An antimicrobial peptide variant Gm-H against Fusarium graminearum and its application
By fusing a histidine tag to the C-terminus of the antimicrobial peptide GMA4CG_V6, a recombinant Pichia pastoris engineered strain G-Gm-H was constructed. This solved the problems of easy loss of activity of the antimicrobial peptide in high-salt fermentation systems and drug resistance of Fusarium graminearum, achieving efficient and low-cost disease control and promoting green agricultural development.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HEFEI BOOSSEN TECHNOLOGY CO LTD
- Filing Date
- 2026-05-27
- Publication Date
- 2026-06-30
AI Technical Summary
Existing antimicrobial peptides are prone to loss of activity in high-salt fermentation systems and have high production costs. Fusarium graminearum is becoming increasingly resistant to chemical pesticides, and there is a lack of green control agents, resulting in poor disease control in agricultural production.
A variant of the antimicrobial peptide Gm-H against Fusarium graminearum was designed. By fusing six histidine tags to the C-terminus of the alfalfa-derived antimicrobial peptide GMA4CG_V6, a recombinant Pichia pastoris engineered strain G-Gm-H was constructed, achieving efficient secretory expression and direct application of the crude fermentation product.
Gm-H exhibits highly effective fungicidal activity against Fusarium graminearum, with a MIC lower than that of chemical pesticides. It also has good thermal stability, a simple fermentation process, reduces disease control costs, minimizes the risk of pesticide resistance, and promotes green and sustainable agricultural development.
Smart Images

Figure CN122302095A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural antifungal biological control technology, specifically an antimicrobial peptide variant Gm-H against Fusarium graminearum and its application. Background Technology
[0002] Fusarium graminearum (Fg) is a globally distributed plant pathogenic fungus with a wide host range, infecting many important food crops such as wheat, corn, and rice, causing major plant diseases such as Fusarium head blight and stem rot. This disease not only leads to a significant drop in crop yield, typically by 10%-30%, and in severe cases exceeding 50%, but also induces Fusarium graminearum to produce toxic secondary metabolites such as vomitoxin (DON) and zearalenone (ZEN). These toxins can accumulate through the food chain, seriously threatening the health and safety of humans and livestock. Currently, the main method for controlling Fusarium graminearum in agricultural production still relies on chemical pesticides. However, the long-term irrational use of these pesticides not only easily induces drug-resistant strains of Fusarium graminearum, but also causes pollution of the soil, water bodies, and other ecological environments, and leads to excessive pesticide residues in agricultural products, which contradicts the development concepts of modern green and ecological agriculture.
[0003] Antimicrobial peptides (AMPs) are a class of small molecule polypeptides widely found in animals, plants, and microorganisms. They possess broad-spectrum antimicrobial activity, and their antimicrobial mechanisms mainly include disrupting the cell membrane integrity of pathogens, interfering with intracellular metabolic processes, and inhibiting nucleic acid and protein synthesis. These mechanisms differ fundamentally from those of traditional chemical pesticides, making them less likely to induce drug resistance in pathogens. Furthermore, they offer significant advantages such as good environmental compatibility, easy degradation, and no residue, making them ideal candidate bioactive substances to replace traditional chemical pesticides. Among them, the antimicrobial peptide GMA4CG_V6 (Gm) derived from alfalfa (Medicago truncatula) has been proven to have certain antimicrobial activity against Botrytis cinerea.
[0004] However, existing technologies face several challenges, including poor salt tolerance of natural antimicrobial peptides, easy loss of activity in high-salt Pichia pastoris fermentation systems, the need for complex purification processes after fermentation before application, high production costs, increasing resistance of Fusarium graminearum to chemical pesticides, and a lack of green control agents. Summary of the Invention
[0005] The purpose of this invention is to provide an antimicrobial peptide variant Gm-H against Fusarium graminearum and its application, in order to solve the problems mentioned above.
