A method, kit, and application for detecting spinal muscular atrophy carriers based on single-chromosome digital droplet PCR.

By combining single chromosome isolation with ddPCR, the SMN1 gene phase can be directly identified, solving the problem of missed detection in the screening of SMA 2+0 carriers in existing technologies. This enables efficient and economical universal testing for the entire population and is suitable for screening carriers of spinal muscular atrophy.

CN122303394APending Publication Date: 2026-06-30邹军
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610377067.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-25
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies cannot effectively identify carriers of spinal muscular atrophy (SMA) type 2+0, resulting in a high rate of missed detections in screening. They are not suitable for large-scale population screening, and existing methods are subject to gender and racial restrictions, and are either costly or cumbersome to operate.

Method used

By employing a method combining single chromosome isolation and digital droplet PCR (ddPCR), the SMN1 gene phase is identified through a specific probe. Combined with internal reference gene calibration, the copy number of the SMN1 gene on a single chromosome is directly detected, achieving accurate screening.

Benefits of technology

It enables screening of SMA 2+0 carriers across all genders and ethnicities, reduces the false negative rate, is low-cost, suitable for clinical application, and improves the sensitivity and specificity of the test.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303394A_ABST
    Figure CN122303394A_ABST
Patent Text Reader

Abstract

This invention discloses a method, kit, and application for detecting carriers of spinal muscular atrophy (SMA) based on single-chromosome digital droplet PCR. This study utilizes single-chromosome suspension preparation technology combined with an SMN1 exon 7 specific probe (distinguishing c.840C>T) for digital droplet PCR to detect the presence of the SMN1 gene on a single chromosome 5. This establishes a novel method for detecting SMA 2+0 carriers based on single-chromosome digital droplet PCR technology. This method can specifically identify the presence or absence of the SMN1 gene on a single chromosome, accurately distinguishing between SMA 2+0 carriers and individuals with normal genotypes, significantly improving the accuracy and detection rate of SMA carrier screening. It is particularly suitable for identifying occult carriers that are difficult to detect using conventional methods, providing a reliable technical means for clinical genetic screening of SMA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and medical detection technology, specifically to a method, kit, and application for detecting carriers of spinal muscular atrophy based on single-chromosome digital droplet PCR. Background Technology

[0002] Spinal muscular atrophy (SMA), an autosomal recessive neurodegenerative disease, is one of the most common genetic causes of infant mortality. Its pathogenesis lies in the loss of function of the survival motor neuron 1 (SMN1) gene on the long arm of chromosome 5, region 1, band 3 (5q13.2). This region has a complex structure and contains a highly homologous survival motor neuron 2 (SMN2) gene, with a sequence similarity of 99.9%, differing only by a single base at position 840 in exon 7 (SMN1: c.840C; SMN2: c.840T). This crucial difference causes the majority of the SMN2 gene transcript to skip exon 7, producing only a small amount (approximately 10%) of functional SMN protein. When both SMN1 alleles in an individual are lost to function (approximately 96% homozygous deletion), severe deficiency of SMN protein leads to degeneration of the anterior horn motor neurons in the spinal cord, muscle atrophy, and in severe cases, respiratory failure and even death.

[0003] Given the heavy disease burden of SMA and the extremely high cost of emerging therapies (such as nusinersen and Zolgensma gene therapy), large-scale population carrier screening and prenatal diagnosis have become the most effective and economical public health strategy for preventing SMA birth defects and reducing the social and family burden.

[0004] Currently, widely used clinical screening technologies for SMA carriers, such as allele-specific PCR, multiplex ligation-dependent probe amplification (MLPA), and copy number analysis based on next-generation sequencing (NGS), primarily target the copy number of exon 7 (E7) of the SMN1 gene. These technologies can accurately identify the vast majority of carriers, the "1+0" carriers (i.e., one chromosome carries one copy of SMN1, and the other chromosome carries zero copies). However, approximately 3%-8% of the population are "2+0" carriers, who carry two copies of SMN1 on one chromosome, while the other chromosome is completely absent. These individuals, when tested using conventional techniques, show a total SMN1 copy number of 2, indistinguishable from phenotypically normal "1+1" carriers, resulting in significant missed diagnoses. Studies estimate that existing screening strategies, due to their inability to identify 2+0 carriers, carry a residual risk of 1.7%-9%, constituting a major technical gap in the SMA prevention system.

[0005] To address this challenge, existing technological solutions all have significant limitations:

[0006] 1. Family linkage analysis: This method infers haplotype by tracing short tandem repeat (STR) markers linked to the SMN1 gene. Although it can effectively identify 2+0 carriers when family information is complete, it heavily relies on DNA samples from multiple generations and family members. It is ineffective for single-birth families, families with incomplete family information, or cases of new mutations, and the operation is cumbersome, making it unsuitable for large-scale screening.

[0007] 2. SNP marker detection method: This method uses specific single nucleotide polymorphisms (SNPs, such as g.27134T>G) linked to repeat alleles of the SMN1 gene for indirect inference. However, the linkage strength of this SNP with the 2+0 type is strongly ethnically dependent. In Caucasian and Asian populations, the linkage disequilibrium coefficient (D') is extremely low (approximately 0.2-0.3), resulting in a detection sensitivity of less than 10%. Even in African populations with strong linkage, approximately 20% of individuals with the 1+0 type carry this SNP, leading to a high false positive rate and a decreased positive predictive value (PPV). Therefore, this method lacks universality.

