Application of maize ZmTOC1 gene in regulating drought resistance of maize
By knocking out the ZmTOC1 gene in maize using CRISPR/Cas9 technology, the problem of the limited number of drought-resistant negative regulatory genes in maize was solved, which enhanced the drought resistance of maize and improved the survival rate and biomass of plants.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE SHENNONG LABORATORY
- Filing Date
- 2026-05-13
- Publication Date
- 2026-06-30
Smart Images

Figure CN122303259A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop genetics and breeding technology, and specifically relates to the application of a gene in regulating drought resistance in maize. Background Technology
[0002] corn( Zea mays Corn (L.) is one of the world's most important food, feed, and industrial raw material crops. Its yield and quality directly affect food security, agricultural economic development, and energy structure adjustment. my country is a major producer and consumer of corn, but arid and semi-arid regions account for more than 40% of its land area. Drought stress has become the primary abiotic stress factor restricting the stable increase of corn yield in my country. Under drought conditions, corn plants exhibit slow growth, leaf wilting, decreased photosynthetic efficiency, and reduced seed setting rate, leading to significant yield reductions or even crop failure in severe cases. Therefore, identifying drought-resistant genes in corn, elucidating their molecular regulatory mechanisms, and developing efficient drought-resistant improvement technologies are of significant theoretical and industrial application value for breeding drought-resistant corn varieties and ensuring food security.
[0003] Plant drought resistance is a complex trait regulated by multiple genes and pathways, involving multiple stages such as drought signal perception, transduction, response, and expression regulation of downstream functional genes. Drought-related genes can be divided into positive and negative regulators based on their function: positive regulators enhance plant drought resistance by activating drought-related pathways and promoting the synthesis of drought-resistant substances; while negative regulators weaken plant drought resistance by inhibiting the activation of drought-resistant pathways and reducing the plant's ability to respond to drought stress. Compared to positive regulators, the research and utilization of negative regulators have unique advantages—by knocking out or inhibiting the expression of negative regulators, their inhibitory effect on plant drought-resistant pathways can be quickly relieved, significantly enhancing the plant's drought-resistant phenotype, without seriously affecting normal plant growth and development. This is a highly efficient technical approach for breeding drought-resistant crop varieties.
[0004] With the rapid development of gene editing technology, CRISPR / Cas9 technology, due to its ease of operation, high editing efficiency, and strong targeting, has been widely applied in gene function research and genetic improvement of crops such as maize, rice, and wheat. Precisely knocking out drought-resistant negative regulatory genes in crops using CRISPR / Cas9 technology can rapidly create drought-resistant mutant materials, providing an efficient means for breeding drought-resistant crop varieties. However, the number of drought-resistant negative regulatory genes reported in maize is currently limited, and the regulatory mechanisms of most genes are still unclear, making it difficult to meet the actual needs of drought-resistant genetic improvement in maize. For example, patent 202410941854.3 discloses a maize drought-resistant negative regulatory factor. ZmIAA31 and its applications, ZmIAA31By influencing the antioxidant oxidase system to regulate the degree of cell membrane damage, drought resistance and root development in maize seedlings are ultimately negatively regulated. Therefore, further research into new maize drought-resistant genes, clarifying their drought-resistant regulatory mechanisms, and developing their applications in maize drought-resistant improvement to fill existing technological gaps have become urgent technical problems to be solved in the field of maize drought-resistant genetic improvement. Summary of the Invention
[0005] To solve the above-mentioned technical problems, the present invention proposes a corn ZmTOC1 Application of genes in regulating drought resistance in maize.
[0006] The technical solution of this invention is implemented as follows: On the one hand, this invention proposes a corn ZmTOC1 Application of genes in regulating drought resistance in maize.
[0007] Preferably, the above ZmTOC1 The coding region sequence of the gene is shown in SEQ ID NO:1.
[0008] Preferably, the above-mentioned regulation of drought resistance in maize is achieved by reducing or knocking out... ZmTOC1 Gene function enhances the drought resistance of maize.
[0009] Secondly, the present invention also provides a method for improving the drought resistance of corn, comprising the following steps: knocking out the corn plant's... ZmTOC1 Gene knockout, thereby improving the drought resistance of maize. Knockout is performed using CRISPR / Cas9 technology, with the knockout target site located in maize... ZmTOC1 The exon regions of a gene.
[0010] Preferably, the above ZmTOC1 The coding region sequence of the gene is shown in SEQ ID NO:1.
[0011] Thirdly, the present invention also provides a method for cultivating drought-resistant transgenic maize plants, the steps of which are as follows: (1) According to corn ZmTOC1 The coding region sequence of the gene was used to design target gRNA1 and gRNA2; (2) Design primer pairs for amplifying gRNA1 and gRNA2 respectively, and amplify gRNA1 and gRNA2 fragments; (3) The gRNA1 and gRNA2 fragments were ligated into the pBUE411 vector to construct a knockout vector, which was then transformed into the maize variety to be improved via Agrobacterium-mediated transformation. The positive plants obtained by screening were the drought-resistant transgenic maize plants. Maize plants with frameshift mutations and / or amino acid loss were positive plants and were used for the breeding of drought-resistant varieties.