[0006] The technical solution adopted in this invention is as follows: an antimicrobial peptide variant Gm-H against Fusarium graminearum, characterized in that: the antimicrobial peptide variant Gm-H is prepared by C-terminal fusion modification of alfalfa-derived antimicrobial peptide GMA4CG_V6 (abbreviated as Gm);
[0007] Specifically, a histidine tag consisting of six consecutive histidine residues is fused to the C-terminus of Gm;
[0008] The amino acid sequence of the antimicrobial peptide GMA4CG_V6 is shown in SEQ ID NO:1.
[0009] The amino acid sequence of the antimicrobial peptide variant Gm-H is shown in SEQ ID NO:2.
[0010] In a preferred embodiment, the nucleotide sequence encoding the antimicrobial peptide variant Gm-H is as follows:
[0011] GGTGGTAGATGTAAGGGTTTTAGAAGAAGATGGTTTTGGACTAGAATTTGTCATCATCATCATCATCAT.
[0012] In a preferred embodiment, a recombinant expression vector is constructed by cloning the gene encoding the antimicrobial peptide variant Gm-H as described in claim 2 into the expression frame of the pPIC9K vector using pPIC9K as the backbone vector, thereby obtaining the recombinant expression vector pPIC9K-Gm-H; the recombinant expression vector contains the encoding gene as described in claim 2.
[0013] In a preferred embodiment, a recombinant Pichia pastoris engineered strain is obtained by integrating a recombinant expression vector into the genome of Pichia pastoris GS115 through homologous recombination, and the recombinant Pichia pastoris engineered strain is screened and named GS115-Gm-H (abbreviated as G-Gm-H).
[0014] In a preferred embodiment, the application of an antimicrobial peptide variant Gm-H against Fusarium graminearum is characterized in that the application includes preparation of an anti-Fusarium graminearum agent.
[0015] In a preferred embodiment, the antifungal agent against Fusarium graminearum uses the antimicrobial peptide variant Gm-H as the active ingredient in the biopesticide. It can be used alone as an active ingredient or in combination with other antifungal agents for the control of fungal diseases in crops.
[0016] In a preferred embodiment, the antimicrobial peptide variant Gm-H has a minimum inhibitory concentration (MIC) of 3 μM against Fusarium graminearum, which is superior to the antimicrobial activity of the chemical pesticide gentamicin (MIC of 6.6 μM).
[0017] In a preferred embodiment, an antifungal pesticide composition for Fusarium graminearum has an antimicrobial peptide variant Gm-H as its core active ingredient, and also contains one or more agriculturally acceptable carriers and adjuvants.
[0018] In a preferred embodiment, the additive includes at least one of emulsifier, dispersant, and stabilizer.
[0019] In a preferred embodiment, the application of the recombinant Pichia pastoris engineered strain in the production of the antimicrobial peptide variant Gm-H includes shaking flask fermentation and induced expression of the recombinant Pichia pastoris engineered strain using a BMGY-BMMY two-step induction culture system; after fermentation, the fermentation supernatant is collected by centrifugation to obtain the crude antimicrobial peptide containing Gm-H; the crude product has significant antimicrobial activity against Fusarium graminearum and can be used directly without further purification.
[0020] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:
[0021] 1. In this invention, the prepared antimicrobial peptide variant Gm-H has highly efficient bactericidal activity against Fusarium graminearum. Its MIC is lower than that of the commonly used chemical pesticide Jinmaitian. It also has the characteristics of fast antimicrobial action and excellent thermal stability. It can stably exert antimicrobial effects in the natural environment and has a significant effect on the control of crop diseases caused by Fusarium graminearum.
[0022] 2. In this invention, the recombinant Pichia pastoris engineered strain G-Gm-H constructed using the Pichia pastoris GS115 strain can achieve efficient secretion expression of Gm-H. The fermentation process is simple, and its crude fermentation product can be directly used for preventive spraying of wheat and other grain crops without the need for complex purification processes. It can significantly reduce the crop infection rate caused by Fusarium graminearum.
