A method for enhancing the antitumor efficacy of t cells

By overexpressing CD2 in T cells to optimize IS morphology, and by expressing or fusing chimeric antigen receptor CAR with exogenous CD2 in parallel, the problem of limited efficacy caused by T cell dysfunction was solved, the antitumor efficacy and antigen sensitivity of T cells were enhanced, and higher antitumor activity and proliferation potential were achieved.

CN122303149APending Publication Date: 2026-06-30BEIJING CHANGPING LAB

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING CHANGPING LAB
Filing Date
2024-12-31
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In existing adoptive T-cell therapies, T-cell dysfunction leads to limited long-term efficacy. Artificially constructed chimeric antigen receptor-mediated immune synapses (IS) are unstable and cannot guarantee the maintenance of activation signals and the orderly release of perforin and granzymes.

Method used

By overexpressing CD2 to optimize immune synapse (IS) morphology, enhance the durable antitumor efficacy of T cells and improve antigen sensitivity, we designed chimeric antigen receptor (CAR) parallel expression or fusion proteins with exogenous CD2, including extracellular, transmembrane and intracellular regions, to recognize tumor antigens and activate signal transduction.

Benefits of technology

It enhances the antitumor efficacy and antigen sensitivity of T cells, strengthens their affinity for tumor cells, reduces non-cytotoxic contact, and improves their in vitro and in vivo antitumor activity and proliferation potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303149A_ABST
    Figure CN122303149A_ABST
Patent Text Reader

Abstract

This invention relates to a method for enhancing the antitumor efficacy of T cells. The invention provides a cell comprising a chimeric antigen receptor (CAR) and exogenous CD2, wherein: 1) the exogenous CD2 comprises an extracellular region, a transmembrane region, and an intracellular region, for example, comprising the full-length CD2 protein; 2) the exogenous CD2 and the chimeric antigen receptor (CAR) are expressed in parallel; and / or 3) the exogenous CD2 and the chimeric antigen receptor (CAR) are a fusion protein. The invention also provides a method for preparing said cells, pharmaceutical compositions comprising said cells, kits, and their use in the treatment of tumors. The cells of the present invention exhibit higher antitumor activity and proliferative potential, as well as better antigen sensitivity, thereby enhancing the efficacy of cell therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cell immunotherapy technology, and in particular to a method for optimizing immune synapse (IS) morphology, enhancing the durable antitumor efficacy of adoptive T cells, and improving antigen sensitivity by overexpressing CD2, as well as the cells prepared or modified therefrom and their uses. Background Technology

[0002] Adoptive T-cell therapy has achieved significant success in treating hematologic malignancies, but its long-term efficacy is limited by T-cell dysfunction. Immune synapses (IS) are crucial for T-cell function and differentiation. TCR-mediated IS are stable and ordered concentric ring structures containing various adhesion receptors, co-stimulatory or co-inhibitory receptors, enabling T cells to maintain effective activation signals and ensuring the orderly release of perforin and granzymes. In contrast, artificially constructed chimeric antigen receptor-mediated IS are disordered and unstable, underutilizing adhesion and co-stimulatory receptors, and failing to maintain activation signals or ensure the orderly release of perforin and granzymes. Summary of the Invention

[0003] The inventors discovered that CD2 expression on the surface of T cells gradually decreases with differentiation, and its expression level is closely related to the quality of immune system (IS) and anti-tumor function. Furthermore, their work also confirmed that the loss of the CD58-CD2 axis is one of the mechanisms of tumor immune escape. Based on these findings, the inventors designed chimeric antigen receptor-modified T cells that overexpress CD2, thereby improving the quality of IS and enhancing the anti-tumor efficacy of T cells by improving the function of the CD2-CD58 axis.

[0004] Some aspects of this invention aim to address the problem of limited long-term efficacy caused by T cell dysfunction in existing adoptive T cell therapies by optimizing IS morphology through CD2 overexpression, thereby enhancing the durable antitumor efficacy of T cells and improving antigen sensitivity.

[0005] Some aspects of this invention include the invention described in the following items.

[0006] 1. A cell comprising a chimeric antigen receptor (CAR) and exogenous CD2, wherein:

[0007] 1) Exogenous CD2 contains extracellular, transmembrane, and intracellular regions, such as the full-length CD2 protein;

[0008] 2) Parallel expression of exogenous CD2 and chimeric antigen receptor CAR; and / or

[0009] 3) The exogenous CD2 and chimeric antigen receptor CAR are fusion proteins.

[0010] 2. The cells described in Project 1, wherein:

[0011] 1) Chimeric antigen receptors (CARs) contain an antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain;

[0012] 2) The fusion protein contains a 2A sequence, an internal ribosome entry site (IRES), a linker, and / or a protease cleavage site;

[0013] 3) Chimeric antigen receptor (CAR) recognizes tumor antigens;

[0014] 4) The cells include lymphocytes, such as T cells; and / or

[0015] 5) The cells have improved immune synaptic morphology, enhanced antitumor efficacy and / or increased antigen sensitivity.

[0016] 3. The cells described in item 1 or 2, wherein:

[0017] 1) The intracellular signal transduction domain of the chimeric antigen receptor (CAR) includes a co-stimulatory signal transduction domain;

[0018] 2) The antigen-binding domain of a chimeric antigen receptor (CAR) is an antibody or its antigen-binding fragment, such as scFv, for example, CD19 scFv;

[0019] 3) The transmembrane domain of the chimeric antigen receptor (CAR) is derived from a transmembrane polypeptide;

[0020] 4) Chimeric antigen receptors (CARs) contain signal peptides;

[0021] 5) Chimeric antigen receptors (CARs) contain a hinge region;