[0008] 3. Long-read sequencing (LRS): Technologies such as PacBio HiFi or Oxford Nanopore can directly resolve the sequences of *SMN1 / SMN2* homologous regions and determine phase. However, its cost is extremely high (approximately 5-10 times that of short-read sequencing), data analysis is complex, it requires specialized bioinformatics algorithms (such as Paraphase), and it is currently mostly limited to small-sample validation, making it difficult to apply on a large scale in clinical screening.

[0009] 4. DMC-ddPCR technology: This technology determines the 2+0 carrier type by detecting the SMN1 copy number of a single sperm cell (representing a single chromosome) in a male semen sample. Although it cleverly utilizes the principle of chromosome segregation during meiosis, its applicability is strictly limited to men, and the compliance rate of semen sample collection is poor. The processing procedure is also special, making it unsuitable for screening female carriers, who make up half of the population.

[0010] In conclusion, those skilled in the art urgently need to develop a new, accurate, economical, and easily clinically applicable SMA 2+0 carrier detection technology that can overcome gender and racial limitations, in order to fill the gaps in the existing screening system and truly achieve comprehensive coverage of SMA prevention. Summary of the Invention

[0011] This study aims to develop a novel technique combining single chromosome isolation and ddPCR (digital droplet PCR) for the accurate detection of carriers of spinal muscular atrophy type 2+0 (SMA). This technique directly identifies the phase information of the SMN1 gene by physically isolating chromosome 5 and combining it with a specific probe of exon 7 of the SMN1 gene. This overcomes the problem of missed detection in existing screening methods for type 2+0 carriers, improving the coverage of SMA carrier screening and enabling universal detection across the entire population. This provides more accurate evidence for genetic counseling and prenatal diagnosis, promotes technological innovation in screening for SMA and other recessive genetic diseases, and offers new means for precise disease prevention and control.

[0012] Therefore, embodiments of the present invention provide a method, kit, and application for detecting carriers of spinal muscular atrophy based on single-chromosome digital droplet PCR.

[0013] According to a first aspect of the present invention, the present invention provides a method for detecting carriers of spinal muscular atrophy based on single-chromosome digital droplet PCR, the method comprising the following steps:

[0014] (1) Prepare a chromosome suspension containing a free single chromosome of the subject;

[0015] (2) Using the chromosome suspension prepared in step (1) as a template, digital droplet PCR amplification is performed, wherein the primers and probes used for the amplification include at least:

[0016] The first detection system includes primers for specifically amplifying the SMN1 gene and a probe containing a first distinguishable fluorescent marker and a first quenching portion;

[0017] The second detection system includes primers for specifically amplifying the SMN2 gene and a probe containing a second distinguishable fluorescent marker and a second quenching portion;

[0018] An internal reference gene detection system, which includes primers for amplifying the internal reference gene and probes containing a third distinguishable fluorescent marker and a third quenching portion;

[0019] (3) Collect the amplified fluorescence signal and determine the SMN1 genotype of the subject based on the number of positive droplets in each detection system.

[0020] Further, in step (3), the judgment includes: performing concentration correction on the original positive droplet count based on the Poisson distribution algorithm, and / or directly calculating the judgment index F value based on the positive droplet count of each detection system, wherein the formula for calculating the F value is F = N 第一 / 第三 / N 第二 / 第三 N 第一 / 第三 N refers to the number of droplets that are positive in both the first and third distinguishable fluorescent marker channels. 第二 / 第三The number of droplets that are positive in both the second and third distinguishable fluorescent marker channels.

[0021] Furthermore, in step (3), the criterion for determining the result of the judgment is:

[0022] When the F value is 0.9 to 1.1, the examinee is considered to be a normal person with spinal muscular atrophy;

[0023] When the F value is 0.4 to 0.6, the examinee is determined to be a carrier of spinal muscular atrophy.

[0024] Further, in step (1), the method for preparing the chromosome suspension containing free single chromosomes is a hypotonic-lysis chemical separation method, specifically including the following steps:

[0025] (a) Cell culture and mid-term synchronization: Peripheral blood lymphocytes or amniotic fluid cells were obtained from the subject and cultured. Colchicine was added before the culture was terminated for mid-term synchronization.

[0026] (b) Cell collection and pre-washing: Collect synchronized cells, centrifuge and lyse to remove red blood cells, and wash with pre-cooled buffer;

[0027] (c) Hypotonic treatment: Add hypotonic solution to the washed cell pellet, mix well and then treat with water bath;

[0028] (d) Chromosome release: Centrifuge the cells after hypotonic treatment and discard the supernatant; add chromosome release buffer to the precipitate to resuspend, incubate on ice, vortex, centrifuge again, and collect the supernatant containing free single chromosomes, which is the chromosome suspension.

[0029] And / or, in step (a), the concentration of colchicine used for treatment is 0.05~0.1 μg / mL, and the treatment time is 4~16 hours; in step (c), the hypotonic solution is 75 mmol / L KCl solution, and the water bath treatment time is 15~30 minutes; in step (d), the chromosome release buffer is polyamine buffer, the ice bath standing time is 10~20 minutes, the vortexing time is 15~30 seconds, and the conditions for the second centrifugation are 4℃, 200~300g centrifugation for 5~10 minutes.

[0030] Furthermore, the first distinguishable fluorescent marker, the second distinguishable fluorescent marker, and the third distinguishable fluorescent marker are different from each other and their spectra are distinguishable. The first quenching portion, the second quenching portion, and the third quenching portion are selected from non-fluorescent quenchers, fluorescence resonance energy transfer quenchers, or deep quenchers.

