Method for promoting early maturity and increasing lint content of cotton based on ghcs10 gene and kasp marker

Abstract

This invention discloses a method and KASP marker for promoting early maturity and increasing lint content in cotton based on the GhCS10 gene. By knocking out or silencing the GhCS10 gene on the cotton D03 chromosome, early maturity is promoted while simultaneously increasing lint content. This invention has significant theoretical and practical implications for breeding high-yielding, high-quality, and widely adaptable early-maturing cotton varieties and ensuring the sustainable development of the industry.

Description

Technical Field

[0001] This invention relates to the field of cotton genetics and breeding technology, and in particular to a method for promoting early maturity of cotton and increasing lint content based on the GhCS10 gene, as well as the KASP marker. Background Technology

[0002] Cotton, belonging to the genus *Gossypium* of the family Malvaceae in the order Malvales, is an annual herbaceous or perennial woody plant. It is an important raw material for fiber, oil, and protein feed, possessing significant economic value and being one of the world's most important crops. Extreme weather events brought about by climate change pose a severe challenge to cotton production. Against this backdrop, developing early-maturing cotton varieties has become a key objective in cotton breeding, aiming to adapt to the planting needs of different ecological regions, mitigate disaster risks, and improve land use efficiency and production benefits.

[0003] Early maturity in cotton is a key agronomic trait measuring the time required for cotton to mature from sowing. It is a complex quantitative trait regulated by both genes and the environment. Evaluation of early maturity typically encompasses the following temporal, morphological, and comprehensive traits. Growth period indicators include Bud Period (BP), Flowering Time (FT), Flower and Boll Period (FBP), Whole Growth Period (WGP), and Squaring Period (SP). Early-maturing varieties can have a 33-day shorter overall growth period and a 15-day earlier FT than late-maturing varieties. Morphological indicators include the Node of First Fruiting Branch (NFFB), an important and easily measurable morphological indicator; lower NFFB positions indicate earlier maturity. Studies show that the average NFFB for early-maturing varieties is 3.6 to 5.3, while for late-maturing varieties it reaches as high as 7.65. Plant height (PH) and height of the first fruiting branch (HNFFB) are also commonly used as parameters for evaluating precocity. Among comprehensive traits, yield percentage before frost (YPBF) reflects the yield contribution during the effective growing period.

[0004] Early maturity in cotton has been revealed as a complex agronomic trait closely related to flowering time, with its regulatory mechanism involving a sophisticated network of multiple genes and signaling pathways. Within this network, the photoperiod pathway plays a central role, and the FLOWERING LOCUS T (FT) gene and its homologs, acting as "florigenin," are key factors integrating multiple flowering signals. Studies have shown that GhFT in Sea Island cotton not only promotes flowering itself but also partially restores the late-flowering phenotype of the Arabidopsis ft-10 mutant, with significantly higher expression levels in early-maturing cotton varieties compared to late-maturing varieties. The CONSTANS-like (COL) gene family, located upstream of FT, is a key component of the photoperiod pathway, and 42 GhCOL members have been identified in cotton. Among them, GhCOL1 is highly homologous to Arabidopsis CO and rice Hd1, and can completely restore the late-flowering phenotype of the Arabidopsis co-2 mutant, making it a potential flowering-inducing gene in cotton; GhCOL2 also shows potential in regulating photoperiodic flowering. Furthermore, the MADS-box transcription factor family also plays an important role in the regulation of flower development. Overexpression of GhSOC1, GhMADS22, and GhMADS23 in cotton significantly promotes early flowering in Arabidopsis thaliana, and GhAP1, as a MADS transcription factor, has a similar effect. RPD3 deacetylases such as GhHDA5 and GhHDA6 in cotton are associated with precocity, while silencing GhHDA5 delays flowering time.

[0005] Early maturity plays an indispensable role in modern cotton production. Adapting to the needs of short-season cotton-growing areas, early-maturing cotton varieties can significantly shorten the growth period, allowing them to successfully complete the entire growth cycle in ecologically short frost-free areas such as the Northwest Inland Early-Maturing Cotton Region, thus expanding the geographical boundaries of cotton cultivation. Mitigating the risk of late-season adverse weather, early maturity enables cotton to complete boll formation and opening before adverse environmental conditions such as autumn frost, pest and disease attacks, or drought, thereby reducing production risks and ensuring yield and quality. Improving the multiple cropping index and resource utilization efficiency, for example, early-maturing cotton can be rotated or intercropped with crops such as wheat and rapeseed, significantly increasing the land's multiple cropping index and agricultural resource utilization efficiency. Reducing production inputs and labor intensity, the compact plant type and concentrated maturity characteristics of early-maturing cotton make it more suitable for mechanized harvesting, greatly reducing labor input and improving agricultural production efficiency.

[0006] Improving the early maturity trait in cotton is an ongoing breeding goal. Wild cotton is mostly a photoperiod-sensitive perennial plant, but through artificial selection during domestication, cultivated cotton has gradually lost its photoperiod sensitivity, transforming into a day-neutral annual crop, thus adapting to a wider range of planting areas. However, there is a significant negative correlation between early maturity and yield and fiber quality, and traditional breeding methods struggle to simultaneously improve these traits. Summary of the Invention

[0007] The purpose of this invention is to provide a method and KASP marker for promoting early maturity of cotton and increasing lint content based on the GhCS10 gene. By knocking out or silencing the GhCS10 gene on the cotton D03 chromosome, early maturity of cotton is promoted and lint content is increased. This has important theoretical and practical significance for breeding high-yield, high-quality, and widely adaptable early-maturing cotton varieties and ensuring the sustainable development of the industry.

