Medicago sativa crisper / cas9 high-efficiency knockout vector and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-02-06
- Publication Date
- 2026-06-30
AI Technical Summary
The CRISPR/Cas9 gene editing efficiency of alfalfa is low, making it difficult to achieve multi-target editing, and it is sensitive to aluminum toxicity, which affects its cultivation in acidic soil areas.
We constructed the alfalfa CRISPR/Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301, using the AtUBQ10 promoter to drive the expression of zCas9 and multi-target tandem tRNA-gRNAs. By modifying the pCAMBIA3301 vector, replacing the CaMV35S promoter with AtUBQ10, and introducing the ployA (50 bp)-BsaI double restriction site-tRNA fragment, we achieved high-efficiency gene editing.
It improved the efficiency of single transcription units and single targets in alfalfa gene editing to 91%, and downregulated MsRAE1 expression and upregulated the expression of aluminum resistance genes MsALS3, MsSTAR1, MsMATE66 and MsGDH1a by editing the promoter of the aluminum resistance negative regulatory gene MsRAE1.
Smart Images

Figure CN122303293A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to an efficient CRISPR / Cas9 knockout vector for alfalfa and its application. Background Technology
[0002] Alfalfa (Medicago sativa) is a high-yielding, high-protein, palatable, and widely distributed perennial leguminous forage crop, cultivated both domestically and internationally. However, due to its highly heterozygous, autotetraploid genome, its large and complex structure, and the fact that many varieties are self-incompatible, its genetic transformation efficiency is low. Therefore, alfalfa gene function research and breeding efforts face significant challenges. Current alfalfa gene function studies primarily focus on obtaining alfalfa gene overexpression and RNAi plants as research materials. However, RNAi technology faces technical difficulties such as high off-target rates, the difficulty in interfering with highly transformed transcripts, and the challenge of stable inheritance of genetic materials.
[0003] CRISPR / Cas9 gene editing technology uses artificially designed gRNAs (guide RNAs) carrying target gene sequences to recognize the target genomic sequence and guide the Cas9 protease to efficiently cleave the DNA double strand, creating double-strand breaks. Normally, cells repair these breaks using efficient non-homologous end joining (NHEJ). However, base insertion or deletion mismatches often occur during repair, causing frameshift mutations that render the target gene nonfunctional, thus achieving gene knockout. The CRISPR / Cas9 system has been validated in targeted gene editing for plant gene function identification and genetic breeding, and molecular breeding using gene editing technology has been implemented in various crops.
[0004] Reports on CRISPR / Cas9 gene editing in alfalfa are scarce, and the efficiency of CRISPR / Cas9 gene editing in alfalfa is also low, which seriously hinders the molecular breeding process of alfalfa. Specifically, the earliest methods used the alfalfa MtU6-1 promoter to drive gRNA expression, with a mutation frequency of 10% for editing MtPDS. The highest frequency of editing in alfalfa was 70% using the soybean ubiquitin GmUbi promoter, and the highest frequency of editing in alfalfa was also 70% using the Arabidopsis ubiquitin AtUBQ10 promoter. However, these methods are all single-target editing methods for alfalfa, and the mutation frequency of single-target editing methods in alfalfa is low. One paper reported that using the MtU6-5 and MtU6-6 promoters to express gRNA separately, the knockout of MsNP1 in alfalfa was achieved through dual-target editing, but the limitation is still the limited number of targets. Other literature reports that using tRNA and Cys4 systems to simultaneously express multiple gRNAs for multi-target editing of alfalfa achieved mutation frequencies of up to 75% and 86%, respectively, with single-target mutation frequencies of up to 35% and 44%, respectively. Recent literature reports that a simplified multi-target gene editing system was achieved using a single transcription unit approach, with a maximum mutation frequency of 71% and a single-target mutation frequency of 61%. However, there is still significant room for improvement in both the overall mutation frequency and the single-target mutation frequency. Therefore, improving editing efficiency and simplifying the alfalfa multi-target CRISPR / Cas9 system are urgent problems to be solved in alfalfa gene editing technology.
[0005] Furthermore, alfalfa is highly sensitive to aluminum toxicity, which is a key factor restricting its cultivation in acidic soil areas. The plant's resistance to aluminum toxicity primarily depends on the regulation of the transcription factor STOP1, which is mainly regulated through a degradation pathway mediated by the F-box protein RAE1. This invention, for the first time, edited the regulatory elements of the alfalfa MsRAE1 promoter, knocking down MsRAE1 mRNA expression and increasing the expression of aluminum resistance genes MsALS3, MsSTAR1, MsMATE66, and MsGDH1a, providing a basis for genetic improvement of alfalfa's aluminum resistance. Summary of the Invention
[0006] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing an efficient alfalfa CRISPR / Cas9 knockout vector.
[0007] Another object of the present invention is to provide the application of the knockout vector.
[0008] Another object of the present invention is to provide a method for gene editing of a target gene in alfalfa using the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 as described in claim 1.