[0022] 6) The target antigens of the antigen-binding domain in chimeric antigen receptor (CAR) are selected from: CD19, CD20, epidermal growth factor receptor (EGFR), CD22, CD23, CD28, CD30, CD33, CD35, CD38, CD40, CD42c, CD43, CD44, CD44v6, CD47, CD49D, CD52, CD53, CD56, CD70, CD72, CD73, CD74, CD79A, CD79B, CD80, CD82, CD85A, CD85B, CD85D, CD85H, CD85K, CD96, CD107a, CD112, CD115, CD117, CD120b , CD123, CD146, CD148, CD155, CD185, CD200, CD204, CD221, CD271, CD276, CD279, CD280, CD281, CD301, CD312, CD353, CD362, BCMA, CD16V, CLL-1, Igκ, T RBC1, TRBC2, CKLF, CLEC2D, EMC10, EphA2, FR-a, FLT3LG, FLT3, Lewis-Y, HLA-G, ICAM5, IGHA1 / IgA1, IL-1RAP, IL-17RE, IL-27RA, MILR1, MR1, PSCA, PTC RA, PODXL2, PTPRCAP, ULBP2, AJAP1, ASGR1, CADM1, CADM4, CDH15, CDH23, CDHR5, CELSR3, CSPG4, FAT4, GJA3, GJB2, GPC2, GPC3, IGSF9, LRFN4, LRRN6A, L INGO1, LRRC15, LRRC8E, LRIG1, LGR4, LYPD1, MARVELD2, MEGF10, MPZLI1, MTDH, PANX3, PCDHB6, PCDHB10, PCDHB12, PCDHB13, PCDHB18, PCDHGA3, PEP, SGC B, Vezatin, DAGLB, SYT11, WFDC10A, ACVR2A, ACVR2B, Anaplastic Lymphoma Kinase, Cadmin 24, DLK1, GFRA2, GFRA3, EPHB2, EPHB3, EPHB4, EFNB1, EPOR, FGFR2, FGFR4, GALR2, GLG1, GLP1R, HBEGF, IGF2R, UNC5C, VASN, DLL3, FZD10, KREMEN2, TMEM169, TMEM198, NRG1, TMEFF1, ADRA2C, CHRNA1, CHRNB4, CHRNA3, CHRNG, DRD4, GABRB3GRIN3A, GRIN2C, GRIK4, HTR7, APT8B2, NKAIN1, NKAIN4, CACNA1A, CACNA1B, CACNA1I, CACNG8, CACNG4, CLCN7, KCNA4, KCNG2, KCNN3, KCNQ2, KCNU1, PKD1L 2. PKD2L1, SLC5A8, SLC6A2, SLC6A6, SLC6A11, SLC6A15, SLC7A1, SLC7A5P1, SLC7A6, SLC9A1, SLC10A3, SLC10A4, SLC13A5, SLC16A8, SLC18A1, SLC18A3, S LC19A1, SLC26A10, SLC29A4, SLC30A1, SLC30A5, SLC35E2, SLC38A6, SLC38A9, SLC39A7, SLC39A8, SLC43A3, TRPM4, TRPV4, TMEM16J, TMEM142B, ADORA2B, BAI1, EDG6, GPR1, GPR26, GPR34, GPR44, GPR56, GPR68, GPR173, GPR175, LGR4, MMD, NTSR2, OPN3, OR2L2, OSTM1, P2RX3, P2RY8, P2RY11, P2RY13, PTGE3, SS TR5, TBXA2R, ADAM22, ADAMTS7, CST11, MMP14, LPPR1, LPPR3, LPPR5, SEMA4A, SEMA6B, ALS2CR4, LEPROTL1, MS4A4A, ROM1, TM4SF5, VANGL1, VANGL2, C18orf1, GSGL1, ITM2A, KIAA1715, LDLRAD3, OZD3, STEAP1, MCAM, CHRNA1, CHRNA3, CHRNA5, CHRNA7, CHRNB4, KIAA1524, NRM.3, RPRM, GRM8, KCNH4, melanocortin 1 receptor, PT PRH, SDK1, SCN9A, SORCS1, CLSTN2, Endothelin-converting enzyme-like 1, Receptor lysophosphatase 2, LTB4R, TLR2, Neutrophilic tyrosine kinase 1, MUC16, B7-H4, ERBB2, HER3, EGFR variant III (EGFRvIII), HGFR, FOLR1, MSLN, CA-125, MUC-1, Prostate-specific membrane antigen (PSMA), Mesothelin, Epithelial cell adhesion molecule (EpCAM), L1-CAM, CEACAM1, CEACAM5, CEACAM6, VEGFR1, VEGFR2, High molecular weight melanoma-associated antigen (HMW-MAA), MAGE-A1,IL-13R-α2, disialialogangiosides (GD2 and GD3), tumor-associated carbohydrate antigens (CA-125, CA-242, Tn and sialyl-Tn), 4-1BB, 5T4, BAFF, carbonic anhydrase 9 (CA-IX), C-MET, CCR1, CCR4, FAP, fibronectin extradomain-B (ED-B), GPNMB, IGF-1 receptor, integrin α5β1, integrin αvβ3, ITB5, ITGAX, Embigin, PDGF-Rα, ROR1, multiligand glycan 1 TAG-72, tendinin C, TRAIL-R1, TRAIL-R2, NKG2D-ligand, major histocompatibility complex (MHC) molecules that present tumor-specific peptide epitopes, PR1 / HLA-A2, lineage-specific or tissue-specific tissue antigens, CD3, CD4, CD5, CD7, CD8, CD24, CD25, CD34, CD80, CD86, CD133, CD138, CD152, CD319, endoglin, and one or more of the following MHC molecules, such as the CD19 antigen;

[0023] 7) The 2A sequence of fusion proteins includes T2A, P2A, E2A, and F2A, such as T2A;

[0024] 8) The linkers for fusion proteins include the gly-ser-gly linker;

[0025] 9) The protease cleavage sites of the fusion protein include furin cleavage sites; and / or

[0026] 10) The cells include natural killer cells, cytotoxic T lymphocytes, and regulatory T cells.

[0027] 4. The cells described in any one of items 1-3, wherein:

[0028] 1) The intracellular signal transduction domains of chimeric antigen receptors (CARs) include signal transduction domains selected from any one or a combination of CD8, CD3ζ, CD3δ, CD3γ, CD3ε, FcγRI-γ, FcγRIII-γ, FcεRIβ, FcεRIγ, DAP10, DAP12, CD32, CD79a, CD79b, CD28, CD3C, CD4, b2c, 4-1BB, ICOS, CD27, CD28δ, CD80, NKp30, and OX40, for example, a signal transduction domain containing a combination of 4-1BB and CD3ζ;

[0029] 2) The transmembrane domains of chimeric antigen receptors (CARs) include the transmembrane domains of CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB, or GM-CSFR, such as the transmembrane domain of CD8α.

[0030] 3) Chimeric antigen receptor (CAR) signal peptides include signal peptides of CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB, or GM-CSFR, such as the CD8α signal peptide; and / or

[0031] 4) The hinge region of chimeric antigen receptor CAR includes the hinge regions of CD8α, IgG4, and CD4, such as the hinge region of CD8α.

[0032] 5. A nucleic acid construct or vector encoding both a chimeric antigen receptor (CAR) and exogenous CD2 as defined in any one of items 1 to 4.

[0033] 6. A method for preparing or modifying cells, the method comprising introducing either a chimeric antigen receptor CAR and exogenous CD2 as defined in any one of items 1 to 4 or a nucleic acid construct or vector as described in item 5 into cells to express both the chimeric antigen receptor CAR and exogenous CD2, thereby producing modified cells.

[0034] 7. The method described in Project 6, wherein:

[0035] 1) The cells described are primary cells;

[0036] 2) The cells are derived from the subject; and / or

[0037] 3) The cells mentioned are lymphocytes, such as T cells.

[0038] 8. A pharmaceutical composition comprising the cells described in any one of items 1 to 4 and optionally a pharmaceutically acceptable carrier or excipient.

[0039] 9. Use of the cells described in any one of Items 1 to 4, the nucleic acid construct or vector described in Item 5, the cells obtained by the method described in Item 6 or 7, and / or the pharmaceutical composition described in Item 8 in the preparation of a medicament for treating a tumor in a subject.

[0040] 10. The uses described in Item 9, wherein:

[0041] 1) The tumors mentioned include hematologic malignancies and solid tumors;

[0042] 2) The tumor expresses CD58;

[0043] 3) The tumors include lymphoma, leukemia, and multiple myeloma; and / or

[0044] 4) The tumors mentioned include central nervous system cancer, melanoma, thoracic cancer, lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head and neck cancer, colorectal cancer, prostate cancer, gynecological cancer, skin cancer, esophageal cancer, thyroid cancer, renal cell carcinoma, gastric cancer, hepatocellular carcinoma, bile duct cancer, and testicular cancer.