[0031] Preferably, the quenching portion is at least one of MGB-NFQ, BHQ series, Dabcyl, or Iowa Black.

[0032] More preferably, the first distinguishable fluorescent marker is FAM, and the quenching portion is NFQ-MGB or BHQ2; the second distinguishable fluorescent marker is VIC or HEX, and the quenching portion is NFQ-MGB or BHQ2; and the third distinguishable fluorescent marker is Cy5 or JUN, and the quenching portion is NFQ-MGB or BHQ2.

[0033] Furthermore, the sequences of the primers and probes are as follows:

[0034] SMN1-F: AATGCTTTTTAACATCCATATAAAGCT;

[0035] SMN1-R: CCTTAATTTAAGGAATGTGAGCACC;

[0036] SMN1-Probe: First distinguishable fluorescent marker - CAGGGTTTCAGACAAA-quenched portion;

[0037] SMN2-F: Same as SMN1-F;

[0038] SMN2-R: Same as SMN1-R;

[0039] SMN2-Probe: Second distinguishable fluorescent marker - TGATTTTGTCTAAAACC - quenched portion;

[0040] The internal reference gene is GDNF, and its primer and probe sequences are as follows:

[0041] GDNF-F:ACTCCACTAGGCCATTGAGGTTA;

[0042] GDNF-R:ACCACCAGTGCGGAATTAGC;

[0043] GDNF-Probe: Third distinguishable fluorescent marker -TTCTCCTGTACTCTGTGCCGCCTTCCA-quenched portion.

[0044] Furthermore, the first distinguishable fluorescent marker is FAM, and the quenched portion is NFQ-MGB; the second distinguishable fluorescent marker is VIC, and the quenched portion is NFQ-MGB; and the third distinguishable fluorescent marker is Cy5, and the quenched portion is BHQ2.

[0045] According to a second aspect of the present invention, the present invention provides a kit for detecting carriers of spinal muscular atrophy, the kit comprising:

[0046] The primers and probes mentioned above;

[0047] And reagents for preparing single chromosome suspensions, said reagents being selected from at least one of: colchicine solution, hypotonic solution, erythrocyte lysis buffer, and chromosome release buffer.

[0048] According to a third aspect of the present invention, the present invention provides the use of the method as described in any of the preceding claims, or the kit described above, in the preparation of a product for screening carriers of spinal muscular atrophy.

[0049] According to a fourth aspect of the present invention, the present invention provides a method for detecting copy number variations of a target gene based on single-chromosome digital droplet PCR, comprising the steps described in any of the preceding claims, for detecting genetic diseases caused by gene duplication, deletion or conversion.

[0050] The embodiments of the present invention have the following advantages:

[0051] 1. This invention is the first to achieve effective screening of SMA 2+0 carriers across all sexes and ethnicities. By physically separating chromosomes, it completely eliminates the reliance on family history, ethnic-specific SNPs, or specific sample types (such as semen), overcoming the fundamental limitations of existing technologies.

[0052] 2. This invention directly analyzes gene phases using single-chromosome isolation technology, eliminating phase ambiguity at its source. Combined with the absolute quantification capabilities of ddPCR and internal reference gene calibration, it achieves precise quantification of gene copy numbers on a single chromosome, significantly improving detection sensitivity and specificity and minimizing false negatives.

[0053] 3. Compared to costly long-read sequencing technologies, the kit of this invention is primarily based on a mature PCR technology platform, significantly reducing costs. Its standardized operating procedures, presented in kit form, make it highly suitable for large-scale application and promotion in clinical laboratory departments, demonstrating extremely high market commercialization potential.

[0054] 4. The kit provided by this invention can be used as an independent and accurate method for confirming SMA carrier status (2+0), and also as a supplement to the existing SMA screening process. It can perform secondary accurate typing of individuals with a SMN1 copy number of 2 in routine screening, greatly improving the detection capability and clinical value of the overall screening program.

[0055] 5. The technical paradigm of combining single chromosome isolation and ddPCR established in this invention provides a new and referable technical approach for solving the problem of carrier detection of other genetic diseases (such as thalassemia, G6PD deficiency, etc.) caused by complex repetitive sequences or phase ambiguity. Attached Figure Description

[0056] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0057] Figure 1 This is a schematic diagram of the principle of the present invention. When a single chromosome is placed into ddPCR, the droplet containing the single chromosome will show fluorescence labeled by the corresponding probe of the gene on the chromosome.

[0058] Figure 2 The present invention provides the following: Isolation of single chromosomes from peripheral blood and amniotic fluid cells; A. Microscopic observation of peripheral blood cells and amniotic fluid cells after metaphase and stained with Gimsa; B. Microscopic observation of metaphase peripheral blood cells and amniotic fluid cells stained with DAPI and stained with fluorescence (left), and microscopic observation of the prepared single chromosome suspension stained with DPAI (middle and right).

[0059] Figure 3 The following are the verification results of the SMN1, SMN2, and GDNF primers and probes provided for this invention: A. SMN1 / SMN2 primer amplification products verified by Sanger sequencing; B. SMN1 / SMN2 primer amplification specificity verified by melting curve method; C. SMN1 / SMN2 primer and probe combination detected genomic DNA by Taqman probe method; D. GDNF primer amplification products verified by Sanger sequencing; E. GDNF primer amplification products verified by melting curve method; F. GDNF primer amplification specificity verified by melting curve method; G. GDNF primer and probe combination detected genomic DNA by Taqman probe method.

[0060] Figure 4 A diagram of constructing a chromosome simulation plasmid provided for this invention.