[0012] Preferably, in step (1) aboveZmTOC1 The coding region sequence of the gene is shown in SEQ ID NO:1; the nucleotide sequence of gRNA1 is shown in SEQ ID NO:2; and the nucleotide sequence of gRNA2 is shown in SEQ ID NO:3.
[0013] Preferably, the primer pair for amplifying gRNA1 in step (2) above is gRNA1_ZmTOC1-F1 and gRNA1_ZmTOC1-F2, the sequence of gRNA1_ZmTOC1-F1 is shown in SEQ ID NO:4, and the sequence of gRNA1_ZmTOC1-F2 is shown in SEQ ID NO:5.
[0014] Preferably, the primer pair for amplifying gRNA2 in step (2) above is gRNA2_ZmTOC1-R1 and gRNA2_ZmTOC1-R2, the sequence of gRNA2_ZmTOC1-R1 is shown in SEQ ID NO:6, and the sequence of gRNA2_ZmTOC1-R2 is shown in SEQ ID NO:7.
[0015] Preferably, the maize variety to be improved in step (3) above is maize inbred line B104.
[0016] The present invention has the following beneficial effects: In the early stages of this invention, a gene that actively responds to drought was identified through screening. ZmTOC1 This gene is located on chromosome 4 of maize, with a coding region of 1641 bp, encoding 546 amino acids and containing 7 exons. To verify... ZmTOC1 To investigate the effects of drought stress, this application utilizes CRISPR / Cas9 technology to knock out B104 (WT) plants. ZmTOC1 By selecting suitable target gRNA1 and gRNA2, the CRISPR / Cas9 knockout vector pBUE411 was constructed, with Cas9 cleavage targets located on exons; this resulted in amino acid loss and frameshift mutations in the translation. zmtoc1-KO1 and zmtoc1-KO2 Drought-resistant plants. Analysis of plant phenotypic changes and physiological and biochemical indicators revealed that under drought conditions... zmtoc1-KO1 , zmtoc1-KO2 The mutant plants showed superior growth compared to the wild type, with significantly higher survival rates and significantly lower water loss rates; under drought stress, zmtoc1-KO1 , zmtoc1-KO2 The mutant plants were 6.0–10.9% taller than the WT plants, and their aboveground biomass was also significantly increased by 59.5–108.0%. In conclusion, the gene... ZmTOC1 This gene negatively regulates drought resistance in maize seedlings. Loss of function of this gene can reduce the rate of water loss from leaves under drought conditions, thereby enhancing drought resistance in maize seedlings. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 For corn ZmTOC1 Gene structure diagram (A) and gel electrophoresis diagram (B).
[0019] Cutting for CRISPR / Cas9 Figure 2 Target location and mutation sequence map of the gene.
[0020] ZmTOC1 Corn under normal and drought conditions Figure 3 Figure 1 shows the growth index results of wild-type and mutant plants; Figure A shows the results under normal and drought treatments. ZmTOC1 Seedling phenotypes of wild-type and mutant plants; B represents maize under drought treatment. ZmTOC1 Plot showing changes in survival rates of wild-type and mutant plants; C represents maize under drought treatment. ZmTOC1 Graph showing changes in water loss rate between wild-type and mutant plants; DE represents maize under normal and drought treatments. ZmTOC1 Plant height changes of wild-type and mutant plants, FG represents maize under normal and drought treatments. ZmTOC1 A graph showing the changes in aboveground biomass of wild-type and mutant plants. Detailed Implementation
[0021] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0022] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0023] Example 1: ZmTOC1 Gene structure analysis
[0024] Our research group previously screened a gene that actively responds to drought using high-throughput RNA-Seq analysis.ZmTOC1 (Zm00001d051114). Analysis of the gene sequence using the MaizeGDB (https: / / www.maizegdb.org / ) genome database revealed that the gene is located on chromosome 4 of maize, with a full-length genome sequence of 3118 bp (sequence shown in SEQ ID NO:8), of which the coding region is 1641 bp (sequence shown in SEQ ID NO:1), encoding 546 amino acids (sequence shown in SEQ ID NO:9), containing 7 exons. ZmTOC1 A).
[0025] Example 2: Cloning of the ZmTOC1 gene
[0026] Design full-length sequencing primers:
[0027] Figure 1 -F1: GTCGGTGCGTTTGGAGTTTGGGT
[0028] ZmTOC1 -R:TTAATCAACGTAGTTCCCCATTCC
[0029] Sequencing results as follows ZmTOC1 As shown in B, by Figure 1 As shown in B, the cloned gene in the sequencing results is consistent with the reference sequence downloaded from the MaizeGDB maize genome database, indicating that the ZmTOC1 gene has been successfully cloned.