[0045] 11. A kit comprising the cells described in any one of items 1-4, the nucleic acid construct or vector described in item 5, reagents for performing the method described in any one of items 6-7, and / or the pharmaceutical composition described in item 8.

[0046] In some embodiments, the present invention provides a method for preparing or modifying cells such as T cells by overexpressing CD2, optimizing the IS morphology of T cells, enhancing their durable antitumor efficacy, and / or improving antigen sensitivity. In some embodiments, the methods described herein can be in vivo, in vitro, or ex vivo methods. In some embodiments, the methods described herein can include activating, modifying, and expanding cells originally obtained or isolated from a subject.

[0047] In some embodiments, the method of the present invention may include one or more of the following steps: 1) introducing the CD2 gene into T cells through genetic engineering technology to achieve CD2 overexpression; 2) using CD2-overexpressing T cells to enhance affinity with tumor cells, reduce non-cytotoxic contact, and improve antigen sensitivity by optimizing IS morphology; 3) verifying the antitumor efficacy of CD2-overexpressing T cells in in vitro and in vivo models, including cytotoxicity, cytokine secretion, persistence, and proliferation potential.

[0048] As those skilled in the art will know, the CD2 molecule, also known as LFA-2 or Len-5, is a transmembrane glycoprotein molecule belonging to the Ig gene superfamily. The CD2 family of proteins also includes molecules such as CD48, CD58, CD244, Ly-9, and CD150.

[0049] In this document, "exogenous CD2" is used as a term relative to endogenous CD2 molecules and can include the introduction of a heterologous CD2 molecule into cells that express or do not express endogenous CD2 molecules by any means, resulting in expression or increased expression levels in those cells (sometimes referred to herein as overexpression). In some embodiments, exogenous CD2 comprises an extracellular region, a transmembrane region, an intracellular region, or a functional fragment or variant thereof, or any combination of functional regions, functional fragments or variants thereof. Methods for modifying or altering functional regions or domains of a protein while preserving its function or enhancing its activity are known in the art. In some embodiments, the exogenous CD2 of the present invention preferably comprises an extracellular region, a transmembrane region, and an intracellular region, for example, it may comprise the full-length CD2 protein. In some embodiments, exogenous CD2 can be introduced into and expressed in target cells by various methods known in the art, for example, expression driven by a constitutive promoter.

[0050] In some implementations, exogenous CD2 and chimeric antigen receptor CAR are expressed in parallel in the target cells. In other implementations, exogenous CD2 and chimeric antigen receptor CAR are not expressed in tandem in the target cells.

[0051] In this paper, "parallel expression" and "tandem expression" refer to different mechanisms of action of exogenous CD2 and chimeric antigen receptor CAR in target cells. For example, "parallel expression" of exogenous CD2 and chimeric antigen receptor CAR means that they independently perform ligand binding and signal transduction functions in target cells, while "tandem expression" means that exogenous CD2 and chimeric antigen receptor CAR function in a common signal transduction pathway in target cells, such as by the chimeric antigen receptor CAR binding to tumor antigens, thereby transmitting signals into the cell and activating the co-stimulatory signal of chimeric antigen receptor CAR and CD2. In "tandem expression," the intracellular signal transduction domain of CD2 is usually fused with the signal transduction domain of CAR (e.g., CD3-ζ signal transduction domain and co-stimulatory domain such as 4-1BB) and co-expressed in the same signal transduction pathway. In some embodiments, the present invention does not include the above-described form of "tandem expression" of exogenous CD2 and chimeric antigen receptor CAR. In some embodiments, the exogenous CD2 and chimeric antigen receptor CAR of the present invention are expressed in "parallel" form in target cells in their respective independent signal transduction pathways. In some embodiments, "parallel expression" can be achieved by including a self-cleaving peptide (e.g., a 2A sequence, such as T2A, P2A, E2A, and F2A), an internal ribosome entry site (IRES), and / or a protease cleavage site (e.g., a furin cleavage site) or its coding sequence in the fusion protein of the CAR and CD2 molecule or its coding sequence. In some embodiments, exogenous CD2 and chimeric antigen receptor CAR (or their coding sequences) are introduced into the target cell as a fusion protein (or its coding sequence), and then separated by protease cleavage, thereby functioning independently. In some embodiments, exogenous CD2 and chimeric antigen receptor CAR can be linked by a linker (e.g., a gly-ser-gly linker). In some embodiments, exogenous CD2 and chimeric antigen receptor CAR can be introduced into the target cell via one or more nucleic acid constructs or vectors containing their coding sequences. In some implementations, the nucleic acid encoding exogenous CD2 (e.g., full-length CD2 or any one or more of its domains, such as extracellular, transmembrane, and intracellular regions) and the nucleic acid encoding a chimeric antigen receptor CAR (e.g., full-length CAR or any one or more of its domains, such as antigen-binding, transmembrane, and intracellular signaling domains) can be present as monocistronic, bicistronic, or polycistronic nucleic acids. In the nucleic acid constructs or vectors encoding exogenous CD2 (or one or more of its domains) and / or chimeric antigen receptor CAR (or one or more of its domains), the coding sequences can be separated by sequences of one or more signal peptides, one or more self-cleaving peptides, one or more internal ribosome entry sites (IRES), and / or one or more protease cleavage sites.In some implementations, nucleic acid constructs or vectors encoding exogenous CD2 (or one or more of its domains) and / or chimeric antigen receptor CAR (or one or more of its domains) can express CAR and CD2 molecules in parallel after being introduced into cells.

[0052] In some embodiments, the chimeric antigen receptor CAR is not particularly limited and may include any suitable CAR known in the art. In some embodiments, the chimeric antigen receptor CAR may include an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the antigen-binding domain may include an antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody) or an antigen-binding fragment thereof, such as Fab, Fab', F(ab')2, Fv fragments, scFv, sdFv, Fd, linear antibodies, single-domain antibodies such as sdAb, camel VHH domain, etc. The antigen-binding domain may target antigens, such as tumor antigens, and any one or more antigens described herein.

