. Polish the glassy carbon working electrode (d = 3 mm) sequentially with 0.3 μm and 0.05 μm Al2O3 powders, then ultrasonically clean it sequentially with water, ethanol, and water for 10 min; S5. Take 10 μL of the magnetically adsorbed solution (the supernatant collected in S3) and 10 μL of the 1.6 mg / mL CuAgNCs prepared in Example 3. Assy The suspension (aqueous solution) was reacted for 30 min, and then 10 μL of the mixture was added dropwise to the surface of the working electrode. After drying at room temperature, the Ag was obtained. + An electrochemiluminescence sensor for human epidermal growth factor receptor 2 (HFR2) is prepared for use. S6: Connect the electrochemiluminescence sensor from step S5 to the ECL instrument. Use a silver-silver chloride electrode as the reference electrode and a platinum wire electrode as the auxiliary electrode. Use PBS solution (pH=10) as the electrolyte and 150 μM triethylamine as the co-reactant to acquire the ECL signal intensity. The PMT is 500 V, and the potential range is 0.2–1.3 V. Calculate the corresponding HFR2 concentration based on the electrochemiluminescence signal value.

[0126] Example 12

[0127] The linear relationship between the electrochemiluminescence intensity and the concentration of human epidermal growth factor receptor 2 (HGF2) was determined using an electrochemiluminescence sensor system. The detection procedure of the electrochemiluminescence sensor system was the same as in Example 9.

[0128] Human epidermal growth factor receptor 2 (HGF2) solutions of different concentrations were prepared at 0.1, 1, 10, 100, 1000, 10000, and 100000 pg / mL, with three parallel experimental groups for each concentration. The detection method described in Example 9 was used. A linear relationship analysis was performed between the obtained electrochemiluminescence signal intensity and the logarithm of HGF2. The results are shown in […]. Figure 12 As the concentration of alkaline phosphatase increases, the intensity of the electrochemiluminescence signal gradually increases, exhibiting a linear relationship. The linear range of this sensor is 10. -1 -10 5 With a detection limit of 92.7 fg / mL, this invention exhibits higher sensitivity compared to existing commercial human epidermal growth factor receptor 2 assay kits (detection limit of 1 ng / mL, eBioscience, catalog number: XY-1282).

[0129] Example 13

[0130] Specificity analysis of target detection using an electrochemiluminescence sensor system for measuring human epidermal growth factor receptor 2.

[0131] The electrochemiluminescence sensor system of the present invention was investigated to determine whether it exhibited non-specific responses to structural analogs of the target analyte. The detection process of the electrochemiluminescence sensor system was the same as in Example 9, except that in step S2, proteins such as 100 ng / mL alpha-fetoprotein, carcinoembryonic antigen, heat shock protein, and trypsin were used instead of human epidermal growth factor receptor 2. The results were as follows: Figure 13 The ECL signal of human epidermal growth factor receptor 2 showed a very significant change (10 ng / mL), while the effects of other potential proteins were negligible even at a concentration 10 times that of human epidermal growth factor receptor 2 (100 ng / mL), indicating that the sensor designed in this invention has good specificity.

[0132] Example 14

[0133] The electrochemiluminescence sensor system of the present invention is used for the quantitative detection of human epidermal growth factor receptor 2 in human serum.

[0134] To investigate the feasibility of using the electrochemiluminescence sensor system of this invention for the quantitative detection of human epidermal growth factor receptor 2 in human serum, the detection process of the electrochemiluminescence sensor system was the same as in Example 9. In step S2, two groups of 1% human serum solutions (solvent: 0.01M PBS solution, pH=7.4) were used to dilute the ALP standard solution to final concentrations of 0, 0.02, 0.2, 2, and 20 ng / mL, respectively, with three parallel experimental groups for each concentration. The results are as follows: Figure 14 As shown, the detection results indicate that the recovery rate of human epidermal growth factor receptor 2 in different human serum samples using the electrochemiluminescence sensor system of the present invention ranges from 96.28% to 104.84%, and the relative standard deviation between different control groups is less than 3.19%, indicating that the test data of the sensor system is stable and reliable, and can be used for the determination of human epidermal growth factor receptor 2 in real biological samples.

[0135] In summary, the copper-silver bimetallic nanoclusters prepared by this invention are a novel nanomaterial. Due to the existence of the bimetallic synergistic effect, the material structure is significantly changed and the material performance is effectively improved. Therefore, it has important application value in related fields such as fluorescence (imaging) sensing, electrochemiluminescence (imaging) sensing, catalysis, light-emitting diodes, photoelectric conversion materials and biomedicine.

Claims

1. A method for preparing a copper-silver bimetallic nanocluster assembly, characterized in that, Includes the following steps: (1) Dissolve copper salt and silver salt in water to form a mixed metal salt aqueous solution; or dissolve copper salt and silver salt in water separately and then mix them to form a mixed metal salt aqueous solution; (2) Dissolve 4,6-dimethylmercaptopyrimidine in water to form an aqueous solution of 4,6-dimethylmercaptopyrimidine; (3) Add the aqueous solution of 4,6-dimethylmercaptopyrimidine to the aqueous solution of the mixed metal salt and stir to obtain a mixed solution; (4) Centrifuge the mixed solution and discard the supernatant. Wash the precipitate to obtain the copper-silver bimetallic nanocluster assembly.

2. The method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1, characterized in that, The copper salt mentioned in step (1) is copper nitrate, copper sulfate, copper chloride, or copper carbonate.

3. The method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1, characterized in that, The silver salt mentioned in step (1) is silver nitrate, silver fluoride, silver chlorate, silver perchlorate or silver sulfate.

4. The method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1, characterized in that, In step (1), it is preferable to mix 3 to 10 mg of copper salt powder with 3 mL of water to form a copper salt aqueous solution; and to mix 0.05 to 2 mg of silver salt powder with 3 mL of water to form a silver salt aqueous solution.

5. The method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1, characterized in that, In step (2), 1–15 mg of 4,6-dimethylmercaptopyrimidine powder is mixed with 6 mL of water to form an aqueous solution of 4,6-dimethylmercaptopyrimidine.

6. The method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1, characterized in that, In step (3), the aqueous solution of 4,6-dimethylmercaptopyrimidine is added to the aqueous solution of mixed metal salts at a uniform speed under magnetic stirring, and the magnetic stirring is continued for 40 to 100 minutes to obtain a mixed solution. The mass ratio of copper salt, silver salt and 4,6-dimethylmercaptopyrimidine is 3 to 10: 0.05 to 2: 1 to 15.

7. The method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1, characterized in that, The mixed solution described in step (4) was centrifuged at 6000–12000 rpm for 10 min, the supernatant was discarded, and the precipitate was washed to obtain copper-silver bimetallic nanoclusters (CuAgNCs). Assy ) suspension.

8. A copper-silver bimetallic nanocluster assembly prepared by the method for preparing the copper-silver bimetallic nanocluster assembly according to claim 1.

9. The application of the copper-silver bimetallic nanocluster assembly of claim 8 in fluorescence (imaging) sensing, electrochemiluminescence (imaging) sensing, catalysis, light-emitting diodes, photoelectric conversion materials and biomedicine.

10. A copper-silver bimetallic nanocluster assembly as described in claim 8, used in the preparation of a device for detecting human epidermal growth factor receptor 2 (HER2) and for the quantitative detection of Ag. + Applications in electrochemiluminescence sensors.