[0008] The technical solution adopted by this invention to solve its technical problem is: A method based on the GhCS10 gene to promote early maturity of cotton while increasing lint content is proposed. This method involves knocking out or silencing the GhCS10 gene on the cotton D03 chromosome, thereby promoting early maturity of cotton and increasing lint content.

[0009] The nucleotide sequence of the GhCS10 gene is shown in SEQ ID No. 1.

[0010] The cotton variety in question is upland cotton.

[0011] The application of the GhCS10 gene on cotton chromosome D03 in regulating early maturity of cotton, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0012] The application of the GhCS10 gene on cotton chromosome D03 in increasing cotton lint content, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0013] A primer for amplifying the KASP marker on chromosome D03 for breeding early-maturing and high-leaf-point cotton varieties, comprising: Forward primer F1 with FAM fluorescent label: GAAGGTGACCAAGTTCATGCTCAAACTCACATGATGGAATAT; Forward primer F2 with HEX fluorescent label: GAAGGTCGGAGTCAACGGATTCAAACTCACATGATGGAATAC; Reverse primer: TGGGGTGAAGCTGCAAATGTCCG.

[0014] The beneficial effects of this invention are: by knocking out or silencing the GhCS10 gene on the cotton D03 chromosome, early maturity of cotton is promoted, and the lint content is increased. This has important theoretical and practical significance for cultivating high-yield, high-quality, and widely adaptable early-maturing cotton varieties and ensuring the sustainable development of the industry. Attached Figure Description

[0015] Figure 1This is a graph showing the effects of different haplotypes of the Ghicr24_D03G114200 gene on early maturity and yield traits in cotton in a natural population. Note: a) Plant height; b) Number of first nodes; c) First node height; d) Flowering period; e) Entire growth period; f) Single boll weight; g) Lint percentage; h) Flet index. * and ** indicate significant (P<0.05) and highly significant (P<0.01) differences between haplotypes, respectively. NS. indicates no significant difference (P≥0.05). Figure 2 This is a graph showing the effects of different haplotypes of the Ghicr24_D03G114700 gene on early maturity and yield traits in cotton in a natural population. Note: a) Plant height; b) Number of first nodes; c) First node height; d) Flowering period; e) Total growth period; f) Single boll weight; g) Lint percentage; h) Flet index. * and ** indicate significant (P<0.05) and highly significant (P<0.01) differences between haplotypes, respectively. NS. indicates no significant difference (P≥0.05). Figure 3 This is a diagram showing the development and haplotype validation of KASP markers based on non-synonymous mutant SNPs in the GhCS10 coding region; Note: a. KASP markers were developed using non-synonymous mutant SNP sites in the GhCS10 coding region, and haplotype detection was performed on the RIL population; FAM and HEX fluorescence signals represent the 'TM-1' and 'CRI50' allele types, respectively. bh. Phenotypic distribution of the two haplotypes in plant height (PH), first fruiting branch node position (NFFB), first fruiting branch height (HFFBN), flowering time (FT), single boll weight (BW), lint percentage (LP), and seed index (SI). ** indicates P<0.01, two-sample t-test; Figure 4 shows the effect of VIGS silencing of GhCS10 on maturity-related traits at the budding stage of cotton. Note: a) Phenotype of plants in each treatment group at the budding stage; b) Silencing efficiency of GhCS10 in the silenced lines; c) Plant height; d) Internode length (n1~n9 represent the 1st to 9th internodes from bottom to top); e) Number of first nodes; f) Height of first node; g) Budding stage. Data are the mean ± standard error of three biological replicates. * indicates P<0.05, ** indicates P<0.01. Figure 5 This is a graph showing the effect of GhCS10 silencing on early maturity and yield traits in cotton during flowering and maturity. Note: a) Plant phenotype of each treatment group at flowering time; b~h) Corresponding to plant height at flowering time, flowering time, fresh weight (FW) at flowering time, dry weight (DW) at flowering time, single boll weight, lint percentage, and seed index. Data are the mean ± standard error of three biological replicates. ** indicates extremely significant difference (P<0.01). Figure 6This is a graph showing the callose content detection results of the GhCS10 silent strains; Note: a) Phenotype of plants in each treatment group at the 6-leaf stage; b) Callose content in internodes and leaf tissues of the GhCS10 silent strains and control strains. Data are the mean ± standard error of three biological replicates, ** indicates extremely significant differences between groups (P<0.01); Figure 7 Figure 1 shows the results of the early-maturing phenotype analysis of GhCS10 transgenic cotton; a, b, comparison of flowering plant phenotypes of transgenic overexpression lines (OE-1, OE-2), knockout lines (C-1, C-2) and wild-type (WT) cotton; c-f, statistical analysis of pH, HNFB, NFFB and FT for each material. Data are expressed as mean ± standard deviation, ** indicates extremely significant difference at the P < 0.01 level; Figure 8 This is a graph showing the yield phenotypic analysis results of GhCS10 transgenic cotton; a) Comparison of mature plant phenotypes between transgenic overexpression lines (OE-1, OE-2), knockout lines (C-1, C-2), and wild-type (WT) cotton; b) Statistical analysis of BW, LP, and SI for each material. Data are expressed as mean ± standard deviation, and * indicates significant differences at the P<0.05 and P<0.01 levels. Detailed Implementation

[0016] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0017] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. The methods described in the following embodiments are conventional methods in the field, unless otherwise specified.