[0009] The objective of this invention can be achieved through the following technical solutions:
[0010] A highly efficient alfalfa CRISPR / Cas9 knockout vector, STU-pAtUBQ10-Cas9-pA-gRNA-3301, is derived from the pCAMBIA3301 vector. The BsaI site of the pCAMBIA3301 vector is removed, and zCas9 with nuclear localization signals at both ends, amplified from pHSE401, is inserted into the vector to replace GUS. The AtUBQ10 promoter replaces the original CaMV35S. The synthesized fragment of ployA (50 bp)-BsaI double restriction site-tRNA (as shown in SEQ ID NO.1) is then ligated downstream of zCas9 to obtain the alfalfa CRISPR / Cas9 highly efficient knockout vector. In this knockout vector, the BsaI double restriction site can be used to insert gRNA, and the AtUBQ10 promoter simultaneously initiates the expression of zCas9 and multi-target tandem tRNA-gRNAs.
[0011] The present invention describes a method for constructing the alfalfa CRISPR / Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301. The knockout vector pCAMBIA3301 is modified by removing the BsaI site from pCAMBIA3301. A zCas9 gene with nuclear localization signals at both ends, amplified from pHSE401, is inserted into the vector to replace GUS. The AtUBQ10 promoter replaces the original CaMV 35S. Finally, the synthesized fragment of ployA (50 bp)-BsaI double restriction site-tRNA shown in SEQ ID NO.1 is ligated into the downstream BstE II restriction site of zCas9 to obtain the alfalfa CRISPR / Cas9 high-efficiency knockout vector.
[0012] Preferably, the construction method includes the following steps:
[0013] (1) Construction of pCAMBIA3301-1 vector without BsaI site: The mutant fragment was amplified from the pCAMBIA3301 vector using SEQ ID NO.2 3301-2F-BstEII and SEQ ID NO.3 3301-1R-BsaI. pCAMBIA3301 was double-digested with BstEII and BsaI. Then, the linearized pCAMBIA3301 was homologously recombinated with the mutant fragment to construct the vector pCAMBIA3301-1.
[0014] (2) Constructing the vector pCAMBIA3301-2 carrying zCas9: 3×FLAG-NLS-zCas9-NLS was amplified from pHSE401 using 3301Cas9-1F shown in SEQ ID NO.4 and 3301Cas9-1R shown in SEQ ID NO.5. pCAMBIA3301-1 was digested with NcoI and DraIII. 3×FLAG-NLS-zCas9-NLS was ligated into the pCAMBIA3301-1 vector by homologous recombination, thereby transforming it into the vector pCAMBIA3301-2.
[0015] (3) pCAMBIA3301-3 was constructed by replacing the original CAMV35S with the AtUBQ10 promoter: the AtUBQ10 promoter was amplified from the Arabidopsis genome using pAtUBQ10-F-3301cas9 shown in SEQ ID NO.6 and pAtUBQ10-R-3301cas9 shown in SEQ ID NO.7. The CAMV35S promoter was removed from pCAMBIA3301-2 by digestion with HindIII and NcoI enzymes. The AtUBQ10 promoter was ligated into pCAMBIA3301-2 by homologous recombination, thereby replacing the original CAMV35S promoter with the AtUBQ10 promoter to drive 3×FLAG-NLS-zCas9-NLS, thus transforming it into the vector pCAMBIA3301-3;
[0016] (4) Synthesize the fragment of ployA (50 bp)-BsaI double restriction site-tRNA shown in SEQ ID NO.1, amplify the fragment using primers BstEII-F shown in SEQ ID NO.8 and BstEII-R shown in SEQ ID NO.9, digest the vector pCAMBIA3301-3 with BstE II single restriction enzyme, and finally construct the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 by homologous recombination.
[0017] The application of the alfalfa CRISPR / Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 in gene editing of alfalfa.
[0018] The application of the alfalfa CRISPR / Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 in the preparation of an alfalfa gene editing kit.
[0019] A method for gene editing of a target gene in alfalfa using the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 as described in claim 1, wherein single or multiple tRNA-gRNA sequences carrying target sequences are ligated into the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 by using BsaⅠ and T4 DNA ligases through a method of enzyme digestion and ligation simultaneously. The constructed vector can be used by the AtUBQ10 promoter to simultaneously promote the expression of zCas9 and tandem tRNA-gRNAs with multiple targets.
[0020] A gene editing vector for the alfalfa phytoene dehydrogenase gene MsPDS.
[0021] The gene editing vector was obtained by ligating the tRNA-gRNA sequence targeting the MsPDS exon of the alfalfa phytoene dehydrogenase gene into the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301. The tRNA-gRNA sequence targeting the MsPDS exon of the alfalfa phytoene dehydrogenase gene was obtained using pGTR as a template, with primers combined as follows: LF-tRNA and MsPDS-Target1-R, MsPDS-Target1-F and MsPDS-Target2-R, MsPDS-Target2-F and MsPDS-Target3-R, MsPDS-Target3-F and MsPDS-Target4-R, and MsPDS-Target4-F and LR-gRNA. The primer LF-tRNA sequence is shown in SEQ ID NO.18, the primer MsPDS-Target1-R sequence is shown in SEQ ID NO.11, and the primer MsPDS-Target1-F sequence is shown in SEQ ID NO.18. The primer sequence MsPDS-Target2-R is shown in SEQ ID NO.10, the primer sequence MsPDS-Target2-F is shown in SEQ ID NO.12, the primer sequence MsPDS-Target3-R is shown in SEQ ID NO.15, the primer sequence MsPDS-Target3-F is shown in SEQ ID NO.14, the primer sequence MsPDS-Target4-R is shown in SEQ ID NO.17, the primer sequence MsPDS-Target4-F is shown in SEQ ID NO.16, and the primer sequence LR-gRNA is shown in SEQ ID NO.19.