[0061] Figure 5 shows the number of fluorescent droplets in each channel of the simulated SMN1-SMN2 plasmid ddPCR provided by this invention; A. Detection result of fluorescent droplets in the FAM channel (blue, SMN1) in the ddPCR results; B. Detection result of fluorescent droplets in the VIC channel (green, SMN2) in the ddPCR results; C. Detection result of fluorescent droplets in the Cy5 channel (red, GDNF) in the ddPCR results.

[0062] Figure 6 shows the number of fluorescent droplets in each channel of the simulated Non-SMN1 plasmid ddPCR provided by the present invention; A. Detection result of fluorescent droplets in the FAM channel (blue, SMN1) in the ddPCR results; B. Detection result of fluorescent droplets in the VIC channel (green, SMN2) in the ddPCR results; C. Detection result of fluorescent droplets in the Cy5 channel (red, GDNF) in the ddPCR results.

[0063] Figure 7 shows the number of fluorescent droplets in each channel of the carrier simulation group (1:1 mixture) ddPCR provided by the present invention; A. Detection result of fluorescent droplets in the FAM channel (blue, SMN1) in the ddPCR results; B. Detection result of fluorescent droplets in the VIC channel (green, SMN2) in the ddPCR results; C. Detection result of fluorescent droplets in the Cy5 channel (red, GDNF) in the ddPCR results.

[0064] Figure 8 A family genealogy chart of 2+0 carriers provided for this invention.

[0065] Figure 9 The probability of SMA in offspring of a 1+0 carrier and a 2+0 carrier, as provided by this invention.

[0066] Figure 10 shows the number of fluorescent droplets in each channel of the 2-copy 1+1 type ddPCR provided by the present invention; A. Detection result of fluorescent droplets in the FAM channel (blue, SMN1) in the ddPCR results; B. Detection result of fluorescent droplets in the VIC channel (green, SMN2) in the ddPCR results; C. Detection result of fluorescent droplets in the Cy5 channel (red, GDNF) in the ddPCR results.

[0067] Figure 11 shows the detection results of each channel of ddPCR for 1-copy carriers provided by the present invention; A. Detection results of fluorescent droplets in the FAM channel (blue, SMN1) in ddPCR results; B. Detection results of fluorescent droplets in the VIC channel (green, SMN2) in ddPCR results; C. Detection results of fluorescent droplets in the Cy5 channel (red, GDNF) in ddPCR results.

[0068] Figure 12 shows the detection results of each channel of ddPCR for 2-copy 2+0 carriers provided by the present invention; A. Detection results of fluorescent droplets in the FAM channel (blue, SMN1) in ddPCR results; B. Detection results of fluorescent droplets in the VIC channel (green, SMN2) in ddPCR results; C. Detection results of fluorescent droplets in the Cy5 channel (red, GDNF) in ddPCR results. Detailed Implementation

[0069] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0070] Main instruments and reagents

[0071] Low-temperature centrifuge: Thermo Fisher Scientific; MAP16 chip plate: Thermo Fisher Scientific; 1.5ml centrifuge tube: Axygen; 200ul PCR tube: Axygen; Digital PCR instrument: Thermo Fisher Scientific; Incubator: Thermo Forma; Vortex mixer: Lepu Technology Vortex-5; Fluorescence microscope: Mingmei Optoelectronics; Centrifuge: Xiangyi H2050R; Digital PCR MIX kit: Thermo Fisher Scientific; Primers and probes: Qingke Biotechnology; KCL: Solarbio; Polyamine buffer (spermine, spermidine, etc.): Solarbio; β-mercaptoethanol, EDTA (optional): Solarbio; Pipes buffer: Solarbio; Phosphate-buffered saline (PBS): Thermo Fisher Scientific; Colchicine: Thermo Fisher Scientific Scientific; Peripheral blood culture medium: Sewell GMN-1640-PB; Erythrocyte lysis buffer: Beyotime; DAPI staining solution: Thermo D21490.

[0072] Example 1: Study on the detection method of SMA 2+0 carriers using single-chromosome ddPCR technology

[0073] This study utilized single-chromosome suspension technology combined with an SMN1 exon 7-specific probe (distinguishing c.840C>T) for digital drop PCR (ddPCR) to detect the presence of the SMN1 gene on a single chromosome 5, thus establishing a novel method for detecting carriers of spinal muscular atrophy (SMMA) type 2+0 based on single-chromosome digital drop PCR (SC-ddPCR). The new method was validated by analyzing a family pedigree identified as SMN1 type 2+0 carriers and by selecting single-copy (type 1+0) carriers and double-copy normal individuals (type 1+1) from the carrier screening included in this study. This study was approved by the Ethics Committee of Jiangxi Provincial Maternal and Child Health Hospital.

[0074] I. Experimental Methods

[0075] 1. Preparation of experimental reagents

[0076] All solutions must be prepared using sterile, ultrapure water and used immediately or dispensed and frozen.

[0077] 10× Polyamine Buffer Stock Solution: The final concentrations of each component are 1.5 mM spermine, 4.0 mM spermidine, 82.0 mM KCl, 23.0 mM NaCl, 0.5 mM EDTA, 14.0 mM β-mercaptoethanol, and 15.0 mM Pipes buffer. Preparation: Dissolve the above components in approximately 80 mL of water, adjust the pH to 7.0-7.4 with NaOH, and bring the volume to 100 mL. Store at 4°C protected from light.

[0078] 1× Working solution polyamine lysis buffer (1×LBB): Take 10 mL of 10×PA Buffer stock solution and add 90 mL of water.