[0018] Example 1: Genetic variation analysis of precocity and yield-related traits in RIL populations 1.1 Materials and Methods 'TM-1' is the first upland cotton material to have its whole genome sequenced, exhibiting a clear genetic background and stable agronomic traits. 'CRI50' is an early-maturing conventional cotton variety bred by the Cotton Research Institute and the Institute of Biotechnology, Chinese Academy of Agricultural Sciences, characterized by insect resistance, early maturity, and high yield. The RIL population used in this study had 'TM-1' (a mid-to-late maturing material) as the male parent and 'CRI50' (an early-maturing material) as the female parent. In the summer of 2019, the two parents were crossbred in the Pingshan Greenhouse of Zhejiang Agriculture and Forestry University to obtain F1. In the winter of 2019, the F1 plants were planted at the Hainan Nanfan Base and self-pollinated to obtain the F2 population. 300 F2 individual plants were randomly selected to construct a recombinant inbred line population. Each generation underwent strict self-pollination, combined with extra-generation propagation in Hainan to accelerate population construction. 2:6The research subjects were high-generation recombinant inbred lines, which were used for phenotypic identification and genetic analysis.

[0019] In the spring of 2023, recombinant inbred line F was sown at the cotton research center experimental station in Linqing City, Shandong Province, and the modern agricultural science and technology demonstration park in Huanggang City, Hubei Province. 2:6 Group and parents, received F in the same year 2:7 Seeds; sown in the winter of 2023 at a cotton planting base in Sanya, Hainan. 2:7 And the parent lines, harvested in the spring of 2024, yielded F. 2:8 Seeds; in the spring of 2024, F1 variety from Sanya, Hainan, was sown at the Cotton Research Center Experimental Station in Linqing City, Shandong Province, the Modern Agricultural Science and Technology Demonstration Park in Huanggang City, Hubei Province, and the Hongcun Base of Zhejiang A&F University in Hangzhou City, Zhejiang Province. 2:8 Seeds and parent plants.

[0020] This study systematically investigated the early maturity and yield traits of RIL populations and their parents in six environments. The early maturity traits measured included flowering time (FT), plant height (PH), first fruiting branch node position (NFFB), and first fruiting branch height (HFFBN); the yield traits measured included boll weight (BW), lint percentage (LP), and seed index (SI).

[0021] 1.2 Results Analysis This study statistically analyzed the early-maturing related traits (PH, NFFB, HNFFB, and FT) of 300 families of RIL populations grown under six environments. The results showed: The pH of the RIL population showed a continuous distribution, and pH was significantly positively correlated across different environments. The broadly heritable value of pH was 76.92%, and the analysis of variance showed a significant association between pH and genotype, indicating that genetic factors play an important regulatory role in pH.

[0022] Under all environmental conditions, NFFB in the RIL population showed a continuous distribution. NFFB showed a significant positive correlation among different environments, with a broad-sense heritability of 73.13%. Analysis of variance showed a significant association between NFFB and genotype, indicating that this trait is primarily regulated by genetic factors.

[0023] HNFFB in the RIL population showed a continuous distribution across all environments, with a significant positive correlation between different environments and a broad-sense heritability of 80.59%. Analysis of variance showed a significant association between HNFFB and genotype, indicating that genetic factors are the main regulator of HNFFB.

[0024] The free radical tendency (FT) of the RIL population showed a continuous distribution across all environments, with a significant positive correlation between FT values ​​across different environments. Its broadly heritable value was 82.13%. Analysis of variance showed that FT was significantly correlated with genotype, indicating that genetic background is an important factor influencing FT.

[0025] The phenotypes of yield traits all showed a continuous distribution (BW, LP, and SI). LP also showed a significant positive correlation in all six environments, with coefficients of variation ranging from 0.05 to 0.09. The broad-sense heritability was 93.00%. Analysis of variance showed that it was significantly affected by genotype, indicating that LP is mainly regulated by genetic factors.

[0026] Correlation analysis was performed on the phenotypic mean values ​​of four precocity traits (PH, NFFB, HNFFB, FT) and three yield traits (BW, LP, SI) in the RIL population under six environmental conditions. The results showed significant positive correlations among the four precocity traits. This indicates that families with higher PH levels had later NFFB, HNFFB, and FT, and vice versa, with stronger precocity among the traits, suggesting a strong synergistic regulatory effect. Furthermore, all precocity traits (PH, NFFB, HNFFB, FT) were highly significantly positively correlated with yield traits BW and SI, but highly significantly negatively correlated with LP, showing that later-maturing families had higher BW and higher SI. However, increased precocity may be accompanied by an increase in LP.

[0027] Example 2: QTL mapping of precocity and yield-related traits 2.1 Extraction of RIL population and parental genomic DNA This study used the cotton F2:7 RIL population and its parents as experimental materials. In December 2023, the parents and 300 F2:7 families were sown at a cotton planting base in Sanya, Hainan. At the flowering stage, approximately 2-3 uniformly growing young true leaves were selected and quickly placed in an icebox for preservation. After being brought back to the laboratory, they were stored at -80℃ for later use. DNA was extracted using the CTAB method. The extracted genomic DNA from the 300 F2:7 RIL population was sent to Wuhan Bena Technology Co., Ltd. for sequencing.

[0028] 2.2 Construction of parental resequencing libraries The extracted genomic DNA from the parental lines 'CRI50' and 'TM-1' was sent to Wuhan Bena Technology Co., Ltd. for resequencing. Library construction was performed according to the standard library construction procedure of the Illumina platform.