[0053] Some aspects of the present invention provide a kit that may include an effective amount of the cells, nucleic acid constructs or vectors described herein, reagents for performing the methods described herein, and / or pharmaceutical compositions described herein. In the composition or kit, cells may be mixed with a solution such as an aqueous solution to prepare a non-frozen or cryopreserved formulation and may contain additional cytotoxic agents or other therapeutic agents. In some embodiments, pharmaceutically acceptable carriers, buffers, stabilizers, and / or preservatives may be added to the cryopreservation solution or aqueous preservation solution. In some embodiments, the kit may include sterile containers, such as boxes, vials, tubes, bags, or other suitable container forms known in the art, which may be made of plastic, glass, paper, metal foil, or other materials suitable for containing reagents or pharmaceuticals and may have one or more, for example, may include multiple containers each containing different reagents. In some embodiments, the kit may include instructions for use of the reagents or pharmaceuticals, which may describe methods of using the reagents or pharmaceuticals and / or indications, etc. In some embodiments, the kit may include various reagents for performing the cell modification methods described herein, including, for example, chimeric antigen receptor CARs, exogenous CD2, nucleic acid constructs and / or vectors, and cell transduction, transformation, or transfection reagents and / or devices for introducing them into cells. Methods for performing cell modification are known in the art, for example, by transforming cells with recombinant DNA. In some embodiments, nucleic acid constructs and / or vectors may include, for example, viral and nonviral vectors, including, for example, retroviruses, adenoviruses, lentiviruses, adeno-associated virus vectors, vaccinia virus, papillomavirus, herpesvirus, and EB virus. In some embodiments, methods for performing cell modification may include direct co-culture of cells with production cells, administration of nucleic acids in the presence of lipid transfection, microinjection, in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion, etc. In some embodiments, constructs and / or vectors may include regulatory elements, introns, promoters, enhancers, etc. In some embodiments, the promoter can be endogenous or exogenous, including, for example, the elongation factor (EF)-1 promoter, CMV promoter, SV40 promoter, PGK promoter, long terminal repeat (LTR) promoter, metallothionein promoter, etc. In some embodiments, the promoter is an inducible promoter, including, for example, the TRE promoter, CD69 promoter, CD25 promoter, IL-2 promoter, IL-12 promoter, p40 promoter, Bcl-xL promoter, etc. Some aspects of the present invention provide methods for treating tumors with cells, nucleic acid constructs or vectors, compositions, kits, etc., as described herein, or their use in tumor treatment. The cells, nucleic acid constructs or vectors, compositions, kits, described herein, can be used to treat tumors in subjects, such as hematologic malignancies and solid tumors.In some embodiments, the cell or pharmaceutical composition may be administered intravenously once or more. In some embodiments, the subject is not particularly limited and may include humans or other mammals, such as monkeys, horses, cattle, dogs, cats, mice, rats, and pigs. In some embodiments, the subject's tumor includes a tumor expressing CD58. A tumor expressing CD58 can be identified by any method known in the art, such as detecting the presence and / or amount of CD58 nucleic acid and / or protein in a tumor sample. In some embodiments, the subject's tumor includes tumors known in the art that express CD58. In some embodiments, the tumor may include lymphoma, leukemia, multiple myeloma, central nervous system cancer, melanoma, thoracic cancer, lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head and neck cancer, colorectal cancer, prostate cancer, gynecological cancer, skin cancer, esophageal cancer, thyroid cancer, renal cell carcinoma, gastric cancer, hepatocellular carcinoma, cholangiocarcinoma, testicular cancer, etc. In some embodiments, the tumor may include any one or more of the above-mentioned tumors expressing CD58.

[0054] The experimental results of this invention show that, compared with conventional T cells, CD2-overexpressing T cells exhibit higher anti-tumor activity and proliferative potential, as well as better antigen sensitivity, in both in vitro and in vivo models. This indicates that CD2 overexpression can be an effective strategy to enhance the efficacy of adoptive T cell therapy. Attached Figure Description

[0055] Figure 1 Schematic diagrams of the constructs of conventional CAR molecules, CAR molecules that integrate the intracellular activation domain of CD2 molecules in tandem (Tandem CD2-CAR19), and CAR molecules that express full-length CD2 in parallel (Dual CD2-CAR19), and their killing efficiency experimental results.

[0056] Figure 2 Schematic diagrams of constructs overexpressing CAR molecules, CD2 molecules, and CAR and CD2 molecules respectively, and experimental results of their killing efficiency.

[0057] Figure 3 Jurkat-T cells overexpressing CD2 and conventional chimeric antigen-modified cells were co-cultured with Raji cells labeled with cell traceviolet. The quality of immune synapse formation was evaluated by staining F-actin (red) using confocal microscopy.

[0058] Figure 4The results of co-culturing CD2-overexpressing T cells and conventional chimeric antigen-modified T cells with Nalm6 cells, and testing the affinity between T cells and Nalm6 cells using a dynamic ultrasonic biomechanical testing platform (Z-Movi).

[0059] Figure 5 The experiment involved co-culturing T cells overexpressing CD2 and conventional chimeric antigen-modified T cells with Nalm6 cells at a 1:1 ratio, and statistically analyzing the tumor-killing ability after each 24-hour co-culture cycle.

[0060] Figure 6 The results of the experiment were obtained by co-culturing T cells overexpressing CD2 and conventional chimeric antigen-modified T cells with Nalm6 cells at a ratio of 1:2, and detecting exhaustion-related markers on the surface of T cells after 3 rounds of co-culture.

[0061] Figure 7 This study presents the results of an in vivo tumor repetitive stimulation model constructed by multiple rounds of tail vein infusion of Nalm6-L cells overexpressing luciferase, and the detection of tumor burden using in vivo imaging in small animals.

[0062] Figure 8 The results of co-culturing CD2-overexpressing and conventional chimeric antigen-modified T cells with CD19-low-expressing Nalm6 cells at a ratio of 1:10, and the tumor-killing ability after 24 hours of co-culture were tested.

[0063] Figure 9 The study aimed to construct an in vitro heterogeneous tumor model by mixing three types of A431 cells with high, medium, and low EGFR expression in a 1:1:1 ratio. Then, T cells overexpressing CD2, CD2 extracellular domain overexpressing (CD2TL), and conventional chimeric antigen-modified T cells were co-cultured with the mixed A431 cells. The tumor-killing ability was then tested after 24 hours of co-culture.

[0064] Figure 10 An in vivo solid tumor model was constructed by subcutaneously transplanting A431 cells with low EGFR expression, and the experimental results of tumor burden were evaluated by measuring the subcutaneous tumor tissue. Detailed Implementation

[0065] Example 1: CD2 gene introduction: The CD2 gene was introduced into T cells via a viral vector to achieve stable high expression of CD2.

[0066] Lentiviral preparation

[0067] To produce lentiviruses, lipid nanoparticles Lipofectamine 3000 (L3000001, Invitrogen), 12 μg of the core plasmid, and viral packaging plasmids psPAX 9.6 μg and pMD2G 2.4 μg were added to opti-MEM (31985070, Gibco) and incubated at room temperature for 10–20 minutes. The mixture was then added dropwise to 293T cells in 10 cm culture dishes. After culturing at 37°C and 5% CO2 for 6 hours, the medium was replaced with 12 mL of complete medium (DMEM + 10% (v / v) FBS, Gibco). After 48 hours, 6 mL of complete medium was added. After 72 hours, the supernatant was collected, centrifuged at 2000 RPM for 10 minutes to remove debris, and stored at -80°C. CAR T cell preparation: Healthy human peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll (LTS1077-1, Tianjin Haoyang Biotechnology). T cells were activated using monoclonal antibodies against CD3 (OKT3, BioLegend) at 2 μg / mL and CD2 at 8 μg / mL (S20013B, BioLegend), and then in X-VIVO2 containing 10% fetal bovine serum (30067334, Gibco). 15 Cultured in medium (02-060Q, Lonza) for 48 hours. Activated T cells, virus, and lentivirus were then transfected with the enhancement reagent Envirus. TM -LV (30001-2-1, Engreen Biosystem) was added to a plate, centrifuged at 850g, 32℃ for 2 hours, the supernatant was removed, and X-VIVO was used with 10% fetal bovine serum (30067334, Gibco) and 300 U / mL recombinant human IL-2 (200-02, PeproTech). 15 Cultured in medium (02-060Q, Lonza) medium.