[0079] Colchicine working solution: 0.1 µg / mL, diluted with culture medium or PBS.

[0080] 2. Separation of single chromosomes

[0081] 1) Cell metaphase synchronization: Before the culture of peripheral blood cells and amniotic fluid cells was terminated, colchicine was added to the culture flask to a final concentration of 0.1 μg / ml. The cells were then incubated in a 37°C incubator to arrest a large number of cells in metaphase.

[0082] 2) Cell collection and pre-washing: Collect cells, wash once with pre-cooled PBS by centrifugation (4℃, 200g, 10 min), and discard the supernatant; add 2 mL of erythrocyte lysis buffer and lyse for 10 min, add 8 mL of pre-cooled PBS, mix well and centrifuge (4℃, 200g, 10 min), and discard the supernatant; wash once with pre-cooled PBS by centrifugation (4℃, 200g, 10 min), and discard the supernatant;

[0083] 3) Hypotonic treatment of cells: After colchicine treatment, remove the culture flask from the incubator, use a pipette to transfer the culture into a centrifuge tube, centrifuge (1500 rpm, 10 min), wash once with 15 mL of pre-cooled PBS, discard the supernatant, add about 8 mL of 75 mmol / L KCl solution, mix well with a pipette, and incubate in a 37ºC water bath for 20 minutes.

[0084] 4) Cell resuspension and lysis: Centrifuge at 500g for 5 min at 4°C, discard the supernatant, resuspend the cell pellet in 500 μL of pre-chilled polyamine buffer, and place on ice for 15 min. To disrupt the cell membrane in one step, vortex for 30 s, then centrifuge at 200g for 10 min at 4°C, and collect the supernatant, which is the chromosome suspension;

[0085] 5) Metaphase level analysis: Giemsa staining was used as a routine chromosome karyotype analysis method to analyze the proportion of metaphase cells in the total number of cells;

[0086] 6) Giemsa staining: After hypotonic treatment, centrifuge the cells, remove the supernatant, add 0.4 mL of 3:1 ethanol-acetic acid fixative, gently pipette to mix, centrifuge (1500 rpm, 10 min), remove the supernatant, fix twice with 6-8 mL of fixative, remove the supernatant, add an appropriate amount of fresh fixative, drop the slide, bake dry, place the slide in a trypsin digestion jar for 60-100 s, then place it in a 6% Giemsa staining jar for 8-12 min, rinse with tap water, air dry, and observe under a microscope;

[0087] 7) Chromosome release analysis: The chromosome suspension after shaking or centrifugation was smeared on a glass slide, stained with 4',6-diamidinyl-2-phenylindole (DAPI), and observed under a fluorescence microscope;

[0088] 8) Optimization of cell synchronization level: Before the culture was terminated, colchicine was added to peripheral blood cells at a final concentration of 0.05 μg / mL for 2 h, 4 h and 6 h respectively. After Giemsa staining to prepare routine karyotype analysis stained slides, the synchronization level was analyzed.

[0089] 9) Hypotonic treatment for cell lysis: To release as many chromosomes as possible, the treatment time of KCl solution was set to 20 min and the vortex shaker time was set to 30 s. After shaking, the liquid was collected, smeared on a glass slide, stained with DAPI, and observed under a fluorescence microscope.

[0090] 10) Isolation of unruptured cells: After centrifugation and shaking, the chromosome suspension was centrifuged at 200g and 4℃ for 10min. The supernatant was then smeared on a glass slide, stained with DAPI, and observed under a fluorescence microscope.

[0091] 3. Detection probe primer design and validation

[0092] 1) Selection of internal reference gene: The internal reference gene is the relatively conserved GDNF (Glial cell-derived neurotrophic factor) gene, which is located in the 5p13.2 region, from the non-complex repeat region on chromosome 5.

[0093] 2) Primer and probe design: The same primers were used for the detection of SMN1 and SMN2 genes, but different probes were used. The probes needed to cover the c.840 site of both genes. For GDNF, primers and probes were designed using Beacon Designer 8 probe design software, as shown in Table 1 below. The specificity of all primers and probes was analyzed using NCBI Primer Blast online software to identify non-specific products that would interfere with detection.

[0094] Table 1: Primer and probe sequences

[0095]

[0096] 3) Primer specificity verification: Using the SYBR Green qPCR method, genomic DNA was used as a template for qPCR detection, and its melting curve was observed to analyze whether there were any non-specific products.

[0097] 4) Construction of simulated plasmids: Synthesize plasmids containing SMN1(c.840T)-SMN2(c.840C)-GDNF amplification fragments (SMN1-SMN2 simulated plasmids) and SMN2-GDNF amplification fragments (none-SMN1 simulated plasmids), with pUC57 as the plasmid backbone;

[0098] 5) Validation of the specificity of SMN1 and SMN2 probes: Using SMN1 mimic plasmid, none-SMN1 mimic plasmid and a 1:1 mixture of the two plasmids as templates, TaqMan qPCR detection of SMN1 primer-probe and SMN2 primer-probe was performed to analyze the specificity of the primer-probe combination for the SMN1 and SMN2 genes.

[0099] 6) Primer amplification efficiency analysis: Using SMN primers and GDNF primers, SYBR Green qPCR was performed with SMN1 and GDNF simulated plasmids as templates, respectively, using 10-fold dilution gradients. Standard curves were plotted and primer amplification efficiency was calculated.