[0029] 2.3 Comparison with reference genome and SNP and InDel detection The BWA alignment software was used to align 300 RIL populations and two parental valid data with the upland cotton reference genome 'ZM24' (YANG Z, GE X, YANG Z, et al. Extensive intraspecific gene order and gene structural variations in upland cotton cultivars[J]. Nature Communications, 2019, 10(1): 2989.). The alignment results were sorted using SAMtools, and SNP / Indel detection was performed using GATK software. Genotyping was then performed on the parents and offspring. To ensure the accuracy of subsequent experiments, the developed markers were filtered according to the following criteria: (1) Filter out sites that do not show polymorphism between parents; (2) Filter out sites where both parents are not homozygous; (3) Filter out sites with a sequencing depth less than 4 times; (4) Filter out sites with a deletion rate greater than 40% in the population; (5) Filter out sites with a partial segregation P-value of less than 0.001 in the chi-square test.

[0030] The high-quality polymorphic SNP markers obtained were used for subsequent genetic map construction and QTL localization analysis.

[0031] 2.4 Genetic Map Construction and QTL Localization After obtaining high-quality SNP markers, a genetic linkage map was constructed using QTL IciMapping 4.2 software. Based on the constructed genetic linkage map and multi-environmental phenotypic data, QTL detection was performed using the Inclusive Composite Interval Mapping (ICIM) method in QTL IciMapping software.

[0032] 'TM-1' yielded 397,632,783 reads, and 'CRI50' yielded 482,306,868 reads, with sequencing depths of 38.12 X and 35.58 X for the two parents, respectively. A total of 12,706,578 reads were obtained from the population sample, with an average sequencing depth of 0.44 X, Q30 > 93.91%, and GC content around 35%, indicating successful library construction. A total of 1,649,308 high-quality SNP markers and 233,505 Indel markers were developed between the two parents. Homozygous and polymorphic SNPs and Indels were found between the parents: 795,212 and 109,115, respectively. By comparing and filtering the offspring markers with homozygous and polymorphic markers among the parents, 9,967 high-quality SNP markers and 360 Indels were obtained, which were used for subsequent genetic map construction and QTL localization analysis.

[0033] In this study, a total of 18 PH-related QTL loci were located. 25 NFFB-related QTL loci were located. 33 HNFFB-related QTL loci were located. 8 FT-related QTL loci were identified. A total of 24 QTL loci regulating BW were located. A total of 25 QTL loci regulating LP were located. Additionally, 23 QTL loci related to SI were identified. High-confidence QTLs in this study were mainly concentrated on chromosome D03.

[0034] Example 3: Identification of candidate genes Using phenotypic and SNP data related to early maturity and yield from 355 natural populations previously obtained in the laboratory (Li LB, Zhang C, Huang JQ, Liu QB, Wei HL, Wang HT, Liu GY, Gu LJ, Yu SX. 2021. Genomic analyses reveal the genetic basis of early maturity and identification of loci and candidate genes in upland cotton (Gossypium hirsutum L.). Plant Biotechnology Journal, 19, 109-123.), GWAS analysis was performed on chromosome D03. Based on the resequencing data of 355 upland cotton germplasms, a total of 402,421 SNPs were identified on chromosome D03. The significant locus rsD03-39518959 was found to be simultaneously mapped to four early maturity traits and also to the yield-related trait SI (Table 1), and this locus is connected to the left boundary rsD03_39518960 of qPlei-D03-1. Subsequently, an LD-block was constructed centered on rsD03-39518959. Within this LD-block, four SNPs exceeding the threshold were identified as early maturity or yield trait loci (Table 1), and the overlap with qPlei-D03-1 was 182.9 kb. A total of eight genes were located within the overlapping region (Ghicr24_D03G114000, Ghicr24_D03G114100, Ghicr24_D03G114200, Ghicr24_D03G114300, Ghicr24_D03G114400, Ghicr24_D03G114500, Ghicr24_D03G114600, Ghicr24_D03G114700). Based on the SNP annotation files obtained from the resequencing of the parents 'TM-1' and 'CRI50' in the previous RIL population, SNPs within a 2 kb range upstream and downstream of these 8 genes were searched. The results showed that only two genes contained SNPs (Table 2). To further investigate whether these SNPs have an impact on the phenotype, haplotypes were classified using these SNPs to examine their impact on natural population maturity and yield. When haplotypes were classified using the 202 bp upstream SNP of Ghicr24_D03G114200, significant differences were found in PH, WGP, and SI, and extremely significant differences were found in LP, while no differences were found in NFFB, HNFFB, FT, and BW. Figure 1When using two SNPs on the intron and exon of Ghicr24_D03G114700 to classify haplotypes, it was found that three haplotypes could be identified: Hap1 (CRI50 type) and Hap2 (TM-1 type). Except for no significant difference in LP, all six traits (PH, NFFB, HNFFB, FT, BW, and SI) reached highly significant levels. Figure 2 Therefore, both genes are potential candidate genes related to early maturity and yield. However, since Ghicr24_D03G114700 has better haplotype segmentation and its coding sequence contains a non-synonymous mutation site, it is chosen as a candidate gene for further investigation.

[0035] Table 1. Significant SNP sites in the linkage interval of rsGhir_D03_39518959

[0036] Table 2 Candidate genes in the overlapping region between the rsGhir_D03_39518959 linkage region and qPlei-D03-1

[0037] The Arabidopsis homolog of Ghicr24_D03G114700 (hereinafter referred to as GhCS10) is AT2G36850.1, with a similarity of 79.56%. AT2G36850.1 encodes callosin synthase 10 (AtCS10), a member of the glucan synthase-like (GSL) family. AtCS10 is essential for male gametophyte development and plant growth, and AtCS10 RNAi lines exhibit a distinct dwarfing phenotype.