[0068] 1. Preparation of CAR molecules

[0069] like Figure 1 As shown, the CAR molecule comprises sequentially connected scFV, CD8a hinge and transmembrane domain, 4-1BB co-stimulatory domain, and CD3ζ activation domain. Its specific preparation method is as follows:

[0070] The CAR19-T2A-EGFP nucleotide sequence was synthesized from the whole genome, with the 5' end containing the BamHI restriction site GGATCC and the 3' end containing the SalI restriction site GTCGAC.

[0071] The full sequence of CAR19 (scFV, CD8a hinge and transmembrane domain, 4-1BB co-stimulatory domain, CD3ζ activation domain) is (SEQ ID NO:1):

[0072]

[0073] The T2A sequence is (SEQ ID NO:2):

[0074] ggaagcggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct

[0075] The EGFP sequence is (SEQ ID NO:3):

[0076] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[0077] The three sequences are directly ligated.

[0078] The synthesized CAR19-T2A-EGFP nucleotide sequence was then double-digested with BamHI and SALI restriction enzymes, and the gene sequence A carrying double sticky ends was obtained by gel extraction.

[0079] The original vector PLVX-EF1a-IRES-puro was purchased from Baienwei Biotechnology Co., Ltd., and double-digested with BamHI and SALI restriction enzymes. The gene sequence B carrying double sticky ends was obtained by gel extraction.

[0080] Gene sequences A and B were mixed in a 3:1 ratio, and ligated with T4 ligase at room temperature for 30 minutes. 10 μL of the product was then used for competent cell transformation. Three clones were selected for sequencing, and after confirmation of correct sequencing, the target CAR expression vector was obtained. CAR19 and CAR-EGFR were prepared using the above methods.

[0081] The downstream of each CAR molecule is linked to a T2A sequence to express GFP fluorescent protein, which is used for the sorting and analysis of CAR T cells.

[0082] 2. Preparation of Tandem CD2-CAR19 molecule

[0083] like Figure 1 As shown, the Tandem CD2-CAR molecule comprises, sequentially, scFV, a CD8a hinge and transmembrane domain, a 4-1BB co-stimulatory domain, a CD3ζ activation domain, and a CD2 intracellular domain. Its specific preparation method is as follows:

[0084] The CD2 intracellular domain sequence is (SEQ ID NO:4):

[0085] aaaaggaaaaaacagaggagtcggagaaatgatgaggagctggagacaagagcccacagagtagctactgaagaaaggggccggaagccccaccaaattccagcttcaacccctcagaatccagcaacttcccaacatcctcctccaccacctggtcatcgttcccaggcacct agtcatcgtcccccgcctcctggacaccgtgttcagcaccagcctcagaagaggcctcctgctccgtcgggcacacaagttcaccagcagaaaggcccgcccctccccagacctcgagttcagccaaaacctccccatggggcagcagaaaactcattgtccccttcctctaat

[0086] Based on the obtained CAR19 plasmid, homologous recombination technology was used to insert the CD2 intracellular domain sequence into the CD3ζ activation domain of the CAR19 molecule. After competent cell transformation, clones were selected and sequenced for verification, yielding the target Tandem CD2-CAR19 plasmid.

[0087] 3. Preparation of Dual CD2-CAR molecules

[0088] like Figure 1 As shown, the Dual CD2-CAR molecule comprises, sequentially, scFV, a CD8a hinge and transmembrane domain, a 4-1BB co-stimulatory domain, a CD3ζ activation domain, a T2A element, and CD2 linked together. Its specific preparation method is as follows:

[0089] The T2A sequence is SEQ ID NO:2 as described above.

[0090] The CD2 sequence is (SEQ ID NO:5):

[0091]

[0092] Based on the obtained CAR19 plasmid, the full-length CD2 sequence was ligated to the CD3ζ activation domain of the CAR19 molecule via a T2A element using homologous recombination technology. After competent cell transformation, clones were selected and sequenced for verification, yielding the target DualCD2-CAR plasmid. CAR19+CD2 and CAR-EGFR+CD2 were prepared using the above methods.

[0093] 4. Preparation of CD2 expression vector

[0094] like Figure 1 As shown, the CAR molecule comprises sequentially connected scFV, a CD8a hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ activation domain. Its specific preparation method is as follows:

[0095] The CD2 sequence is SEQ ID NO:5 above. The original PLVX-EF1a-IRES-puro vector was double-digested with BamHI and SALI restriction enzymes, and the gene sequence carrying double sticky ends was obtained by gel extraction.

[0096] The CD2 gene sequence and the original vector were mixed at a ratio of 3:1, and T4 ligase was added for ligation at room temperature for 30 minutes. Then, 10 μL of the product was used for competent cell transformation. Three clones were selected for sequencing, and after sequencing verification, the CD2 expression vector was obtained.

[0097] 5. Preparation of CAR-EGFR-CD2TL molecules

[0098] like Figure 1 As shown, the CAR-EGFR-CD2TL molecule comprises, sequentially, scFV, a CD8a hinge and transmembrane domain, a 4-1BB co-stimulatory domain, a CD3ζ activation domain, a T2A element, and a CD2 extracellular domain. Its specific preparation method is as follows:

[0099] The CD2 extracellular domain sequence is (SEQ ID NO:6):

[0100] atgagctttccatgtaaatttgtagccagcttccttctgattttcaatgtttcttccaaaggtgcagtctccaaagagattacgaatgccttggaaacctggggtgccttgggtcaggacatcaacttggacattcctagttttcaaatgagtgatgatattgacgatataaaatggga aaaaacttcagacaagaaaaagattgcacaattcagaaaagagaaagagactttcaaggaaaaagatacatataagctatttaaaaatggaactctgaaaattaagcatctgaagaccgatgatcaggatatctacaaggtatcaatatatgatacaaaaggaaaaaatgtgttggaaa aaatatttgatttgaagattcaagagagggtctcaaaaccaaagatctcctggacttgtatcaacacaaccctgacctgtgaggtaatgaatggaactgaccccgaattaaacctgtatcaagatgggaaacatctaaaactttctcagagggtcatcacacacaagtggaccaccagc ctgagtgcaaaattcaagtgcacagcagggaacaaagtcagcaaggaatccagtgtcgagcctgtcagctgtccagagaaaggtctggacatctatctcatcattggcatatgtggaggaggcagcctcttgatggtctttgtggcactgctcgttttctatatcaccaaaaggaaaaaa

[0101] Based on the obtained CAR-EGFR plasmid, the extracellular domain sequence was ligated to the CD3ζ activation domain of the CAR-EGFR molecule via a T2A element using homologous recombination technology. After competent cell transformation, clones were selected and sequenced for verification, yielding the target CAR-EGFR-CD2TL plasmid.

[0102] Experimental results

[0103] like Figure 1As shown, we constructed lentiviral expression plasmids for overexpressing conventional CAR molecules, tandemly integrated CD2 activation domains (Tandem CD2-CAR19), and parallel expression of full-length CD2 (Dual CD2-CAR19), respectively. After preparing the lentiviruses, T cells were infected. On day 8 after infection, the three types of T cells were co-cultured with wild-type Nalm6 and CD58 knockout Nalm6 cells, respectively. After 24 hours, the killing efficiency was assessed. The results showed that in the presence of CD58 on tumor cells, parallel overexpression of CD2 significantly improved the tumor-killing ability of T cells, while the strategy of tandemly integrating the CD2 activation domain had no significant effect on the antitumor efficacy of T cells. When CD58 was absent on tumor cells, parallel overexpression of CD2 did not improve the tumor-killing ability of T cells, while tandem integration of the CD2 activation domain significantly improved the antitumor efficacy of T cells.