[0022] A method for knocking out the MsPDS gene of phytoene dehydrogenase in alfalfa involves infecting alfalfa with the gene editing vector Agrobacterium tumefaciens to obtain a MsPDS mutant.
[0023] A promoter editing vector for the alfalfa aluminum resistance negative regulatory gene MsRAE1 is disclosed. The gene editing vector is obtained by ligating the tRNA-gRNA sequence targeting the MsRAE1 promoter into the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301. The tRNA-gRNA sequence targeting the MsRAE1 promoter is amplified using pGTR as a template, with primers combined as follows: LF-tRNA and MsRAE1-Target1-R, MsRAE1-Target1-F and MsRAE1-Target2-R, MsRAE1-Target2-F and MsRAE1-Target3-R, MsRAE1-Target3-F and MsRAE1-Target4-R, and MsRAE1-Target4-F and LR-gRNA. The primer LF-tRNA sequence is shown in SEQ ID NO.18, and the primer MsRAE1-Target1-R sequence is shown in SEQ ID NO.18. As shown in NO.22, the primer MsRAE1-Target1-F sequence is shown in SEQ ID NO.21, the primer MsRAE1-Target2-R sequence is shown in SEQ ID NO.24, the primer MsRAE1-Target2-F sequence is shown in SEQ ID NO.23, the primer MsRAE1-Target3-R sequence is shown in SEQ ID NO.26, the primer MsRAE1-Target3-F sequence is shown in SEQ ID NO.25, the primer MsRAE1-Target4-R sequence is shown in SEQ ID NO.28, the primer MsRAE1-Target4-F sequence is shown in SEQ ID NO.27, and the primer LR-gRNA sequence is shown in SEQ ID NO.19.
[0024] A method for improving aluminum resistance in alfalfa, characterized in that the gene promoter of the negatively regulating gene MsRAE1 in the gene editing vector of claim 9 is used to upregulate the expression of aluminum resistance genes MsALS3, MsSTAR1, MsMATE66 and MsGDH1a. Preferably, the gene editing vector is used to obtain a mutant of the MsRAE1 promoter by infecting alfalfa with Agrobacterium, and the regulatory element of the MsRAE1 promoter in alfalfa is edited for the first time. This mutation leads to downregulation of MsRAE1 expression, which in turn leads to upregulation of the expression of aluminum resistance genes MsALS3, MsSTAR1, MsMATE66 and MsGDH1a.
[0025] Beneficial effects:
[0026] This invention uses the AtUBQ10 promoter to drive the codon-optimized zCas9 in maize, and employs a polyA vector 2.5 times longer than previous methods to ensure efficient and stable translation of zCas9. This knockout vector can simultaneously initiate the expression of zCas9 and multi-target tandem tRNA-gRNAs using the AtUBQ10 promoter. The plant editing efficiency and single-target efficiency of the CRISPR / Cas9 single-transcriptional unit gene editing system targeting the alfalfa target gene MsPDS can reach up to 91%. For the first time, by editing the regulatory element on the promoter of the aluminum resistance negative regulator gene MsRAE1, a mutant with downregulated MsRAE1 expression was obtained. In this mutant, the expression of aluminum resistance genes MsALS3, MsSTAR1, MsMATE66, and MsGDH1a was upregulated. Attached Figure Description
[0027] Figure 1 Schematic diagrams of the vector structures of STU-pAtUBQ10-Cas9-pA-gRNA-3301 (PV026) and MsPDS-PV026.
[0028] Figure 2 Schematic diagrams of the vector structures of pMtU6-1-gRNA-pAtUBQ10-Cas9-3301 (PV022) and MsPDS-PV022.
[0029] Figure 3 Target site of MsPDS-PV026 and mutation results in transgenic positive seedlings.
[0030] Figure 4 Schematic diagram of the carrier structure of pMsRAE1-PV026
[0031] Figure 5 Target site of pMsRAE1-PV026 and mutation results in transgenic positive seedlings.
[0032] Figure 6 Electrophoresis image and Sanger sequencing results of the pMsRAE1-PV026#11 mutant.
[0033] Figure 7 Mutations in the MsRAE1 promoter of pMsRAE1-PV026#11 lead to decreased expression levels.