[0038] Example 4: Development of KASP markers for candidate gene GhCS10 To verify the association between the GhCS10 gene and early maturity and yield, a KASP marker was developed based on a non-synonymous SNP (rsD03_39724473) in the GhCS10 coding region. Allele-specific forward primers (KASP-F1(GAAGGTGACCAAGTTCATGCTCAAACTCACATGATGGAATAT, SEQ ID No. 2) / KASP-F2(GAAGGTCGGAGTCAACGGATTCAAACTCACATGATGGAATAC, SEQ ID No. 3)) and reverse primers (KASP-R: TGGGGTGAAGCTGCAAATGTCCG, SEQ ID No. 4) with FAM and HEX fluorescent markers were designed using Primer Premier 5 and Phytozome software. Genotyping was performed on the LGC high-throughput genotyping platform (Shanghai Likong Biotechnology Co., Ltd.).

[0039] To investigate the genotyping of GhCS10 in the RIL population, this study successfully genotyped non-synonymous mutation sites of GhCS10 using the KASP technique. The population samples could be clearly divided into two haplotypes: FAM fluorescently labeled homozygous (Hap1: CRI50 type, n=98) and HEX fluorescently labeled homozygous (Hap2: TM-1 type, n=170). Figure 3 (a) The two haplotypes showed highly significant differences in all four early maturity traits and three yield traits (P<0.01). Figure 3 (bh in the middle). And consistent with the parental phenotype, Hap2 showed a significant increase in PH, HNFFB and NFFB, and a significant delay in FT; at the same time, BW and SI, which are yield components, were also significantly increased, while Hap1 showed a significantly higher LP.

[0040] Example 5: Expression pattern analysis of candidate genes The expression pattern of GhCS10 in various cotton tissues and during ovule and fiber development was examined, revealing a clear tissue-specific expression pattern. This gene is mainly expressed in vegetative organs and floral organs, with the highest expression levels in leaves and terminal buds, at relative levels of 266.54 and 249.61, respectively. High expression levels were also observed in roots, stems, cotyledons, receptacles, petals, and ovaries, ranging from 117.68 to 231.36. During ovule development, from -1 to 25 DPA, GhCS10 expression remained consistently at a medium-to-high level, between 93.00 and 162.67, peaking at 10–15 DPA. However, during fiber development (5–15 DPA), its expression remained extremely low, almost completely silent.

[0041] Example 6: Effects of GhCS10 on cotton early maturity and yield phenotype 6.1 Materials and Methods 6.1.1 Test Materials The function of candidate genes was validated using a VIGS system mediated by cotton leaf crumple virus (CLCrV). This system comprised three vectors (see Meng J, Gao H, Zhai W, Shi J, Zhang M, Zhang W, Jian G, Zhang M, Qi F. Subtle regulation of cotton resistance to Verticillium wilt mediated by MAPKK family members. Plant Science, 2018, 272:235-242.): pCLCrV:00 (empty vector, used as a negative control), pCLCrVB (helper vector, responsible for virus movement), and pCLCrV:GhCLH (positive control, silencing chlorophyll synthesis genes, resulting in leaf yellowing phenotype). All three vectors were kanamycin resistant. The cotton material used for infection was 'TM-1', grown in an artificial climate chamber under the following conditions: 16 h light / 28℃ and 8 h dark / 25℃.

[0042] 'Zhongmian Institute 49' was selected as the recipient material for GhCS10 genetic transformation. Hypocotyls were used as explants for genetic transformation. Agrobacterium tumefaciens strain LBA4404 was used as the engineered bacterium to introduce the target gene into cotton cells. The overexpression vector used was pCAMBIA1305-35S-GFP (see Zhu L, Wang H, Zhu J, Wang X, Jiang B, Hou L, Xiao G. A conserved brassinosteroid-mediated BES1-CERP-EXPA3 signaling cascade controls plant cell elongation. Cell Rep. 2023,42(4):112301.); the CRISPR / Cas9 gene editing vector used was pCAMBIA1300-Cas9 as the basic vector (see Wang P, Zhang J, Sun L, Ma Y, Xu J, Liang S, Deng J, Tan J, Zhang Q, Tu L, DaniellH, Jin S, Zhang X. High efficient multisites genome editing in allotetraploidcotton (Gossypium hirsutum) using CRISPR / Cas9 system. Plant Biotechnol J.2018,16(1):137-150.).

[0043] 6.1.2 Construction of VIGS and transgenic vector 6.1.2.1 Construction of VIGS Vector The coding sequence (CDS) of the target gene GhCS10 was obtained from the 'ZM24' reference genome. Specific amplification primers were designed using PrimerPremier 5.0 software. CLCrVA-GhCS10-SpeI-F:AGCAAAATGGCATGCCTGCAGACTAGTAGTTCAGTGGCCTTTGTTTC (SEQ ID No. 5); CLCrVA-GhCS10-AscI-R: ATTCACTAGACCTAGGGGCGCGCCGACGACCTTCATTTCTTGCT (SEQ ID No. 6), with an amplified fragment length of 462 bp. Enzyme restriction sites (Spe1, Asc1) and protective bases corresponding to the multiple cloning site of the pCLCrV vector were introduced at the 5' ends of the upstream and downstream primers, respectively. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0044] PCR amplification was performed using cDNA from 'TM-1' leaves as a template. The reaction mixture (50 μL) consisted of: 25 μL 2× buffer (PhantaFlash Buffer, Novizan), 2 μL each of forward and reverse primers (10 μM), 2 μL template cDNA, 1 μL Phanta Flash Super-Fidelity DNA Polymerase (Novizan, catalog number: P521-d1), and ddH2O to a final volume of 50 μL. The amplification program was: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 1 min. After PCR product detection by 1.5% agarose gel electrophoresis, the target band was excised and purified using a gel extraction kit (Tiangen Biotech, Beijing), following the kit's instructions. The purified product was then processed using In-Fusion... TM The Advantage PCR Cloning Kit (Clontech, USA) was used to ligate the pCLCrV vector into a linearized pCLCrV vector, constructing a pCLCrV:GhCS10 recombinant plasmid driven by the 35S promoter. The ligation product was transformed into *E. coli* DH5α competent cells, and single colonies were picked for colony PCR identification. Positive clones were sent to Qingke Biotechnology (Shanghai) Co., Ltd. for sequencing verification. After amplification of correctly sequenced clones, plasmids were extracted using a plasmid extraction kit (Tiangen Biotech, Beijing) and stored at -20℃ for later use.