[0023] 3. In this invention, the prepared antimicrobial peptide variant Gm-H, as a bioactive substance, is not prone to inducing drug resistance in Fusarium graminearum, and has good environmental compatibility, is easily degradable, and leaves no pesticide residue. It can replace traditional chemical pesticides, effectively alleviate the industry problem of aggravated fungal drug resistance, promote green and sustainable agricultural development, and has broad application prospects. Attached Figure Description
[0024] Figure 1 This is a schematic diagram of PCR detection of engineered yeast strain G-Gm-H in this invention.
[0025] Figure 2 This is a schematic diagram of the Tricine-Tris-SDS-PAGE detection of the small peptide Gm-H secreted by the fermentation supernatant of the engineered bacteria G-Gm-H in this invention.
[0026] Figure 3This is a schematic diagram illustrating the control effect of Gm-H fermentation crude product on Fusarium graminearum disease in wheat in this invention.
[0027] Figure 4 This is a schematic diagram of HPLC and mass spectrometry detection of Gm-H purified by chemical synthesis in this invention.
[0028] Figure 5 This is a schematic diagram comparing the minimum inhibitory concentrations of pure Gm-H and the chemical pesticide Jinmaitan against Fusarium graminearum in this invention.
[0029] Figure 6 This is a schematic diagram illustrating the time-kinetic analysis of the antibacterial and bactericidal effect of pure Gm-H on Fusarium graminearum spores in this invention.
[0030] Figure 7 This is a schematic diagram illustrating the thermal stability analysis of the antibacterial and bactericidal effect of pure Gm-H on Fusarium graminearum spores in this invention. Detailed Implementation
[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0032] Reference Figure 1-7 ,
[0033] Example 1: Molecular design and construction of recombinant expression vector for the antimicrobial peptide variant Gm-H:
[0034] 1.1 Selection of prototype peptides:
[0035] The antimicrobial peptide GMA4CG_V6 (Gm) derived from alfalfa (Medicago truncatula) was selected as the prototype peptide. Its amino acid sequence is shown in SEQ ID NO:1. This prototype peptide has been shown to have certain antifungal activity, but it has poor salt tolerance and cannot adapt to high-salt fermentation systems.
[0036] 1.2 Variant Molecular Design:
[0037] Based on the amino acid sequence of the prototype peptide Gm, a C-terminal fusion modification strategy was employed to fuse six consecutive histidine residues (His-tag) to its C-terminus, constructing the antimicrobial peptide variant Gm-H. The introduction of the histidine tag enhances the salt tolerance of the peptide through charge interaction, while not disrupting the core antimicrobial domain of the prototype peptide, ensuring that its antimicrobial mechanism remains unaffected. The final amino acid sequence of the antimicrobial peptide variant Gm-H is shown in SEQ ID NO:2.
[0038] 1.3 Synthesis of coding genes and construction of recombinant expression vectors:
[0039] Based on the amino acid sequence of the antimicrobial peptide variant Gm-H and the codon bias of Pichia pastoris, its coding gene was optimized to ensure efficient transcription and translation in Pichia pastoris. The optimized coding gene nucleotide sequence is shown in SEQ ID NO:3. This coding gene was synthesized by Beijing Qingke Biotechnology Co., Ltd., and cloned into the pPIC9K vector using restriction endonucleases SnaBⅠ and NotⅠ to construct the recombinant cloning vector pPIC9K-Gm-H.
[0040] Example 2 Construction and high-copy screening of recombinant Pichia pastoris engineered strains
[0041] 2.1 Preparation of Pichia pastoris GS115 competent cells:
[0042] Pichia pastoris strain GS115 was streaked onto YPD solid medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar) for activation and incubated at 30 ℃ for 2 days. A single colony was picked and inoculated into 3 mL of YPD liquid medium and cultured overnight (16-18 h) with shaking at 30 ℃ and 220 rpm. The culture was then inoculated into 50 mL of YPD liquid medium at a 1:100 volume ratio and cultured with shaking until the OD value reached 0.6-0.8 (mid-logarithmic growth phase). The culture was cooled in an ice bath for 15 min, centrifuged at 4 ℃ and 1800 g for 10 min, and the supernatant was discarded. The cells were washed twice with pre-cooled sterile deionized water, then twice with pre-cooled 1M sorbitol solution. Finally, the cells were resuspended in 500 μL of pre-cooled 1M sorbitol solution and dispensed into 50 μL tubes. Store frozen at ℃ for later use.