[0030] Example 3: Figure 1 Phenotypic changes and physiological and biochemical indicators of knockout plants under drought treatment
[0031] To verify ZmTOC1 The effect of drought stress was investigated by knocking out B104 (WT) plants using CRISPR / Cas9 technology. ZmTOC1 We constructed the CRISPR / Cas9 knockout vector pBUE411.
[0032] Using the online tool CRISPR-PLANT (http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html), select appropriate target gRNA1 and gRNA2, the sequences of which are as follows: gRNA1 (sequence shown in SEQ ID NO:2): AGGGGGATCGCGTGGGTGTC; gRNA2 (sequence shown in SEQ ID NO:3): GCTCCGGTCCACGAACTGCT.
[0033] The Cas9 cleavage targets are all located on exons, and the primers were designed as follows: gRNA1_ZmTOC1-F1 (sequence shown in SEQ ID NO:4): AATAATGGTCTCAGGCGAGGGGGATCGCGTGGGTGTC; gRNA1_ZmTOC1-F2 (sequence shown in SEQ ID NO:5): GAGGGGGATCGCGTGGGTGTCGTTTTAGAGCTAGAAATAGC; gRNA2_ZmTOC1-R1 (sequence shown in SEQ ID NO:6): AGCAGTTCGTGGACCGGAGCCGCTTCTTGGTGCC; gRNA2_ZmTOC1-R2 (sequence shown in SEQ ID NO:7): ATTATTGGTCTCTAAACAGCAGTTCGTGACCGGAGC.
[0034] sgRNA was amplified using primers to construct the knockout vector pBUE411; amino acid loss and frameshift mutations were selected. ZmTOC1 and zmtoc1-KO1 The plants were used for subsequent experiments ( zmtoc1-KO2 ).
[0035] Under normal conditions, the mutant and WT plants exhibit essentially the same growth pattern, both growing normally. However, under drought conditions... Figure 2 , zmtoc1-KO1 The mutant plants showed better growth than the wild type, and their survival rate was significantly higher than that of the WT plants. zmtoc1-KO2 AB). Furthermore, leaf water loss rate measurements showed that, 50 minutes after leaf detachment, the water loss rate of WT was significantly higher than that of the mutant (approximately 1.2 times). Figure 3 C). Under drought stress, Figure 3 , zmtoc1-KO1 The mutant plants were 6.0–10.9% taller than the WT plants, and their aboveground biomass was also 59.5–108.0% higher. zmtoc1-KO2 DG). In summary, genes Figure 3 ZmTOC1 This gene negatively regulates drought resistance in maize seedlings. Loss of function of this gene can reduce the rate of water loss from leaves under drought conditions, thereby enhancing drought resistance in maize seedlings.
[0036] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Corn ZmTOC1 Application of genes in regulating drought resistance in maize.
2. The application according to claim 1, characterized in that: The ZmTOC1 The coding region sequence of the gene is shown in SEQ ID NO:
1.
3. The application according to claim 2, characterized in that: The regulation of corn drought resistance is achieved by reducing or knocking out... ZmTOC1 Gene function enhances the drought resistance of maize.
4. A method for improving the drought resistance of maize, characterized in that, The steps are as follows: Knock out the seeds from the corn plants. ZmTOC1 Genes, thereby improving the drought resistance of corn.
5. The method according to claim 4, characterized in that: The ZmTOC1 The coding region sequence of the gene is shown in SEQ ID NO:
1.
6. A method for cultivating drought-resistant transgenic maize plants, characterized in that, The steps are as follows: (1) Based on corn ZmTOC1 The coding region sequence of the gene was used to design target gRNA1 and gRNA2; (2) Design primer pairs for amplifying gRNA1 and gRNA2 respectively, and amplify gRNA1 and gRNA2 fragments; (3) Link gRNA1 and gRNA2 fragments to the pBUE411 vector to construct a knockout vector, and transfer it into the maize variety to be improved via Agrobacterium-mediated transformation. The positive plants obtained by screening are drought-resistant transgenic maize plants.
7. The method according to claim 6, characterized in that: In step (1) ZmTOC1 The coding region sequence of the gene is shown in SEQ ID NO:1; the nucleotide sequence of gRNA1 is shown in SEQ ID NO:2; and the nucleotide sequence of gRNA2 is shown in SEQ ID NO:
3.
8. The method according to claim 7, characterized in that: In step (2), the primer pair for amplifying gRNA1 is gRNA1_ZmTOC1-F1 and gRNA1_ZmTOC1-F2. The sequence of gRNA1_ZmTOC1-F1 is shown in SEQ ID NO:4, and the sequence of gRNA1_ZmTOC1-F2 is shown in SEQ ID NO:
5.
9. The method according to claim 8, characterized in that: In step (2), the primer pair for amplifying gRNA2 is gRNA2_ZmTOC1-R1 and gRNA2_ZmTOC1-R2. The sequence of gRNA2_ZmTOC1-R1 is shown in SEQ ID NO:6, and the sequence of gRNA2_ZmTOC1-R2 is shown in SEQ ID NO:
7.
10. The method according to claim 9, characterized in that: The maize variety to be improved in step (3) is maize inbred line B104.