[0104] like Figure 2 As shown, we constructed lentiviral plasmids that overexpressed CAR molecules, CD2 molecules, and both CAR and CD2 molecules, respectively. After preparing the lentiviruses, T cells were infected, and the expression levels of CAR and CD2 molecules on the surface of T cells were detected on day 5 post-infection. On day 8 post-infection, the three types of T cells were co-cultured with Nalm6 tumor cells, and the killing efficiency was detected after 24 hours. The results showed that simultaneous overexpression of CAR molecules and CD2 synergistically enhanced the tumor-killing ability of T cells; overexpression of CD2 alone produced almost no anti-tumor efficacy.

[0105] Example 2: Optimization of IS morphology: The changes in IS morphology when CD2-overexpressing T cells were co-cultured with tumor cells were observed using confocal microscopy.

[0106] After staining the target cells with CellTrace™ Violet (C34557, Thermo Scientific), 1×10 6Target cells were evenly seeded on glass culture dishes (801002, NEST) coated with 0.1% poly-L-lysine (P8920, Sigma-Aldrich). After complete attachment, an equal number of Jurkat-CAR T cells were added, and the cells were incubated at 37°C with 5% CO2 for 30 minutes. Subsequently, the cells were fixed with 4% formaldehyde solution (1.00496, Sigma-Aldrich) at room temperature for 10 minutes. Cells were washed 2-3 times with PBS and permeabilized with 0.5% Triton X-100 solution (93443, Sigma-Aldrich) for 5 minutes. After washing 2-3 times with PBS, 200 µL of prepared phalloidin (40734ES75, Yeasen) working solution was used to cover the cells on the coverslip, and the cells were incubated at room temperature in the dark for 30 minutes. After washing with PBS, fluorescence was observed under a confocal microscope (LSM 980) using TRITC excitation / emission filters (Ex / Em = 545 / 570 nm) and Violet excitation / emission filters (Ex / Em = 405 / 450 nm). To assess the formation of immune synapses, 30 conjugates (i.e., direct contact between effector cells and target cells (tumor cells)) were randomly selected from each culture dish. The polarization of immune synapses was reflected by statistically analyzing the ratio of the fluorescence intensity of F-actin at the conjugated interface to that at the unconjugated membrane.

[0107] like Figure 3 As shown, we co-cultured Jurkat-T cells overexpressing CD2 and conventionally chimeric antigen-modified cells with Raji cells labeled with Cell Trace Violet (C34557, Thermo Scientific). After 30 minutes of co-culture, we stained F-actin with rhodamine-labeled phalloidin (40734ES75, Yeasen) and used a confocal microscope (LSM 980) to statistically analyze the polarization of F-actin to evaluate the quality of immune synapse formation. The results showed that CD2 overexpression significantly increased the polarization of F-actin.

[0108] Example 3: Validation of antitumor efficacy: The antitumor efficacy of T cells overexpressing CD2 was evaluated through in vitro cytotoxicity experiments and in vivo animal models.

[0109] A certain number of tumor cells (Nalm6-GL 1×10) 5 A431 5×10 4Cells were seeded in 96-well plates, and appropriate numbers of CAR T cells were added according to different effector-to-target ratios for co-incubation. A negative control well was prepared using tumor cells (without CAR T cells). After a certain co-incubation period, the cells were removed, and the number of surviving tumor cells was analyzed by flow cytometry. The cytotoxicity% was calculated using the formula: Cytotoxicity% = (1 - treatment / negative control) × 100.

[0110] Nalm6-GL cells (5 × 10⁶ cells per mouse) 5 The cells were administered via tail vein injection to 4-6 week old female NPG mice (NOD.Cg-Prkdcscid Il2rgtm1 / Vst, Beijing Vitonda Biotechnology Co., Ltd.). All cells were adjusted to an appropriate concentration with PBS, and the injection volume for each mouse was 100 µl. Five days after tumor bearing, 2×10⁻⁶ cells were injected. 6 CAR T or NT cells were resuspended in PBS and injected into mice via tail vein. 5 × 10⁵ cells were injected via tail vein on days 7 and 12 after T cell infusion. 5 Nalm6-GL cells were re-stimulated with antigens to assess the sustained antitumor capacity of T cells. All animals were anesthetized with isoflurane gas, and tumor burden in vivo was monitored and quantified via BLI on the NightOwl II (LB 983, Berthold) platform. BLI data were analyzed using indiGO software (Berthold).

[0111] A431 cells with low EGFR expression (5 × 10⁶ cells per mouse) 5 Subcutaneous injection was administered to 4-6 week old female NPG mice (NOD.Cg-Prkdcscid Il2rgtm1 / Vst, Beijing Vitonda Biotechnology Co., Ltd.). Seven days after tumor implantation, 2×10⁻⁶ NPG was reinfused via the tail vein. 6 CAR-T or NT cells were used, and subcutaneous tumor volume was measured periodically to quantify and compare the antitumor efficacy of CD2-overexpressing CAR T cells and conventional CAR T cells. All animal experiments were conducted strictly in accordance with established animal use protocols. In mice, the allocation of experimental groups was kept blinded during treatment.

[0112] like Figure 4 As shown, we co-cultured CD2-overexpressing and conventional chimeric antigen-modified T cells with Nalm6 cells. Nalm6 cells were cultured to 70%-80% confluence and then prepared into 180×10⁶ cells using RPMI 1640 medium (11875093, Gibco). 6Single-cell suspensions of cells / ml were prepared. A microfluidic chip was embedded with 0.002% poly-L-lysine (P4707, Sigma-Aldrich), and 20 µL of the cell suspension was carefully drawn into the z-Movi ultrasonic mechanical testing platform analyzer. ® The cells were incubated in a Cell Avidity Analyzer (Lumicks) solution at 37°C for 2 hours in a drying incubator. Jurkat CAR T cells were stained with CellTrace™ Far Red (C34564, Thermo Scientific) before induction experiments, with 5 × 10⁶ cells... 6 Jurkat CAR T cells were introduced into a microfluidic chip and incubated for 5 minutes. After incubation, Jurkat cells were detached from the z-Movi system by applying ultrasonic and hydrodynamic forces. The data were analyzed using Ocean 1.2.8 and statistically evaluated using PrismGraphPad 9.4.1.

[0113] like Figure 5 As shown, we co-cultured CD2-overexpressing T cells and conventional chimeric antigen-modified T cells with Nalm6 cells at a 1:1 ratio, and statistically analyzed the tumor-killing ability after 24 hours of co-culture in each round. The results showed that the antitumor ability of conventional T cells decreased significantly after the 5th round of co-culture, while CD2-overexpressing T cells maintained a high level of antitumor ability.

[0114] like Figure 6 As shown, we co-cultured CD2-overexpressing T cells and conventional chimeric antigen-modified T cells with Nalm6 cells at a 1:2 ratio, and detected exhaustion-related markers on the surface of T cells after three rounds of co-culture. The results showed that CD2 overexpression significantly reduced the expression of exhaustion markers on T cells.