[0043] 2.2 Electroconversion:
[0044] Take 1-8 μg of the linearized recombinant expression vector pPIC9K-Gm-H (linearized using SacⅠ restriction endonuclease), add it to 80 μL of Pichia pastoris GS115 competent cells, gently mix, and incubate on ice for 20 min. Transfer the mixture to a pre-chilled 0.2 cm electroporation cuvette, set the electroporation parameters to: voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω, and perform electroporation. Immediately after electroporation, add 1 mL of pre-chilled 1M sorbitol solution to the cuvette, gently mix, and incubate at 30 ℃ for 1 h to allow the cells to regain activity. Centrifuge at 4 ℃, 5000 g for 5 min, discard part of the supernatant, retain about 200 μL of bacterial culture, gently resuspend, and spread on MD solid medium (glucose 20 g / L, yeast nitrogen basal medium 13.4 g / L, biotin 4 × 10⁻⁶).-4 Incubate on 20 g / L agar (or 20 g / L agar) at 30℃ for 3-5 days and observe the growth of single colonies.
[0045] 2.3 Screening of high-copy engineered strains:
[0046] Single colonies on MD solid culture medium were rinsed with sterile physiological saline to prepare a bacterial suspension, and the OD of the bacterial suspension was adjusted. 600 The concentration was adjusted to 1.0; after serial dilution of the bacterial suspension, it was spread onto YPD solid medium containing 0.25-4.0 mg / mL G418 and incubated at 30 ℃ for 3-5 days; single colonies with good growth and regular morphology were picked from high G418 resistant (2.0-4.0 mg / mL G418) plates, inoculated into YPD liquid medium, and cultured with shaking. Genomic DNA was extracted from the bacteria, and PCR identification was performed to amplify the target fragment of the expected size (e.g., Figure 1 As shown in the figure, the recombinant expression vector has been successfully integrated into the Pichia pastoris GS115 genome, resulting in a high-copy recombinant Pichia pastoris engineered strain GS115-Gm-H (abbreviated as G-Gm-H).
[0047] like Figure 1 As shown
[0048] Lanes 1 and 2: PCR amplification products of empty vector pPIC9K;
[0049] Lane 3: Genomic PCR amplification product of the control strain (transformed into GS115 Pichia pastoris using pPIC9K empty vector);
[0050] Lane 6: Genomic PCR amplification product of recombinant engineered bacteria G-Gm-H (recombinant vector pPIC9K-Gm-H transformed into GS115);
[0051] The primer combination used for PCR amplification in this experiment was: AOX1 5' (5'-GACTGGTTCCAATTGACAAGC-3') and AOX1 3' (5'-GCAAATGGCATTCTGACATCC-3').
[0052] Note: Lanes 4, 5, 7, 8, 9, 10, 11, 12, and 13 are all PCR amplification samples of other engineered yeast genomes unrelated to this patent application.