[0034] Figure 8 MsRAE1 promoter mutations lead to upregulation of expression levels of aluminum resistance genes MsALS3, MsSTAR1, MsMATE66, and MsGDH1a. Detailed Implementation
[0035] Example 1
[0036] 1. Because the pCAMBIA3301 vector has a BsaI restriction site near pVS1 oriV, which would affect the subsequent construction of the BsaI knockout vector, the BsaI site on pCAMBIA3301 was mutated first. A 3.8 kb mutant fragment was amplified from pCAMBIA3301 using primers 3301-2F-BstEII and 3301-1R-BsaI. Here, the BsaI recognition site 5'-GGTCTC-3' was mutated to 5'-GGACTC-3' using primer 3301-1R-BsaI. pCAMBIA3301 was then double-digested with BstEII and BsaI. Finally, the linearized pCAMBIA3301 was homologously recombinated with the mutant fragment to complete the initial construction of the vector pCAMBIA3301-1.
[0037] Primers for amplifying the 3.8 kb mutant fragment from pCAMBIA3301:
[0038] 3301-2F-BstEII 5'-cacgtgtgaattacaggtgacc-3' (SEQ ID NO.2),
[0039] 3301-1R-BsaI 5'-tacgtgctatccacaggaaagagTccttttcgacc-3' (SEQ ID NO.3),
[0040] 2. 3×FLAG-NLS-zCas9-NLS was amplified from the pHSE401 vector. zCas9 is a codon-optimized Cas9 from maize (Zea mays). pCAMBIA3301-1 was digested with NcoI and DraIII. 3×FLAG-NLS-zCas9-NLS was ligated into the pCAMBIA3301-1 vector by homologous recombination, thereby transforming it into the vector pCAMBIA3301-2.
[0041] Primers for amplifying 3×FLAG-NLS-zCas9-NLS from the pHSE401 vector:
[0042] 3301Cas9-1F 5'-cacgggggactcttgaccatggattacaaggaccacgacgg-3' (SEQ IDNO.4),
[0043] 3301Cas9-1R 5'-gtcacctgtaattcacacgtggtgtcacttcttcttcttcgcctgcc-3' (SEQ ID NO.5),
[0044] 3. The AtUBQ10 (AT4G05320) promoter (636 bp) was amplified from the Arabidopsis genome. pCAMBIA3301-2 was digested with HindIII and NcoI, and the AtUBQ10 promoter was ligated into pCAMBIA3301-2 via homologous recombination, thus replacing the original CaMV 35S promoter with the AtUBQ10 promoter to drive 3×FLAG-NLS-zCas9-NLS. This resulted in the vector pCAMBIA3301-3.
[0045] Primers for amplifying the AtUBQ10 promoter:
[0046] pAtUBQ10-F-3301cas9: 5'-gacctgcaggcatgcaagcttgtcgacgagtcagtaataaacg-3' (SEQ ID NO. 6),
[0047] pAtUBQ10-R-3301cas9: 5'-cgtggtccttgtaatccatggcctgttaatcagaaaaactcagatt-3' (SEQ ID NO.7),
[0048] AtUBQ10 boot sequence:
[0049] Gtcgacgagtcagtaataaacggcgtcaaagtggttgcagccggcacacacgagtcgtgtttatcaactcaaagcacaaatacttttcctcaacctaaaaataaggcaattagccaaaaacaactttgcgtgtaaacaacgctcaatacacgtgtcatt ttattattagctattgcttcaccgccttagctttctcgtgacctagtcgtcctcgtcttttcttcttcttcttcttctataaaacaatacccaaagagctcttcttcttcacaattcagatttcaatttctcaaaatcttaaaaactttctctcaattctct ctaccgtgatcaaggtaaatttctgtgttccttattctctcaaaatcttcgattttgttttcgttcgatcccaatttcgtatatgttctttggtttagattctgttaatcttagatcgaagacgattttctgggtttgatcgttagatatcatcttaat tctcgattagggtttcatagatatcatccgatttgttcaaataatttgagttttgtcgaataattactcttcgatttgtgatttctatctagatctggtgttagtttctagtttgtgcgatcgaatttgtcgattaatctgagtttttctgattaacag
[0050] 4. A fragment of ployA (50 bp)-BsaI double restriction site-tRNA was synthesized from Qingke Company. This fragment was amplified using BstEII-F and BstEII-R primers. The vector pCAMBIA3301-3 was digested with a single BstEII enzyme, and further homologous recombination was used to construct the vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 (hereinafter referred to as PV026). Sequencing confirmed successful construction. The vector sequence is shown in SEQ ID NO.29. The BsaI double restriction site can be used to ligate gRNA (…). Figure 1 A).
[0051] Primers for amplifying the poly A (50 bp)-BsaI double restriction site-tRNA fragment:
[0052] BstEII-F 5’-cacgtgtgaattacaggtgacc-3’ (SEQ ID NO.8),
[0053] BstEII-R 5’-ggggaaattcgagctggtcacctgcaccagccgggaatc-3’ (SEQ ID NO.9),
[0054] ploy A (50 bp)-BsaI double digestion site - tRNA sequence synthesized by the company:
[0055] cacgtgtgaattacaggtgaccAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA tttg aGAGACCttatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggaaaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatttcaccagcccctgttctcgtcagcaaaagagccgttcatttcaataaaccgggcgacctcagccatcccttcctgattttccgctttccagcgttcggcacgcagacgacgggcttcattctgcatggttgtgcttaccagaccggagatattgacatcatatatgccttgagcaactgatagctgtcgctgtcaactgtcactgtaatacgctgcttcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttGGTCTCg AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA (SEQ ID NO. 1).