[0045] pCLCrV:GhCS10, pCLCrV:00, pCLCrV:GhCLH, and pCLCrVB were transformed into Agrobacterium LBA4404 competent cells using a freeze-thaw method. Single colonies were picked and inoculated into 1 mL of LB broth containing kanamycin (50 mg / L) and cultured overnight at 28°C with shaking at 220 rpm. After confirmation by PCR, 1 mL of the bacterial culture was added to an equal volume of 30% sterile glycerol and stored at -80°C for later use.

[0046] 6.1.2.2 Construction of transgenic vectors Total RNA from 'TM-1' leaves was reverse transcribed to synthesize the first strand of cDNA. Specific primers (1305-GhCS10-SpeI-F:GCCCAGATCAACTAGTATGGCTAGGGTTTTAAAAAACTGGG (SEQ ID No. 7); 1305-GhCS10-XbaI-R:TCGAGACGTCTCTAGAGACGACCTTCATTTCTTGCT (SEQ ID No. 8)) were designed based on the open reading frame sequence of the target gene GhCS10. The CDS sequence of the target gene was amplified by high-fidelity enzyme PCR. The target gene fragment was double-digested with restriction endonucleases Xba I and Sac I, recovered, and ligated into the similarly linearized pCAMBIA1305-35S-GFP vector. The ligation was performed on *E. coli* DH5α, and the recombinant plasmid was preserved after colony PCR and double digestion verification. For CRISPR / Cas9 gene editing, specific sgRNAs were designed in the exon regions of the target gene using the CRISPR-P 2.0 online tool. Target 1 sgRNA: AGAGAGCAGCUCAGAGAUGCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc (SEQ ID No. 9); Target 2 sgRNA: AGAAGACCAAGUGGGAUCGCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc (SEQ ID No. 10); The synthesized target oligonucleotide chain was annealed and ligated into the Bsa I-linearized pCAMBIA1300-Cas9 vector, and the correctness was verified by sequencing. The correctly sequenced overexpression vector and CRISPR / Cas9 recombinant plasmid were transformed into Agrobacterium LBA4404 competent cells by freeze-thaw method, respectively. The cells were plated on YEB plates containing the corresponding antibiotics (50 mg / L kanamycin, 25 mg / L rifampin), incubated at 28°C, and single clones were picked for colony PCR verification. Positive clones were used for subsequent genetic transformation.

[0047] 6.1.3 VIGS virus inoculation and transgenic genetic transformation 6.1.3.1 VIGS virus inoculation Select plump and uniform 'TM-1' seeds and sow them in nutrient soil (nutrient soil: vermiculite = 3:1). Incubate in an artificial climate chamber (28 ℃, 16 h light / 8 h dark, light intensity 200 μmol·m²). -2 ·s -1 (Relative humidity 60%). Infection was carried out when the cotyledons were fully expanded; in this study, the infection time was 8 days after sowing.

[0048] Three days prior to the experiment, bacterial suspensions containing pCLCrV:GhCS10, pCLCrV:00, pCLCrV:GhCLH, and the helper vector pCLCrVB were streaked onto LB solid medium containing the corresponding antibiotics (50 mg / L kanamycin, 25 mg / L rifampin) and incubated at 28°C for 2 days to activate the bacteria. Single colonies were picked and inoculated into 1.5 mL of LB liquid medium containing the corresponding antibiotics (50 mg / L kanamycin, 25 mg / L rifampin) and incubated overnight at 28°C with shaking at 220 rpm. The activated bacterial suspensions were then transferred at a 1:100 ratio to 50 mL of LB liquid medium containing the corresponding antibiotics (50 mg / L kanamycin, 25 mg / L rifampin) and incubated at 28°C with shaking at 220 rpm until OD500 was reached. 600 ≈0.8~1.2. Centrifuge at 8000 rpm for 2 min at room temperature, discard the supernatant and collect the bacterial cells. Resuspend the bacterial pellet in infection resuspension buffer (10 mM MES, pH 5.6, containing 10 mM MgCl2 and 200 μM acetylsylcholine), and adjust the OD. 600 Adjust the value to 1.0. After standing at room temperature for 3 hours, mix equal volumes of bacterial suspension according to the following combination: Negative control group: pCLCrV: 00 + pCLCrVB; Positive control group: pCLCrV:GhCLH+pCLCrVB; Experimental group: pCLCrV:GhCS10+pCLCrVB.

[0049] Using a 1 mL needleless syringe, draw up the mixed bacterial solution and inject it into the leaf tissue from both sides of the midrib on the underside of the cotton cotyledons, ensuring the solution fills the entire cotyledon and the leaf appears water-soaked. Inject two cotyledons per plant. After infection, cover the seedlings in the dark and treat them for 12 hours, then transfer them to a greenhouse to resume normal light and culture conditions.