[0053] Example 3: Fermentation expression of the antimicrobial peptide variant GM-H and detection of its antimicrobial activity in live plants:
[0054] 3.1 Shake-flask fermentation-induced expression:
[0055] Single colonies of the recombinant Pichia pastoris engineered strain G-Gm-H were picked and inoculated into 3 mL of BMGY medium (yeast extract 10 g / L, peptone 20 g / L, glycerol 10 g / L, yeast nitrogen basal medium 13.4 g / L, biotin 4×10⁻⁻⁻⁻⁶). 4 In a solution of (g / L), the culture was carried out at 30 ℃ and 220 rpm with shaking for 16-24 h to obtain the seed culture; the seed culture was then inoculated into 50 mL of BMGY medium at an inoculum rate of 1%, and the culture was continued with shaking until the bacterial OD of the culture was reached. 600 When the value reaches 6-10; centrifuge at 4 ℃, 5000 g for 10 min, discard the supernatant, and use an equal volume of BMMY induction medium (yeast extract 10 g / L, peptone 20 g / L, methanol 10 g / L, yeast nitrogen source basal medium 13.4 g / L, biotin 4×10⁻⁻⁻⁻⁶). 4 The bacterial cells were resuspended at 28 °C and 220 rpm with shaking for 4 days. Methanol was added to the culture medium every 24 h until the final concentration reached 1% to maintain the induced state. After fermentation, the culture was centrifuged at 4 °C and 8000 g for 15 min, and the fermentation supernatant was collected. SD-PAGE silver staining analysis confirmed the presence of Gm-H peptides (such as...) in the fermentation supernatant. Figure 2 As shown in the figure, the crude product of Gm-H fermentation is stored at 4 ℃ for later use.
[0056] like Figure 2 As shown
[0057] Lane 3: Fermentation supernatant of engineered yeast strain G-Gm-H; Lane 9: Fermentation supernatant of control yeast transformed with empty pPIC9K vector; Lanes 1, 2 and 4-8: Fermentation supernatant of other engineered yeast strains unrelated to this patent application; M: Protein molecular weight marker.
[0058] Note: The white arrows in the figure indicate the target small peptide bands detected in the fermentation supernatant of each yeast strain. The white arrow in lane 3 shows the antimicrobial peptide Gm-H specifically expressed in the fermentation supernatant.
[0059] 3.2 In vivo antibacterial activity of wheat from Gm-H fermentation crude products:
[0060] Select plump, disease-free wheat seeds, disinfect them with 75% ethanol for 30 seconds, rinse them 3-5 times with sterile water, soak them for 24 hours, and then place them in petri dishes lined with moist filter paper. Cultivate them in a light-controlled culture chamber (16 hours of light per day, 25 ℃, 70% humidity) for 10-15 days until the wheat seedlings reach a length of 5-8 cm. Select wheat seedlings with uniform growth for the experiment.
[0061] Three treatment groups were set up: the Gm-H fermentation crude product treatment group and the empty vector control group (GS115-pPIC9K recombinant strain fermentation supernatant). Each group had three biological replicates, with five wheat seedlings in each replicate to ensure the reliability of the experimental results.
[0062] Wheat seedlings were treated using a spray method. The corresponding solution (10 mL per plant) was evenly sprayed onto each treatment group. After 24 hours, all treatment groups were sprayed with a Fusarium graminearum spore suspension (concentration 1×10⁻⁶). 6 (2 mL per plant) to ensure spores are evenly attached to the surface of wheat seedling leaves; place the wheat seedlings in a light-incubated culture room for 30 days and observe the disease status of the wheat seedlings regularly.
[0063] The disease infection rate of wheat seedlings in each group was calculated (disease infection rate = number of infected plants / total number of plants × 100%). Figure 3 The results showed that the disease rate of wheat seedlings in the control group was 96.3%, with obvious lesions on the leaves and some plants wilting. In contrast, the disease rate of wheat seedlings in the Gm-H fermentation crude product treatment group decreased to 59.62%, with no completely wilted plants. The number and area of leaf lesions were significantly reduced, indicating that the Gm-H fermentation crude product has significant inhibitory activity against Fusarium graminearum and can be directly applied without further purification, thus greatly reducing production costs.
[0064] like Figure 3 As shown
[0065] Column 1: Wheat seedlings treated with supernatant from yeast fermentation using empty vector; Column 2: Wheat seedlings treated with supernatant from yeast G-Gm-H fermentation; Figure A: Phenotypic observation of treated plants; Figure B: Statistical data on plant disease incidence.
[0066] Example 4: Determination of the bactericidal effect of pure antimicrobial peptide Gm-H:
[0067] To further determine the antibacterial activity of Gm-H, the corresponding antimicrobial peptide was synthesized by Suzhou Bio-Aipai Biotechnology Co., Ltd. based on the amino acid sequence shown in SEQ ID NO.2. The purity of the peptide was >95%, as shown in the results. Figure 4 .