[0056] Example 2
[0057] 1. Construction of a single transcription unit gene editing vector from alfalfa
[0058] The gene editing vector uses the phytopene dehydrogenase gene MsPDS as the target gene, designing four knockout target sites. The tRNA-gRNA sequences of the four target sites were amplified and tandemly ligated into the vector PV026 using the Golden Gate cloning method. Since a complete Regen-SY4D alfalfa genome sequence is unavailable, primers were designed based on the MsPDS gene sequence in the Xinjiang large-leaf alfalfa reference genome to amplify the Regen-SY4D MsPDS and ligate it into a T-vector for sequencing. Knockout target sites were designed on the exons of the sequenced gene sequence using the CRISPR website. The target sites had to meet two conditions: first, they had high scores on the CRISPR website; second, they were selected from positions where there were no differences across the four chromosomes. Therefore, the following four target sites were designed on the MsPDS exons:
[0059] MsPDS-Target1CGTCCTGAGCTTGATGATAC
[0060] MsPDS-Target2 AAGGTTGTTATTGCTGGTGC
[0061] MsPDS-Target3 GAGGCAAGAGATGTTCTAGG
[0062] MsPDS-Target4 AGATGGAGACTGGTATGAGA
[0063] Furthermore, adapter primers were designed to amplify the tRNA-gRNA tandem sequence of the target MsPDS:
[0064] MsPDS-Target1CGTCCTGA GCTT GATGATAC
[0065] MsPDS-Target1-F 5'-taGGTCTCC GCTT GATGATACgttttagagctagaaatagc-3' (SEQ ID NO.10),
[0066] MsPDS-Target1-R 5′-cgGGTCTCA AAGC TCAGGACGtgcaccagccgggaatc-3'(SEQ IDNO.11),
[0067] MsPDS-Target2AAGGTTGT TATT GCTGGTGC
[0068] MsPDS-Target2-F 5'-taGGTCTCC TATT GCTGGTGCgttttagagctagaaatagc-3'(SEQID NO.12),
[0069] MsPDS-Target2-R 5′-cgGGTCTCA AATA ACAACCTTtgcaccagccgggaatc-3'(SEQ IDNO.13),
[0070] MsPDS-Target3GAGGCAAG AGAT GTTCTAGG
[0071] MsPDS-Target3-F 5'-taGGTCTCC AGAT GTTCTAGGgttttagagctagaaatagc-3'(SEQID NO.14),
[0072] MsPDS-Target3-R 5′-cgGGTCTCA ATCT CTTGCCTCtgcaccagccgggaatc-3'(SEQ IDNO.15),
[0073] MsPDS-Target4AGATGGAG ACTG GTATGAGA
[0074] MsPDS-Target4-F 5'-taGGTCTCC ACTG GTATGAGAgttttagagctagaaatagc-3'(SEQID NO.16)
[0075] MsPDS-Target4-R 5′-cgGGTCTCA CAGT CTCCATCTtgcaccagccgggaatc-3'(SEQ IDNO.17)
[0076] Read more:
[0077] LF-tRNA 5'-taGGTCTCC TTTG aacaaagcaccagtgg-3' (SEQ ID NO. 18),
[0078] LR-gRNA5'-cgGGTCTCA TGTT gcaccgactcggtg-3' (SEQ ID NO.19),
[0079] Furthermore, using pGTR as a template, primers were used to amplify fragments in combinations of LF-tRNA and MsPDS-Target1-R, MsPDS-Target1-F and MsPDS-Target2-R, MsPDS-Target2-F and MsPDS-Target3-R, MsPDS-Target3-F and MsPDS-Target4-R, and MsPDS-Target4-F and LR-gRNA. The PCR products were then recovered using a kit after agarose gel detection.
[0080] The recovered product from the previous step was mixed with the PV026 vector, and pre-digested with BsaⅠ at 37℃ for 10 min. Then, T4 ligase was added for simultaneous digestion and ligation. The specific procedure is as follows:
[0081] Pre-enzyme digestion system:
[0082] system volume 10×Buffer 1.5 μL BsaⅠ 1 μL PCR product recovery 50 ng PV026 vector 80 ng <![CDATA[ddH2O]]> Up to 15 μL
[0083] Edge-cutting and edge-connecting system:
[0084] system volume Previous product 14.4μL T4 ligase 0.1 μL T4 Buffer 0.5 μL
[0085] Cutting and connecting reaction steps
[0086]
[0087] Furthermore, the recombinant vector was transformed into E. coli, and after colony PCR identification, it was sent to Qingke Biotechnology Co., Ltd. for sequencing to detect whether the target tRNA-gRNA sequence was ligated into the vector, thus forming MsPDS-PV026 ( Figure 1 B). Simultaneously, the target tRNA-gRNA sequence was also ligated into plasmid PV022 ( Figure 2 A), this plasmid uses the pMtU6-1 promoter to drive the tRNA-gRNA sequence, thereby constructing the control plasmid MsPDS-PV022 ( Figure 2 B).