[0100] 7) Validation of genomic DNA and chromosome suspension using probe detection: Using genomic DNA and chromosome suspension as templates, primer-probe combinations of SMN1, SMN2 and GDNF were used for detection by TaqMan qPCR with 10-fold dilution gradients. A standard curve was plotted and the amplification efficiency of the primer library was calculated.

[0101] The results showed that the SMN1 / SMN2 primer amplification products contained the SMN1 and SMN2 genes. Figure 3 A); GDNF primer amplification product is single ( Figure 3 E). In SYBR Green qPCR, both primer pairs produced acceptable amplification curves. Melting curve analysis showed that both primer pairs exhibited good specificity. Figure 3 B Figure 3 F). In TaqMan qPCR detection, the primer-probe combinations of SMN1, SMN2, and GDNF all yielded suitable fluorescence intensity signals, which can be used for subsequent ddPCR experiments. Figure 3 CD Figure 3 G).

[0102] 4. Establishment of a single-chromosome ddPCR method

[0103] 1) Single Chromosome Digital Droplet PCR Detection of SMN1, SMN2, and GDNF: The sorted chromosome suspension was detected by digital PCR using Absolute Q™ DNA Digital PCR Master Mix (5×). 15µL reaction system: 2µL 5× DNA Digital PCR Master Mix, 1µL each of upstream and downstream primers (SMN-F, SMN-R, GDNF-F, GDNF-R) and probes (SMN1-Probe-FAM, SMN2-Probe-VIC, GDNF-Probe-Cy5) (total 7µL), 1µL sample, and 5µL enzyme-free water. After preparation, vortex for 5–20 s, then centrifuge at 300g for 3 min. Primer and probe information is shown in Table 1 above. Reaction conditions: 96℃ pre-denaturation for 10 min, 40 cycles (95℃ denaturation for 5 s, 60℃ annealing and extension for 15 s). After PCR, the droplets were detected for fluorescence using a digital PCR system.

[0104] 2) Plasmid-simulated chromosome detection: Single chromosome digital droplet PCR detection was performed using SMN1-SMN2 simulated plasmid, none-SMN1 simulated plasmid, and a 1:1 mixture of the two plasmids;

[0105] 3) Chromosomal testing of clinical samples: Two normal individuals who were 2+0 carriers were selected from a 2+0 family, and two single-copy (1+0) carriers and two double-copy (1+1) normal individuals were selected from the carrier screening included in this study. Single chromosome isolation and single chromosome digital droplet PCR detection were performed.

[0106] 4) Calculation of single-chromosome digital droplet PCR detection results:

[0107] Based on the droplet fluorescence characteristics of digital PCR, the number of 8 fluorescent droplets was determined:

[0108] N T = The effective number of droplets;

[0109] N F = Number of positive reaction units in the FAM channel;

[0110] N V = Number of positive reaction units in the VIC channel;

[0111] N C = Number of positive reaction units in the Cy5 channel;

[0112] N FV = The number of reaction units that are positive in both FAM and VIC channels;

[0113] N FC = Number of reaction units that are positive in both FAM and Cy5 channels;

[0114] N VC = Number of reaction units that are positive in both VIC and Cy5 channels;

[0115] N FVC = The number of reaction units that are positive in all three channels: FAM, VIC and Cy5;

[0116] Judgment criteria: Expected to be N FC and N VC The ratio is the criterion for judgment. Theoretically, a ratio close to 1 indicates a normal population, while a ratio close to 0.5 indicates a carrier.

[0117] II. Results

[0118] 1. Results of metaphase differentiation and single chromosome segregation of peripheral blood cells and amniotic fluid cells

[0119] Peripheral blood cells and amniotic fluid cells were treated with colchicine at a final concentration of 0.05 μg / mL for 6 h, followed by Giemsa staining to observe the proportion of cells in metaphase to the total cell count. The results showed that monocytes in peripheral blood and amniotic fluid could produce cells in metaphase (…). Figure 2 A). To observe whether hypotonic cells could release free chromosomes after oscillatory rupture and to verify the staining effect of DAPI on free chromosomes, we prepared cell smears after oscillatory rupture, dried them, stained them with DAPI, and observed them under a microscope. Figure 2 (B) The results showed that both mitotic cells and free single chromosomes in peripheral blood mononuclear cells could be stained with DAPI, indicating that single chromosomes in metaphase cells could be released into the supernatant by the hypotonic-induced oscillation lysis method. This result suggests that DAPI staining experiments can be used to observe single chromosome segregation and the presence of unruptured cells.

[0120] 2. Primer and probe design and validation results

[0121] Primers and probes for SMN1, SMN2, and GDNF were designed, with SMN1 and SMN2 sharing the same primers and the two probes differing only at the c.840 site. The SMN1 probe used FAM signaling, the SMN2 probe used VIC signaling, and the GDNF probe used Cy5 signaling. Genomic DNA extracted from 293T cells was used as a template for sequencing of amplified products, SYBR Green qPCR, and TaqMan qPCR experiments. Results showed that the amplified products of the SMN1 / SMN2 primers contained both the SMN1 and SMN2 genes. Figure 3 A); GDNF primer amplification product is single ( Figure 3 E). In SYBR Green qPCR, both primer pairs produced acceptable amplification curves. Melting curve analysis showed that both primer pairs exhibited good specificity. Figure 3 B Figure 3 F). In TaqMan qPCR detection, the primer-probe combinations of SMN1, SMN2, and GDNF all yielded suitable fluorescence intensity signals (F). Figure 3 CD Figure 3 G).