[0068] 4.1 Comparative analysis of the minimum inhibitory concentrations (MICs) of pure Gm-H and the chemical pesticide Jinmaitan against Fusarium graminearum:
[0069] The MICs of pure Gm-H and the chemical pesticide gentamicin against Fusarium graminearum were determined using a micro-broth dilution method combined with resazurin staining. Figure 5The results showed that the MICs of pure Gm-H and Jinmaitian against Fusarium graminearum were 3 μM and 6.6 μM, respectively. This indicates that the antimicrobial peptide Gm-H has a stronger antibacterial effect against Fusarium graminearum than the chemical pesticide Jinmaitian.
[0070] like Figure 5 As shown
[0071] A. Set different concentrations of ginsenosides and their concentrations at 1×10⁻⁶. 4 CFU / mL of Fusarium graminearum were co-incubated; CK1 was the control group incubated with Resveratrol test solution and blank culture medium, and CK2 was the blank control group of pathogens without added gentian.
[0072] B. Set different concentrations of Gm-H and their corresponding concentrations of 1×10⁻⁶. 4 CFU / mL of Fusarium graminearum were co-incubated; CK1 was the control group incubated with Resveratrol test solution and blank culture medium, and CK2 was the blank control group of pathogens without Gm-H.
[0073] All treatment groups were simultaneously incubated with resorcinol detection solution. Oxidized resorcinol is stable and blue in the system, and its color remains unchanged upon contact with dead fungal cells. However, upon contact with fungal cells exhibiting normal metabolic activity, it can be reduced by intracellular reducing substances to form red resorufin. As the reduction reaction intensifies, the system fades from red to colorless. Based on the gradual color change of resorcinol from blue to red and then to colorless, the color differences between each treatment group and the control group can be compared to quickly determine the metabolic activity of fungal cells, directly reflecting the growth and proliferation level of the pathogen, and thus determining the minimum inhibitory concentration (MIC) of the tested sample against Fusarium graminearum.
[0074] 4.2 Time-kinetic analysis of the antibacterial and bactericidal effect of pure Gm-H on Fusarium graminearum spores:
[0075] To determine the time required for the antimicrobial peptide Gm-H to initiate its bactericidal effect against Fusarium graminearum, this invention conducted a time-kinetic analysis of the bactericidal action of Gm-H against Fusarium graminearum. The experimental system used 1×SFM medium as the basic detection environment, with the concentration of the antimicrobial peptide Gm-H set at 3 μM and the final concentration of Fusarium graminearum spores set at 1×10⁻⁶. 6 The final concentration of propidium iodide (PI) fluorescent dye was set at 0.5 μg / mL; the control group consisted of 1×SFM medium without any added antimicrobial peptides. The experimental procedure is as follows:
[0076] 1) Dilute the antimicrobial peptide variant Gm-H to 6 μM with sterile water in a laminar flow hood;
[0077] 2) Prepare 2×10 at different time points in the clean bench 6 / mL of Fusarium graminearum spores were suspended in 2×SFM medium, and after mixing by pipetting, 50μL was placed in each sterile 1.5 mL EP tube. 50μL of the previously prepared 2×MIC antimicrobial peptide solution was added to the tube, and the tubes were allowed to stand at room temperature for time to observe the treatment effect.
[0078] 3) After 1 h, 2 h and 4 h of treatment, add fluorescent dye PI and incubate at room temperature for 15 minutes. Then centrifuge at 1500g for 7 min at room temperature, discard 60 μL of supernatant, and use a pipette to mix the remaining liquid and add it to the groove on a pre-cleaned biconcave slide. Cover with a coverslip, let stand for 1 min, and observe under a fluorescence microscope. Bright field mode is used to observe the location and number of spores, and fluorescence mode is used to observe the presence or absence of signal.