[0088] The pMtU6-1 boot sequence is:
[0089] ATCCAACATTTCACTTGAGTTAACTCAATAGCAAGAATAACGTCCATAGTTTCAGCATTCAAGCAAAACAGCCAAGAAAATCAGCTTGGTAATTTCAGTGAGACTTGGACTACCATAAGCAGCACCGCCTATTACACTTAATGGGGTAAAGTAAAACGAGCCACATCACCTCCTTGATTTTAAGGAGCATTTGAAGGAGTATAAAAAGAATGTATGTAATGTAAGGTTGTGTTGTGTCATTCAAGATAGCAA GACGGACCAAAGCTTCTATGTATCTATCTATGTCTATGATATGATGATTGTATTGATTTGGTTTGAGTACAGTGAGGGAGAGGGAGGAACTTCTTCACTTGTTTATTTAACCTGAAACTCAACTCA AATCACTGAGAGTGAATGTTGAGAAATAAGTATTATGTTATGTTTGCTTTTGCTATTAGTCCCACATCGCTTACATATACGtcatttatattgtttataTAGCCTAGACGAACAGCAGGGTTT (SEQ ID NO.20)
[0090] Similarly, the following four target sites were designed on the pMsRAE1 promoter, and the tRNA-gRNA sequences of the target sites were tandemly ligated into the vector PV026 to form pMsRAE1-PV026. Figure 4 and 5 A).
[0091] pMsRAE1-Target1 AGAGAATAATAATGTGCCAA
[0092] pMsRAE1-Target2 AACTGTGGGTATGAAAAACA
[0093] pMsRAE1-Target3 TTGGTACTGTTGTTGGTACT
[0094] pMsRAE1-Target4 TTGGTTAACATGGGAAGGTG
[0095] Adapter primers for amplifying the tRNA-gRNA tandem sequence of the target site on the MsRAE1 promoter:
[0096] pMsRAE1-Target1 AGAGAATA ATAA TGTGCCAA
[0097] pMsRAE1-Target1-F:5’-taGGTCTCC ATAA TGTGCCAAgttttagagctagaa-3’ (SEQ IDNO.21)
[0098] pMsRAE1-Target1-R:5’-cgGGTCTCA TTAT TATTCTCT tgcaccagccggg-3’(SEQ IDNO.22)
[0099] pMsRAE1-Target2 AACTGTGG GTAT GAAAAACA
[0100] pMsRAE1-Target2-F :5’-taGGTCTCC GTAT GAAAAACA gttttagagctagaa-3’ (SEQID NO.23)
[0101] pMsRAE1-Target2-R: 5’-cgGGTCTCA ATAC CCACAGTT tgcaccagccggg-3’(SEQ IDNO.24)
[0102] pMsRAE1-Target3 TTGGTACT GTTG TTGGTACT
[0103] pMsRAE1-Target3-F: 5’-taGGTCTCC GTTG TTGGTACT gttttagagctagaa-3’ (SEQID NO.25)
[0104] pMsRAE1- Target3-R: 5’-cgGGTCTCA CAAC AGTACCAA tgcaccagccggg-3’(SEQ IDNO.26)
[0105] pMsRAE1-Target4 TTGGTTAA CATG GGAAGGTG
[0106] pMsRAE1-Target4-F: 5’-taGGTCTCC CATG GGAAGGTG gttttagagctagaa-3’ (SEQID NO.27)
[0107] pMsRAE1-Target4-R: 5'-cgGGTCTCA CATG TTAACCAA tgcaccagccggg-3' (SEQ IDNO.28)
[0108] 3. Identification of gene editing in alfalfa
[0109] The MsPDS target site sequences of positive transgenic plants of MsPDS-PV022 and MsPDS-PV026 were amplified by PCR and sent to the China National Rice Research Institute for Hi-TOM sequencing, followed by subsequent analysis and comparison. The results showed that none of the positive transgenic plants of MsPDS-PV022 had mutations (0 / 31); the mutation frequency at Target3 in the positive transgenic plants of MsPDS-PV026 was 91% (10 / 11), while there were no mutations at other target sites, therefore the mutation frequency of MsPDS-PV026 plants was also 91% (10 / 11). Figure 3 The alfalfa MsPDS-PV026 single transcription unit gene editing system showed significantly higher editing efficiency for the same target sites in MsPDS compared to the control plasmid MsPDS-PV022.