[0122] 3. Construction of simulated plasmids and simulation of ddPCR results

[0123] Using pUC57 as the expression vector, two plasmids containing primer amplification fragments were constructed: a triplet plasmid containing SMN1-GDNF-SMN2 and a binary plasmid containing SMN2-GDNF. A 1000bp random sequence interval was used between the amplification fragments to avoid interference between the SMN1 / SMN2 primers. Figure 4The above plasmids were named SMN1-SMN2 simulated plasmid and none-SMN1 simulated plasmid, respectively.

[0124] Plasmid-simulated single-chromosome ddPCR experiments were performed using designed primers and probes, divided into three groups: SMN1-SMN2 group, non-SMN1 group, and carrier simulation group (1:1 mixture). The number of fluorescent droplets in each channel of ddPCR for the three groups is shown in Figures 5, 6, and 7. The effective droplet count for each group was counted (Table 2). All three groups obtained more than 20,000 effective droplets, indicating that the lipid droplet generation in the early stage of ddPCR was effective, meaning that the droplets generated at the recommended kit concentration (7.14 × 10⁻⁶) were successfully generated. -5 Single copies of the plasmid (copies / mL) were dispersed into individual lipid droplets. The number of droplets in each individual channel and the superimposed channel was collected, and the ratio of the number of SMN1-GDNF droplets to the number of SMN2-GDNF droplets (N) was calculated. FC / N VC This allows for the determination of SMN1 carrier status. The SMN1-SMN2 group simulates the normal population, and its N... FC / N VC The value was 0.936, which, according to the diagnostic criteria, classifies the individual as a normal population of type 1+1; the Non-SMN1 group simulates the patient population, and its N... FC / N VC The value was 0.003, which, according to the diagnostic criteria, indicates that the individual is a patient with SMA; the 1:1 mixed simulated carrier group had N... FC / N VC The value was 0.581, which, according to the diagnostic criteria, indicates that the individual can be classified as a carrier. The plasmid simulation results demonstrate the correct identification of the effective simulation group, indicating that the primers and probes designed in this study have sufficient specificity in ddPCR, enabling simultaneous detection of different genes within the same plasmid and distinguishing between SMN1 and SMN2 genes. Based on the results of the plasmid-simulated chromosome analysis, we roughly determined the diagnostic criteria as follows: N (Normal population) FC / N VC The value was 1 ± 0.1 (0.9 ~ 1.1), and the carrier N FC / N VC It is 0.5±0.1 (0.4~0.6).

[0125] 4. Collection of SMN1 2+0 carrier family pedigrees

[0126] The following is a pedigree chart of a case of SMN1 2+0 type ( Figure 8The patient's father (II-5) and mother (II-6) had three children. The second child (III-7) died of respiratory failure around three months after birth due to a cold. The third child (III-8) also died of respiratory failure around 70 days after birth. The third child underwent SMN1 copy number testing, which showed 0 copies (homozygous deletion). Several family members underwent SMN1 copy number testing: the patient's sister (healthy, III-6) had 2 copies, the father (II-5) had 2 copies, the mother (II-6) had 1 copy, the grandfather (I-1) had 1 copy, and the grandmother (I-2) had 3 copies. Based on the family analysis, it can be inferred that the grandmother has an SMN1 genotype of 2+1, the father inherited one 0-copy SMN1 chromosome from the grandfather and 2 copies from the grandmother, making him a 2+0 carrier, and the mother is a 1+0 carrier. Based on this inference... Figure 9 The probability of the parents of an affected child having another affected child is 25%, which is consistent with the SMN1 copy number test results of family members and the child's disease status.

[0127] 5. Single chromosome ddPCR detection of blood samples

[0128] In the family shown in Figure 7, II-5 and III-6 were selected as carriers of the double-copy 2+0 type. Two normal carriers of type 1+1 and two single-copy carriers of type 1+0 were selected from the carrier screening included in this study for further testing. Peripheral blood samples from normal type 1+1 and single / double-copy carriers were subjected to single-chromosome isolation, and single-chromosome ddPCR was performed using the single-chromosome suspension as a template. The number of fluorescent droplets in each channel of ddPCR for the three groups is shown in Figures 10, 11, and 12. The number of effective droplets in each group was counted (Table 3). All three groups obtained more than 20,000 effective droplets, indicating that the lipid droplet generation in the early stage of ddPCR was effective. Since the single-chromosome copy number concentration was much lower than the recommended copy number concentration of the plasmid, we speculate that the single chromosome could be dispersed into each lipid droplet as a single copy. The droplet counts of each individual channel and the superimposed channel were collected, and the ratio of SMN1-GDNF droplets to SMN2-GDNF droplets (N) was calculated. FC / N VC ), thereby determining the SMN1 carrying status. 2. Copying the N of a normal person FC / N VC The values ​​were 1.022 and 0.977 respectively. Based on the approximate criteria given in the plasmid-simulated chromosome experiment, they can be identified as normal individuals with a 1+1 chromosome pattern; the N values ​​of the two single-copy carriers... FC / N VC The values ​​were 0.482 and 0.503 respectively. Based on the approximate criteria given in the plasmid-simulated chromosome experiment, they can be identified as carriers of type 1+0; N, a carrier of two double copies. FC / N VCThe values ​​were 0.562 and 0.536, respectively. Based on the approximate criteria given in the plasmid-simulated chromosome experiment, these individuals can be identified as carriers of type 2+0. These results demonstrate the correct identification of these six samples, indicating that the single-chromosome suspension preparation combined with single-chromosome ddPCR technology established in this study can preliminarily achieve carrier status detection for type 2+0 samples. The currently established approximate criteria have a certain degree of effectiveness.