[0079] 4) Count the spores exhibiting fluorescent signals. The formula for calculating the spore mortality rate is:
[0080] Spore mortality rate (%) = Number of spores with obvious red fluorescent signal / Total number of observed spore cells × 100%. Spore count is based on 50.
[0081] like Figure 6 As shown
[0082] A. Fluorescence microscopy observation of dead Fusarium graminearum spores: Propidium iodide (PI) is a nucleic acid fluorescent dye. The cell membrane of living cells acts as a permeability barrier to PI. When spores die and the cell membrane integrity is damaged, PI can penetrate the damaged cell membrane and enter the cell, specifically binding to genomic DNA and emitting a red fluorescent signal. The blue circles in the figure indicate individual spores observed under a microscope. After treating spores with Gm-H for 1 h, 2 h, and 4 h, the spore killing rate can be quantitatively calculated by counting the number of spores exhibiting red fluorescence in the field of view. The blank control group (CK) represents the microscopic observation results after incubation for 4 h under the same conditions in a culture medium without Gm-H.
[0083] B. The effect of different treatment times on the killing efficiency of Fusarium graminearum spores.
[0084] 4.3 Thermal stability analysis of the antibacterial and bactericidal effects of pure Gm-H on Fusarium graminearum spores
[0085] Pure Gm-H was subjected to constant temperature treatment at 25 ℃, 50 ℃, 75 ℃, and 90 ℃ for 30 min, respectively. A treatment group was also established, stored at 25 ℃ for 7 days. Untreated pure Gm-H served as a control. The antibacterial activity of each group against Fusarium graminearum was detected using the micro-broth dilution method. The results showed no significant difference in antibacterial activity between the treated and untreated groups (P > 0.05), indicating that Gm-H possesses excellent thermal stability and can maintain its activity under extreme temperature conditions, making it suitable for agricultural applications in various climatic conditions.
[0086] like Figure 7 As shown
[0087] A. Pretreatment of 3 μM Gm-H at different temperatures for 30 min, followed by reaction with a concentration of 1×10⁻⁶. 4 Gm-H was co-incubated with *Fusarium graminearum* at CFU / mL. Observation of the color change in the resazurin chromogenic solution revealed no significant difference in the antibacterial activity of Gm-H against *Fusarium graminearum* after pretreatment at different temperatures, indicating that Gm-H possesses good thermostability. CK1 was the control incubated with resazurin chromogenic solution and blank medium, while CK2 was the negative control incubated with only *Fusarium graminearum* and resazurin chromogenic solution without the addition of Gm-H.
[0088] B. Store 3 μM Gm-H at room temperature (25 ℃) for different times, then react with 1×10 4 Co-incubation with CFU / mL Fusarium graminearum. Resazurin staining results showed that the antibacterial effect of Gm-H did not significantly decrease after different storage times at room temperature, confirming that Gm-H can stably maintain its biological activity under normal temperature storage conditions.
[0089] The amino acid sequence of SEQ ID NO:1 (antimicrobial peptide Gm) is as follows:
[0090] GGRCKGFRRRWFWTRIC
[0091] SEQ ID NO:2 (the amino acid sequence of the antimicrobial peptide variant Gm-H) is:
[0092] GGRCKGFRRRWFWTRICHHHHHH
[0093] SEQ ID NO:3 (the nucleotide sequence encoding the antimicrobial peptide variant Gm-H) is as follows:
[0094] GGTGGTAGATGTAAGGGTTTTAGAAGAAGATGGTTTTGGACTAGAATTTGTCATCATCATCATCATCAT.
[0095] In summary, the antimicrobial peptide variant Gm-H prepared in this invention exhibits highly efficient bactericidal activity against Fusarium graminearum, with a MIC lower than that of the commonly used chemical pesticide Jinmaitian. It also features rapid antimicrobial action and excellent thermal stability, allowing it to stably exert its antimicrobial effect in the natural environment and significantly control crop diseases caused by Fusarium graminearum.