[0110] The target sequence on the MsRAE1 promoter of pMsRAE1-PV026 positive transgenic plants was amplified by PCR and sent to the China National Rice Research Institute for Hi-TOM sequencing. The results showed that the pMsRAE1-PV026#11 mutant had mutations in two alleles, -75 bp and -6 bp, respectively. Figure 5 B). Electrophoresis results showed two banding patterns for -75 bp and other alleles ( Figure 6 A), the bimodal position of the Sanger sequencing results also shows the location of the differences between -75 bp and other alleles ( Figure 6 B). The large fragments from the electrophoresis were excised and then Sanger sequenced. The bimodal positions of the results also showed the locations where the -6 bp and other alleles (allele1 and allele2) differed. Figure 6 C). Although not all alleles of pMsRAE1-PV026#11 were mutated, a large 75 bp fragment was lost, namely 5'-CAATGGACCCATGTTTTTCATA CCCACAGTTTTTCATTTGACAAAAATATTACCCATAGTTTTGGAGTACCAAGT-3'. Furthermore, qRT-PCR results showed that the mutation at the promoter of pMsRAE1-PV026#11 led to a significant decrease in the relative expression level of MsRAE1. Figure 7Furthermore, the relative expression levels of the aluminum toxicity resistance genes MsALS3 and MsSTAR1 were significantly upregulated, as were the relative expression levels of MsMATE66 and MsGDH1a. Figure 8 This indicates that the mutation at the promoter disrupts the regulatory elements of MsRAE1 expression, pMsRAE1-PV026#11 is a knockdown mutant of MsRAE1, and MsRAE1 negatively regulates the expression of the aluminum toxicity resistance gene.
[0111] Primers for identifying relative gene expression levels using qPCR:
[0112] MsRAE1:
[0113] Q-MsRAE1-F5'-AACTGATAAAGGAGTTGCCAA-3'
[0114] Q-MsRAE1-R 5'-CAGCATTAATCATCTGAAGGCTA-3'
[0115] MsALS3:
[0116] Q-MsALS3-F5'-CAGCCTCATCATCACAATCATCACC-3'
[0117] Q-MsALS3-R5'-TGGTTGAGTGAGTTTCTGAAAGGCAT-3'
[0118] MsSTAR1:
[0119] Q-MsSTAR1-F5'-CTCATTCTCTCAATCACACGCC-3'
[0120] Q-MsSTAR1-R5'-GCTTCCCATCATCCGATTCTTT-3'
[0121] MsMATE66:
[0122] Q-MsMATE66-F5'-TCACCTAAAACAGTGAATTGGC-3'
[0123] Q-MsMATE66-R5'-TCGCGACCAAGATCGTCTAATTT-3'
[0124] MsGDH1a:
[0125] Q-MsGDH1a-F5'-TTACAGTGACACTGCAAGATCT-3'
[0126] Q-MsGDH1a-R5’-ATAAGATTGCAACGTGCCGTC-3’。
Claims
1. A highly efficient alfalfa CRISPR / Cas9 knockout vector, STU-pAtUBQ10-Cas9-pA-gRNA-3301, characterized in that, The knockout vector was modified from the pCAMBIA3301 vector, with the BsaI site removed, and the vector amplified from pHSE401 containing nuclear localization signals at both ends. zCas9 Alternative GUS Connect to the carrier, using AtUBQ10 The promoter replaces the original CaMV 35S Then, the synthesized fragment of ployA (50 bp)-BsaI double restriction site-tRNA shown in SEQ ID NO.1 is ligated into... z The downstream of Cas9 yields the alfalfa CRISPR / Cas9 high-efficiency knockout vector; the knockout vector, with its BsaI double restriction site, can be used to insert gRNA, which is then... AtUBQ10 The promoter starts z simultaneously Cas9 and multi-target tandem tRNA-gRNAs Express.
2. The method for constructing the alfalfa CRISPR / Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 as described in claim 1, characterized in that, The vector was modified from pCAMBIA3301, with the BsaI site removed. Nuclear localization signals at both ends were amplified from pHSE401. zCas9 Alternative GUS Connect to the carrier, using AtUBQ10 The promoter replaces the original CaMV 35S Then, the synthesized fragment of ployA (50 bp)-BsaI double restriction site-tRNA shown in SEQ ID NO.1 is ligated into... z The downstream BstE II restriction site of Cas9 yields the alfalfa CRISPR / Cas9 high-efficiency knockout vector.
3. The construction method according to claim 2, characterized in that, Includes the following steps: (1) Construction of pCAMBIA3301-1 vector without BsaI site: The mutant fragment was amplified from the pCAMBIA3301 vector using SEQ ID NO.2 3301-2F-BstEII and SEQ ID NO.3 3301-1R-BsaI. pCAMBIA3301 was double digested with BstEII and BsaI. Then, the linearized pCAMBIA3301 was homologously recombinated with the mutant fragment to construct the vector pCAMBIA3301-1. (2) Constructing a carrier zCas9 The vector pCAMBIA3301-2: amplified from pHSE401 using SEQ ID NO.4 (3301Cas9-1F) and SEQ ID NO.5 (3301Cas9-1R). 3×FLAG-NLS-zCas9-NLS pCAMBIA3301-1 was digested with NcoI and DraIII, and homologous recombination was used to... 3×FLAG-NLS-zCas9-NLS The pCAMBIA3301-1 vector was incorporated to transform it into the pCAMBIA3301-2 vector; (3) Use AtUBQ10 The promoter replaces the original CAMV 35S Construction of pCAMBIA3301-3: pAtUBQ10-F-3301cas9 (SEQ ID NO. 6) and pAtUBQ10-R-3301cas9 (SEQ ID NO. 7) were amplified from the Arabidopsis genome. AtUBQ10 The promoter was removed by digesting pCAMBIA3301-2 with HindIII and NcoI enzymes to excise the CAMV35S promoter, and then homologous recombination was used to... AtUBQ10 The promoter is connected to pCAMBIA3301-2, thereby using AtUBQ10 The promoter replaced the original CaMV 35S Startup driver 3×FLAG-NLS-zCas9-NLS Thus, it was transformed into the carrier pCAMBIA3301-3; (4) Synthesize the fragment of ployA (50 bp)-BsaI double restriction site-tRNA shown in SEQ ID NO.1, amplify the fragment using primers BstEII-F shown in SEQ ID NO.8 and BstEII-R shown in SEQ ID NO.9, digest the vector pCAMBIA3301-3 with BstE II single restriction enzyme, and finally construct the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 by homologous recombination.