[0115] like Figure 7 As shown, we constructed an in vivo tumor repetitive stimulation model by repeatedly infusing Nalm6-GL cells overexpressing luciferase via tail vein. Using in vivo imaging of small animals to detect tumor burden, we found that T cells overexpressing CD2 had significantly stronger antitumor activity than conventional T cells.

[0116] like Figure 8 As shown, we co-cultured CD2-overexpressing T cells and conventional chimeric antigen-modified T cells with CD19-low-expressing Nalm6 cells at a ratio of 1:10, and then examined their tumor-killing ability after 24 hours of co-culture. The results showed that CD2 overexpression significantly enhanced the killing ability of T cells against tumor cells with low antigen density.

[0117] like Figure 9 As shown, we constructed an in vitro heterogeneous tumor model by mixing three types of A431 cells with high, medium, and low EGFR expression in a 1:1:1 ratio. We co-cultured the mixed A431 cells with CD2 overexpression, CD2 extracellular domain overexpression (CD2TL), and conventional chimeric antigen-modified T cells, and then examined their tumor-killing ability after 24 hours of co-culture. The results showed that CD2 overexpression significantly enhanced the killing ability of T cells against low antigen density tumor cells, and CD2 extracellular domain overexpression also partially enhanced the killing ability of T cells against low antigen density tumor cells.

[0118] like Figure 10 As shown, we constructed an in vivo solid tumor model by subcutaneously transplanting A431 cells with low EGFR expression. By measuring the tumor burden in the subcutaneous tumor tissue, we found that T cells overexpressing CD2 had significantly stronger antitumor activity than conventional T cells, while the efficacy enhanced by overexpressing the extracellular segment of CD2 was not very significant.

[0119] The antibodies used in the examples are shown in the table below:

[0120] Antigen Fluoro-chrome Clone Company Catalog # Dilu-tion CD28 Ultra-LEAF™ S20013B BioLegend 377804 2 μg / mL CD3 Ultra-LEAF™ OKT3 BioLegend 317326 2 μg / mL CD3 PerCP / Cyanine5.5 SK7 BioLegend 344808 1:50 EGFR AF488 EP38Y Abcam ab52894 1:250 PD-1 BV421 EH12.2H7 BioLegend 329920 1:50 LAG-3 PE / Cyanine7 11C3C65 BioLegend 369310 1:50 Tim-3 APC A18087E BioLegend 364804 1:50 CD39 BV421 A1 BioLegend 328214 1:50 Streptavidin PE BioLegend 405204 0.6 μg / mL Biotin-SP Unconjugated Polyclonal Jackson ImmunoResearch AB_2338565 1:200 CD2 APC / Cyanine7 RPA-2.10 BioLegend 300220 1:50 CD58 PE TS2 / 9 BioLegend 330928 1:50 Anti-G4S linker FITC B02H1 hys-bio GS-ARNC100 1:50 CD3 PE / Cyanine7 UCHT1 BioLegend 300420 1:50 CD4 FITC SK3 BioLegend 980802 1:50 CD4 PE SK3 BioLegend 980804 1:50 CD8 FITC SK1 BioLegend 980908 1:50 CD8 PE SK1 BioLegend 980902 1:50 CD8 APC / Cyanine7 SK1 BioLegend 344713 1:50 CD45RA FITC HI100 BioLegend 983002 1:50 CD45RA APC HI100 BioLegend 983004 1:50 CD62L APC DREG-56 BioLegend 980706 1:50 CTLA-4 BV421 BNI3 BioLegend 369606 1:50 B7-H3 PerCP / Cyanine5.5 MIH42 BioLegend 351010 1:50 EGFR AF647 AY13 BioLegend 352918 1:50 CD3 PerCP / Cyanine5.5 OKT3 BioLegend 317336 1:50 EGFR PE AY13 BioLegend 352904 1:50 CD19 PE / Cyanine7 HIB19 BioLegend 302216 1:50 CD19 PE HIB19 BioLegend 302208 1:50 CD2 APC RPA-2.10 BioLegend 300214 1:50 CD107a APC H4A3 BioLegend 328620 1:50 ROR1 PE 2A2 BioLegend 357803 1:50 IFN-γ APC 4S.B3 BioLegend 502512 1:50 Ki-67 PE Ki-67 BioLegend 350504 1:50

Claims

1. A cell comprising a chimeric antigen receptor (CAR) and exogenous CD2, wherein the exogenous CD2 comprises an extracellular region, a transmembrane region, and an intracellular region, such as comprising the full-length CD2 protein; and the exogenous CD2 and the chimeric antigen receptor (CAR) are expressed in parallel.

2. The cell of claim 1, wherein: 1) Chimeric antigen receptors (CARs) contain an antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain; 2) The exogenous CD2 and chimeric antigen receptor CAR are fusion proteins, which optionally contain a 2A sequence, an internal ribosome entry site IRES, an adapter, and / or a protease cleavage site; 3) Chimeric antigen receptor (CAR) recognizes tumor antigens; 4) The cells include lymphocytes, such as T cells; and / or 5) The cells have improved immune synaptic morphology, enhanced antitumor efficacy and / or increased antigen sensitivity.