[0050] 6.1.3.2 Cotton genetic transformation Select plump cotton seeds, remove the seed coat, and disinfect them with 75% ethanol for 30 seconds and 0.1% H2O2 for 8-10 minutes. Rinse with sterile water 4-5 times, inoculate onto 1 / 2 MS medium, and culture in the dark for 3-5 days, then transfer to light. When the hypocotyl elongates to 5-7 cm, cut 0.5-0.8 cm segments as explants and inoculate them onto callus induction medium (MS + 2 mg / L 2,4-D + 0.5 mg / L KT + 30 g / L sucrose + 2.5 g / L plant gel, pH 5.8). Induce callus formation in the dark at 25℃, subculturing every 3-4 weeks to obtain embryogenic callus. Culture the activated Agrobacterium to OD... 600 =0.6~0.8, after centrifugation to collect bacterial cells, adjust OD with MS liquid resuspending buffer containing 100 μmol / L acetylsuccinone. 600 The bacterial concentration was increased to 0.4-0.6. The cotton embryogenic callus was then immersed in the bacterial solution for 15-20 min. After blotting the surface bacterial solution with sterile filter paper, it was inoculated onto a co-culture medium (MS + 2 mg / L 2,4-D + 0.5 mg / L KT + 100 μmol / L acetosyringone, pH 5.8) and incubated in the dark at 22°C for 48-72 h. The co-cultured callus was then transferred to a selection medium (MS + 2 mg / L 2,4-D + 0.5 mg / L KT + 50 mg / L kanamycin or 25 mg / L hygromycin + 500 mg / L cephalosporin, pH 5.8) and incubated in the dark at 25°C to select resistant callus. Subculture was performed every 3-4 weeks until resistant callus was obtained. Resistant callus was transferred to differentiation medium (MS + 0.5 mg / L IBA + 0.5 mg / L KT + 0.5 g / L glutamine + 0.1 g / L asparagine + 50 mg / L kanamycin or 25 mg / L hygromycin, pH 5.8) and cultured under light to induce adventitious buds and somatic embryogenesis. Differentiated embryoids were transferred to germination medium (MS + 0.1 mg / L IBA + 0.1 mg / L GA3, pH 5.8) to induce germination. When seedlings reached 3-4 true leaves, they were transferred to rooting medium (1 / 2 MS + 0.1 mg / L IBA, pH 5.8) to induce rooting. After rooting, harden off the seedlings for 3-5 days, then transplant them into sterile nutrient soil and cultivate them in an artificial climate chamber (16 h light / 8 h darkness, 28℃ temperature, 60-70% relative humidity). After that, acclimatize them and transplant them to a greenhouse or field.

[0051] 6.1.4 VIGS silencing efficiency and transgenic plant detection 6.1.4.1 VIGS Silence Efficiency Test Twenty-one days post-infection (after the etiolation phenotype stabilized), the second true leaf from the top of the plants in both the experimental and negative control groups was immediately flash-frozen in liquid nitrogen and stored at -80 °C for later use. Three biological replicates were collected for each treatment, with each replicate consisting of leaves from three plants. Total RNA was extracted using the FastPure® Universal Plant TotalRNA Isolation Kit (catalog number: RC411-01) from Nanjing Novizan Biotechnology Co., Ltd. Intact and highly pure RNA was used for reverse transcription, following the procedures outlined in the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, RR047).

[0052] 6.1.4.2 Statistical analysis of early maturity and yield-related phenotypes in silent plants Agronomic traits were investigated in the experimental group (pCLCrV:GhCS10) and the negative control group (pCLCrV:00) at the cotton flowering and boll opening stages. Three independent biological replicates were set up for each treatment, with each replicate containing nine cotton plants. Traits investigated included FT, NFFB, HNFFB, PH, BW, LP, and SI.

[0053] To quantitatively analyze the effect of GhCS10 silencing on callose deposition levels in cotton leaves, this study used the plant callose enzyme-linked immunosorbent assay kit (catalog number: RJ23275, Shanghai Renjie Biotechnology Co., Ltd.) for detection.

[0054] 6.2 Results and Analysis 6.2.1 Phenotypic changes in GhCS10 VIGS silent plants To specifically elucidate the function of GhCS10 in cotton growth and development, this study used VIGS technology to construct GhCS10-silenced lines in cotton, with empty vector and GhCLH-silenced lines serving as negative and positive controls, respectively. At the budding stage, the yellowing phenotype of CLCrV-GhCLH remained evident. qRT-PCR results showed that GhCS10 expression in the CLCrV-GhCS10 lines was significantly downregulated compared to the control, accompanied by significant changes in plant type and growth stage. Figure 4 (a, b) In this context, compared with the control, the plant height of the GhCS10 silent line was significantly reduced ( Figure 4 In the c), the length of a fully developed intersegment is significantly shortened ( Figure 4 In the d), both NFFB and HNFFB were significantly reduced ( Figure 4 (e, f), and the budding stage (SP) is significantly advanced ( Figure 4 g in (the middle part).

[0055] To further elucidate the function of GhCS10 in cotton reproductive development and yield formation, this study conducted statistical analyses of flowering phenotypes and yield-related traits at maturity for CLCrV-GhCS10 and the Vector control. At the flowering stage, compared to the control, the CLCrV-GhCS10 lines showed significantly shorter plants, approximately 15 cm shorter, and a highly significant earlier first flowering (FT). Figure 5 The ac in the middle), about 4 days earlier. The aboveground dry weight and fresh weight of CLCrV-GhCS10 at the flowering period were statistically analyzed, and it was found that both were significantly lower than those of the control (ac). Figure 5 (d and e in the text). Regarding yield-related traits, BW and SI were both significantly lower than the control, while LP was significantly higher (…). Figure 5 The fh in the figure indicates that GhCS10 has a negative regulatory effect on cotton maturity and LP, and a positive regulatory effect on BW, SI and biomass accumulation.