[0096] In this invention, the recombinant Pichia pastoris engineered strain G-Gm-H constructed using the Pichia pastoris GS115 strain can achieve efficient secretion and expression of Gm-H. The fermentation process is simple, and its crude fermentation product can be directly used for preventive spraying of wheat and other grain crops without the need for complex purification processes. It can significantly reduce the crop infection rate caused by Fusarium graminearum.
[0097] In this invention, the prepared antimicrobial peptide variant Gm-H, as a bioactive substance, is not prone to inducing drug resistance in Fusarium graminearum, and has good environmental compatibility, is easily degradable, and leaves no pesticide residue. It can replace traditional chemical pesticides, effectively alleviate the industry problem of aggravated fungal drug resistance, promote green and sustainable agricultural development, and has broad application prospects.
[0098] It should be noted that, in this document, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the term "comprising" or any other variations thereof is intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.
[0099] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. An antimicrobial peptide variant Gm-H against Fusarium graminearum, characterized in that: The antimicrobial peptide variant Gm-H was prepared by C-terminal fusion modification using alfalfa-derived antimicrobial peptide GMA4CG_V6 (Gm for short) as the parent compound. Specifically, a histidine tag consisting of six consecutive histidine residues is fused to the C-terminus of Gm; The amino acid sequence of the antimicrobial peptide GMA4CG_V6 is shown in SEQ ID NO:
1. The amino acid sequence of the antimicrobial peptide variant Gm-H is shown in SEQ ID NO:
2.
2. The antimicrobial peptide variant Gm-H against Fusarium graminearum as described in claim 1, characterized in that: The nucleotide sequence encoding the antimicrobial peptide variant Gm-H is as follows: GGTGGTAGATGTAAGGGTTTTAGAAGAAGATGGTTTTGGACTAGAATTTGTCATCATCATCATCATCAT.
3. A recombinant expression vector, characterized in that: Using pPIC9K as the backbone vector, the gene encoding the antimicrobial peptide variant Gm-H as described in claim 2 was cloned into the pPIC9K vector expression cassette to construct the recombinant expression vector pPIC9K-Gm-H; the recombinant expression vector contains the encoding gene as described in claim 2.
4. A recombinant Pichia pastoris engineered strain, characterized in that: The recombinant expression vector described in claim 3 was integrated into the genome of Pichia pastoris GS115 through homologous recombination, and a recombinant Pichia pastoris engineered strain was obtained by screening and named GS115-Gm-H.
5. The application of an antimicrobial peptide variant Gm-H against Fusarium graminearum, characterized in that: The applications include the preparation of antifungal agents against Fusarium graminearum.
6. The application of the antimicrobial peptide variant Gm-H against Fusarium graminearum as described in claim 5, characterized in that: The antifungal agent against Fusarium graminearum uses the antimicrobial peptide variant Gm-H as the active ingredient in the biopesticide. It can be used alone as an active component or in combination with other antifungal agents for the control of fungal diseases in crops.
7. The application of the antimicrobial peptide variant Gm-H against Fusarium graminearum as described in claim 5, characterized in that: The antimicrobial peptide variant Gm-H has a minimum inhibitory concentration (MIC) of 3 μM against Fusarium graminearum, which is superior to the antimicrobial activity of the chemical pesticide Jinmaitan (MIC of 6.6 μM).
8. A pesticide composition against Fusarium graminearum, characterized in that: The active ingredient is the antimicrobial peptide variant Gm-H as described in claim 1, and it also contains one or more of agriculturally acceptable carriers and adjuvants.
9. The pesticide composition against Fusarium graminearum as described in claim 8, characterized in that: The additives include at least one of emulsifiers, dispersants, and stabilizers.
10. The application of the recombinant Pichia pastoris engineered strain as described in claim 4 in the production of the antimicrobial peptide variant Gm-H, characterized in that: The recombinant Pichia pastoris engineered strain was subjected to shake-flask fermentation and induced expression using the BMGY-BMMY two-step induction culture system. After fermentation, the fermentation supernatant was collected by centrifugation to obtain the crude antimicrobial peptide containing Gm-H. The crude product showed significant antimicrobial activity against Fusarium graminearum and could be used directly without further purification.