3. The cell of claim 2, wherein: 1) The intracellular signal transduction domain of the chimeric antigen receptor (CAR) includes a co-stimulatory signal transduction domain; 2) The antigen-binding domain of a chimeric antigen receptor (CAR) is an antibody or its antigen-binding fragment, such as scFv, for example, CD19scFv; 3) The transmembrane domain of the chimeric antigen receptor (CAR) is derived from a transmembrane polypeptide; 4) Chimeric antigen receptors (CARs) contain signal peptides; 5) Chimeric antigen receptors (CARs) contain a hinge region; 6) The target antigens of the antigen-binding domain in chimeric antigen receptor (CAR) are selected from: CD19, CD20, epidermal growth factor receptor (EGFR), CD22, CD23, CD28, CD30, CD33, CD35, CD38, CD40, CD42c, CD43, CD44, CD44v6, CD47, CD49D, CD52, CD53, CD56, CD70, CD72, CD73, CD74, CD79A, CD79B, CD80, CD82, CD85A, CD85B, CD85D, CD85H, CD85K, CD96, CD107a, CD112, CD115, CD117, CD120b , CD123, CD146, CD148, CD155, CD185, CD200, CD204, CD221, CD271, CD276, CD279, CD280, CD281, CD301, CD312, CD353, CD362, BCMA, CD16V, CLL-1, Igκ, T RBC1, TRBC2, CKLF, CLEC2D, EMC10, EphA2, FR-a, FLT3LG, FLT3, Lewis-Y, HLA-G, ICAM5, IGHA1 / IgA1, IL-1RAP, IL-17RE, IL-27RA, MILR1, MR1, PSCA, PTC RA, PODXL2, PTPRCAP, ULBP2, AJAP1, ASGR1, CADM1, CADM4, CDH15, CDH23, CDHR5, CELSR3, CSPG4, FAT4, GJA3, GJB2, GPC2, GPC3, IGSF9, LRFN4, LRRN6A, L INGO1, LRRC15, LRRC8E, LRIG1, LGR4, LYPD1, MARVELD2, MEGF10, MPZLI1, MTDH, PANX3, PCDHB6, PCDHB10, PCDHB12, PCDHB13, PCDHB18, PCDHGA3, PEP, SGC B, Vezatin, DAGLB, SYT11, WFDC10A, ACVR2A, ACVR2B, Anaplastic Lymphoma Kinase, Cadmin 24, DLK1, GFRA2, GFRA3, EPHB2, EPHB3, EPHB4, EFNB1, EPOR, FGFR2, FGFR4, GALR2, GLG1, GLP1R, HBEGF, IGF2R, UNC5C, VASN, DLL3, FZD10, KREMEN2, TMEM169, TMEM198, NRG1, TMEFF1, ADRA2C, CHRNA1, CHRNB4, CHRNA3, CHRNG, DRD4, GABRB3GRIN3A, GRIN2C, GRIK4, HTR7, APT8B2, NKAIN1, NKAIN4, CACNA1A, CACNA1B, CACNA1I, CACNG8, CACNG4, CLCN7, KCNA4, KCNG2, KCNN3, KCNQ2, KCNU1, PKD1L 2. PKD2L1, SLC5A8, SLC6A2, SLC6A6, SLC6A11, SLC6A15, SLC7A1, SLC7A5P1, SLC7A6, SLC9A1, SLC10A3, SLC10A4, SLC13A5, SLC16A8, SLC18A1, SLC18A3, S LC19A1, SLC26A10, SLC29A4, SLC30A1, SLC30A5, SLC35E2, SLC38A6, SLC38A9, SLC39A7, SLC39A8, SLC43A3, TRPM4, TRPV4, TMEM16J, TMEM142B, ADORA2B, BAI1, EDG6, GPR1, GPR26, GPR34, GPR44, GPR56, GPR68, GPR173, GPR175, LGR4, MMD, NTSR2, OPN3, OR2L2, OSTM1, P2RX3, P2RY8, P2RY11, P2RY13, PTGE3, SS TR5, TBXA2R, ADAM22, ADAMTS7, CST11, MMP14, LPPR1, LPPR3, LPPR5, SEMA4A, SEMA6B, ALS2CR4, LEPROTL1, MS4A4A, ROM1, TM4SF5, VANGL1, VANGL2, C18orf1, GSGL1, ITM2A, KIAA1715, LDLRAD3, OZD3, STEAP1, MCAM, CHRNA1, CHRNA3, CHRNA5, CHRNA7, CHRNB4, KIAA1524, NRM.3, RPRM, GRM8, KCNH4, melanocortin 1 receptor, PT PRH, SDK1, SCN9A, SORCS1, CLSTN2, Endothelin-converting enzyme-like 1, Receptor lysophosphatase 2, LTB4R, TLR2, Neutrophilic tyrosine kinase 1, MUC16, B7-H4, ERBB2, HER3, EGFR variant III (EGFRvIII), HGFR, FOLR1, MSLN, CA-125, MUC-1, Prostate-specific membrane antigen (PSMA), Mesothelin, Epithelial cell adhesion molecule (EpCAM), L1-CAM, CEACAM1, CEACAM5, CEACAM6, VEGFR1, VEGFR2, High molecular weight melanoma-associated antigen (HMW-MAA), MAGE-A1,IL-13R-α2, disialialogangiosides (GD2 and GD3), tumor-associated carbohydrate antigens (CA-125, CA-242, Tn and sialyl-Tn), 4-1BB, 5T4, BAFF, carbonic anhydrase 9 (CA-IX), C-MET, CCR1, CCR4, FAP, fibronectin extradomain-B (ED-B), GPNMB, IGF-1 receptor, integrin α5β1, integrin αvβ3, ITB5, ITGAX, Embigin, PDGF-Rα, ROR1, multiligand glycan 1 TAG-72, tendinin C, TRAIL-R1, TRAIL-R2, NKG2D-ligand, major histocompatibility complex (MHC) molecules that present tumor-specific peptide epitopes, PR1 / HLA-A2, lineage-specific or tissue-specific tissue antigens, CD3, CD4, CD5, CD7, CD8, CD24, CD25, CD34, CD80, CD86, CD133, CD138, CD152, CD319, endoglin, and one or more of the following MHC molecules, such as the CD19 antigen; 7) The 2A sequence of fusion proteins includes T2A, P2A, E2A, and F2A, such as T2A; 8) The linkers for fusion proteins include the gly-ser-gly linker; 9) The protease cleavage sites of the fusion protein include furin cleavage sites; and / or 10) The cells include natural killer cells, cytotoxic T lymphocytes, and regulatory T cells.

4. The cell according to any one of claims 1-3, wherein: 1) The intracellular signal transduction domains of chimeric antigen receptors (CARs) include signal transduction domains selected from any one or a combination of CD8, CD3ζ, CD3δ, CD3γ, CD3ε, FcγRI-γ, FcγRIII-γ, FcεRIβ, FcεRIγ, DAP10, DAP12, CD32, CD79a, CD79b, CD28, CD3C, CD4, b2c, 4-1BB, ICOS, CD27, CD28δ, CD80, NKp30, and OX40, for example, a signal transduction domain containing a combination of 4-1BB and CD3ζ; 2) The transmembrane domains of chimeric antigen receptors (CARs) include the transmembrane domains of CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB, or GM-CSFR, such as the transmembrane domain of CD8α. 3) Chimeric antigen receptor (CAR) signal peptides include signal peptides of CD2, CD3δ, CD3ε, CD3γ, CD3ζ, CD4, CD8α, CD19, CD28, 4-1BB, or GM-CSFR, such as the CD8α signal peptide; and / or 4) The hinge region of chimeric antigen receptor CAR includes the hinge regions of CD8α, IgG4, and CD4, such as the hinge region of CD8α.

5. A nucleic acid construct or vector encoding both the chimeric antigen receptor CAR and exogenous CD2 as defined in any one of claims 1 to 4.

6. A method for preparing or modifying cells, the method comprising introducing either a chimeric antigen receptor CAR as defined in any one of claims 1 to 4 and exogenous CD2 or a nucleic acid construct or vector as described in claim 5 into cells to express both the chimeric antigen receptor CAR and exogenous CD2, thereby producing modified cells.

7. The method of claim 6, wherein: 1) The cells described are primary cells; 2) The cells are derived from the subject; and / or 3) The cells mentioned are lymphocytes, such as T cells.

8. A pharmaceutical composition comprising the cells as described in any one of claims 1 to 4 and optionally a pharmaceutically acceptable carrier or excipient.

9. Use of the cells of any one of claims 1 to 4, the nucleic acid construct or vector of claim 5, the cells obtained by the method of claim 6 or 7, and / or the pharmaceutical composition of claim 8 in the preparation of a medicament for treating a tumor in a subject.

10. The use as described in claim 9, wherein: 1) The tumors mentioned include hematologic malignancies and solid tumors; 2) The tumor expresses CD58; 3) The tumors include lymphoma, leukemia, and multiple myeloma; and / or 4) The tumors mentioned include central nervous system cancer, melanoma, thoracic cancer, lung cancer, ovarian cancer, breast cancer, pancreatic cancer, head and neck cancer, colorectal cancer, prostate cancer, gynecological cancer, skin cancer, esophageal cancer, thyroid cancer, renal cell carcinoma, gastric cancer, hepatocellular carcinoma, bile duct cancer, and testicular cancer.

11. A kit comprising the cells of any one of claims 1-4, the nucleic acid construct or vector of claim 5, a reagent for performing the method of any one of claims 6-7, and / or the pharmaceutical composition of claim 8.