[0056] 6.2.2 Preliminary functional verification of candidate genes in early maturity and yield regulation Since the homolog of GhCS10 in Arabidopsis thaliana, AT2G36850.1, encodes callose synthase 10, this study further detected the callose content in CLCrV-GhCS10 and the empty vector control. At the 6-leaf stage, when the yellowing phenotype of the positive control was stable, the CLCrV-GhCS10 line also exhibited a significant dwarfing phenotype. Figure 6 (a) At this point, samples were taken to measure the callose content. The results showed that the callose content of the CLCrV-GhCS10 line in internodes and leaf tissues was significantly lower than that of the control, at 168.41 μg / g and 165.78 μg / g, respectively, while the callose content of the corresponding tissues in the control was 210.58 μg / g and 270.33 μg / g, respectively. Figure 6 (b) This indicates that GhCS10 also participates in callose synthesis in cotton.

[0057] The changes in sucrose and starch content in different tissues, including leaves, petioles, stems, and terminal buds, of the CLCrV-GhCS10 line and the control were further determined. The results showed that, compared with the control, the sucrose content in the leaves, petioles, and terminal buds of the CLCrV-GhCS10 silent line was significantly increased, with an increase of approximately 33.44% in leaves (P<0.05), and increases of 81.76% and 52.95% in petioles and terminal buds, respectively (P<0.01). There was no significant difference in sucrose content in the stems. However, the starch content in all tissues of the silent line was significantly lower than that of the control, with the largest decrease in starch content in the petioles, only 59.40% of the control (P<0.01). The starch content in leaves, stems, and terminal buds also decreased by 6.00%–39.28% (P<0.05 or P<0.01), respectively. The above results indicate that GhCS10 silencing significantly altered the carbon allocation pattern of cotton plants, promoted the accumulation of sucrose in source organs (leaves) and sink organs (apical buds), and inhibited the synthesis and accumulation of starch in various tissues, suggesting that GhCS10 may play a key regulatory role in sucrose transport and starch metabolism in cotton.

[0058] 6.2.3 Identification of GhCS10 overexpression and knockout phenotypes in cotton To further verify the function of GhCS10 in regulating cotton growth, development, and flowering, this study constructed GhCS10 overexpression lines (OE-1, OE-2) and knockout lines (C-1, C-2) using 'CRI49' as the receptor material, and performed phenotypic statistical analysis with wild-type (WT) as the control. Phenotypic observation showed that, compared with WT, the GhCS10 overexpression lines exhibited increased pH and delayed FT, while the knockout lines showed significantly dwarfed plants and significantly earlier flowering time. Figure 7 (a and b in the text). Quantitative analysis results showed that the FT of the overexpressing lines was significantly delayed by 6-7 days compared to WT, the pH was significantly increased by 10-12 cm, and HNFFB and NFFB were significantly increased by 11-13 cm and 2-3 cm, respectively. Figure 7 The knockout lines showed the opposite phenotype, with FT significantly shortened by 3-4 days compared to WT, pH significantly decreased by 9-12 cm, and NFFB and HNFFB significantly decreased by 1-2 and 2-3 cm, respectively. Figure 7 The results above are highly consistent with the conclusions of the previous VIGS silencing experiment, further confirming that GhCS10 negatively regulates pH and positively regulates FT in cotton, and participates in plant architecture and flower bud differentiation by regulating NFFB and HNFFB. It is a key gene that regulates the transition from vegetative growth to reproductive growth in cotton.

[0059] 6.2.4 Effects of GhCS10 transgenic on early maturity and yield traits At maturity, the yield phenotypes of the GhCS10 transgenic lines were analyzed. The results showed that the yield (BW) of the overexpressing lines was significantly increased by 0.28–0.32 g compared to the WT lines, while that of the knockout lines was significantly decreased by 0.51–1.18 g. Figure 8 (b) The overexpression line LP showed a significant decrease of 2.45%–2.71% compared to WT, while the knockout line showed a highly significant increase of 1.89%–2.55%. Figure 8 c); SI showed a trend consistent with BW, with the overexpressing lines showing a highly significant increase in SI (1.14–3.08 g) compared to WT, while the knockout lines showed a significant decrease in SI (0.72–0.79 g) compared to WT. Figure 8 (d in the text). These results indicate that GhCS10 plays an important regulatory role in the genetic regulation of cotton yield components.

[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications are possible without departing from the technical solutions described in the claims.

[0061] GhCS10:

Claims

1. A method for promoting early maturity and increasing lint content in cotton based on the GhCS10 gene, characterized in that, By knocking out or silencing the GhCS10 gene on the cotton D03 chromosome, early maturity of cotton is promoted, while lint content is increased.

2. The method according to claim 1, characterized in that, The nucleotide sequence of the GhCS10 gene is shown in SEQ ID No.

1.

3. The method according to claim 1, characterized in that, The cotton variety in question is upland cotton.

4. The application of the GhCS10 gene on cotton chromosome D03 in regulating early maturity of cotton, characterized by, The nucleotide sequence of the GhCS10 gene is shown in SEQ ID No.

1.

5. The application of the GhCS10 gene on cotton chromosome D03 in increasing cotton lint content, characterized in that, The nucleotide sequence of the GhCS10 gene is shown in SEQ ID No.

1.

6. An amplification primer for the KASP marker on chromosome D03 for breeding early-maturing and high-leaf cotton varieties, characterized in that, include: Forward primer F1 with FAM fluorescent label: GAAGGTGACCAAGTTCATGCTCAAACTCACATGATGGAATAT; Forward primer F2 with HEX fluorescent label: GAAGGTCGGAGTCAACGGATTCAAACTCACATGATGGAATAC; Reverse primer: TGGGGTGAAGCTGCAAATGTCCG.

Images