4. The application of the alfalfa CRISPR / Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 as described in claim 1 in gene editing of alfalfa.
5. The application of the alfalfa CRISPR / Cas9 high-efficiency knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 as described in claim 1 in the preparation of an alfalfa gene editing kit.
6. A method for gene editing of a target gene in alfalfa using the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 as described in claim 1, characterized in that, Using BsaⅠ and T4 DNA ligases, single or multiple tRNA-gRNA sequences carrying target sequences are ligated into the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301 via a digestion-while-ligation method. The constructed vector can then be... AtUBQ10 The promoter starts z simultaneously Cas9 and multi-target tandem tRNA- gRNAs Express.
7. A gene for alfalfa phytoene dehydrogenase MsPDS The gene editing vector is characterized by, The gene-editing vector described herein is a vector that targets the phytoene dehydrogenase gene in alfalfa. MsPDS The tRNA-gRNA sequence of the exon was ligated into the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301, which is the target gene for phytoene dehydrogenase in alfalfa. MsPDS The exon tRNA-gRNA sequences were amplified using pGTR as a template, with primers obtained by combining LF-tRNA and MsPDS-Target1-R, MsPDS-Target1-F and MsPDS-Target2-R, MsPDS-Target2-F and MsPDS-Target3-R, MsPDS-Target3-F and MsPDS-Target4-R, and MsPDS-Target4-F and LR-gRNA. The primer sequences are shown in SEQ ID NO.18, MsPDS-Target1-R, SEQ ID NO.11, SEQ ID NO.10, SEQ ID NO.13, SEQ ID NO.12, and SEQ ID NO.14 respectively. As shown in NO.15, the primer MsPDS-Target3-F sequence is shown in SEQ ID NO.14, the primer MsPDS-Target4-R sequence is shown in SEQ ID NO.17, the primer MsPDS-Target4-F sequence is shown in SEQ ID NO.16, and the primer LR-gRNA sequence is shown in SEQ ID NO.
19.
8. A gene knockout method for phytoene dehydrogenase in alfalfa MsPDS The method is characterized by, The gene editing vector described in claim 7 was obtained by infecting alfalfa with Agrobacterium tumefa. MsPDS A mutant of a mutation.
9. A negative regulatory gene for aluminum toxicity resistance in alfalfa MsRAE1 The promoter editing carrier is characterized by, The gene-editing vector described herein is used to target the negative regulatory gene for aluminum resistance in alfalfa. MsRAE1 The promoter tRNA-gRNA sequence was ligated into the knockout vector STU-pAtUBQ10-Cas9-pA-gRNA-3301, which is used to target... MsRAE1 The promoter tRNA-gRNA sequence was obtained using pGTR as a template and primers in the following combinations: LF-tRNA and MsRAE1-Target1-R, MsRAE1-Target1-F and MsRAE1-Target2-R, MsRAE1-Target2-F and MsRAE1-Target3-R, MsRAE1-Target3-F and MsRAE1-Target4-R, and MsRAE1-Target4-F and LR-gRNA. The primer sequences are shown in SEQ ID NO. 18, MsRAE1-Target1-R, SEQ ID NO. 22, SEQ ID NO. 21, SEQ ID NO. 24, SEQ ID NO. 23, and SEQ ID NO. 24 respectively. As shown in NO.26, the primer MsRAE1-Target3-F sequence is shown in SEQ ID NO.25, the primer MsRAE1-Target4-R sequence is shown in SEQ ID NO.28, the primer MsRAE1-Target4-F sequence is shown in SEQ ID NO.27, and the primer LR-gRNA sequence is shown in SEQ ID NO.
19.
10. A method for improving the aluminum toxicity resistance of alfalfa, characterized in that, Using the gene editing vector of claim 9 to negatively regulate genes MsRAE1 The gene promoter, thereby upregulating the anti-aluminum toxicity gene. MsALS3 , MsSTAR1 , MsMATE66 and MsGDH1a The expression is preferably obtained by infecting alfalfa with the gene-editing vector of claim 9 using Agrobacterium. MsRAE1 A mutant with a promoter mutation, which leads to MsRAE1 Downregulation of expression, leading to the reduction of aluminum resistance genes MsALS3 , MsSTAR1 , MsMATE66 and MsGDH1a The expression is adjusted upwards.