[0129] Table 2. Statistics of colocalized droplets in plasmid-simulated ddPCR experiments

[0130]

[0131] Table 3. Statistics of SMN1 chromosome colocalization droplets carrying 2-copy 1+1, single-copy, and double-copy 2+0 types.

[0132]

[0133] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for detecting carriers of spinal muscular atrophy based on single-chromosome digital droplet PCR, characterized in that, The method includes the following steps: (1) Prepare a chromosome suspension containing a free single chromosome of the subject; (2) Using the chromosome suspension prepared in step (1) as a template, digital droplet PCR amplification is performed, wherein the primers and probes used for the amplification include at least: The first detection system includes primers for specifically amplifying the SMN1 gene and a probe containing a first distinguishable fluorescent marker and a first quenching portion; The second detection system includes primers for specifically amplifying the SMN2 gene and a probe containing a second distinguishable fluorescent marker and a second quenching portion; An internal reference gene detection system, which includes primers for amplifying the internal reference gene and probes containing a third distinguishable fluorescent marker and a third quenching portion; (3) Collect the amplified fluorescence signal and determine the SMN1 genotype of the subject based on the number of positive droplets in each detection system.

2. The method according to claim 1, characterized in that, In step (3), the judgment includes: performing concentration correction on the original positive droplet count based on the Poisson distribution algorithm, and / or directly calculating the judgment index F value based on the positive droplet count of each detection system, wherein the formula for calculating the F value is F = N 第一 / 第三 / N 第二 / 第三 N 第一 / 第三 N refers to the number of droplets that are positive in both the first and third distinguishable fluorescent marker channels. 第二 / 第三 The number of droplets that are positive in both the second and third distinguishable fluorescent marker channels.

3. The method according to claim 2, characterized in that, In step (3), the judgment result determination criteria are as follows: When the F value is 0.9 to 1.1, the examinee is considered to be a normal person with spinal muscular atrophy; When the F value is 0.4 to 0.6, the examinee is determined to be a carrier of spinal muscular atrophy.

4. The method according to claim 1, characterized in that, In step (1), the method for preparing the chromosome suspension containing free single chromosomes is a hypotonic-lysis chemical separation method, which specifically includes the following steps: (a) Cell culture and mid-term synchronization: Peripheral blood lymphocytes or amniotic fluid cells were obtained from the subject and cultured. Colchicine was added before the culture was terminated for mid-term synchronization. (b) Cell collection and pre-washing: Collect synchronized cells, centrifuge and lyse to remove red blood cells, and wash with pre-cooled buffer; (c) Hypotonic treatment: Add hypotonic solution to the washed cell pellet, mix well and then treat with water bath; (d) Chromosome release: Centrifuge the cells after hypotonic treatment and discard the supernatant; add chromosome release buffer to the precipitate to resuspend, incubate on ice, vortex, centrifuge again, and collect the supernatant containing free single chromosomes, which is the chromosome suspension. And / or, in step (a), the concentration of colchicine used for treatment is 0.05~0.1 μg / mL, and the treatment time is 4~16 hours; in step (c), the hypotonic solution is 75 mmol / L KCl solution, and the water bath treatment time is 15~30 minutes; in step (d), the chromosome release buffer is polyamine buffer, the ice bath standing time is 10~20 minutes, the vortexing time is 15~30 seconds, and the conditions for the second centrifugation are 4℃, 200~300g centrifugation for 5~10 minutes.

5. The method according to claim 1, characterized in that, The first distinguishable fluorescent marker, the second distinguishable fluorescent marker, and the third distinguishable fluorescent marker are different from each other and their spectra are distinguishable. The first quenching part, the second quenching part, and the third quenching part are selected from non-fluorescent quenchers, fluorescence resonance energy transfer quenchers, or deep quenchers. Preferably, the quenching portion is at least one of MGB-NFQ, BHQ series, Dabcyl, or Iowa Black; More preferably, the first distinguishable fluorescent marker is FAM, and the quenching portion is NFQ-MGB or BHQ2; the second distinguishable fluorescent marker is VIC or HEX, and the quenching portion is NFQ-MGB or BHQ2; and the third distinguishable fluorescent marker is Cy5 or JUN, and the quenching portion is NFQ-MGB or BHQ2.

6. The method according to claim 1, characterized in that, The sequences of the primers and probes are as follows: SMN1-F: AATGCTTTTTAACATCCATATAAAGCT; SMN1-R: CCTTAATTTAAGGAATGTGAGCACC; SMN1-Probe: First distinguishable fluorescent marker - CAGGGTTTCAGACAAA-quenched portion; SMN2-F: Same as SMN1-F; SMN2-R: Same as SMN1-R; SMN2-Probe: Second distinguishable fluorescent marker - TGATTTTGTCTAAAACC - quenched portion; The internal reference gene is GDNF, and its primer and probe sequences are as follows: GDNF-F:ACTCCACTAGGCCATTGAGGTTA; GDNF-R:ACCACCAGTGCGGAATTAGC; GDNF-Probe: Third distinguishable fluorescent marker -TTCTCCTGTACTCTGTGCCGCCTTCCA-quenched portion.

7. The method according to claim 6, characterized in that, The first distinguishable fluorescent marker is FAM, and the quenched portion is NFQ-MGB; the second distinguishable fluorescent marker is VIC, and the quenched portion is NFQ-MGB; the third distinguishable fluorescent marker is Cy5, and the quenched portion is BHQ2.

8. A kit for detecting carriers of spinal muscular atrophy, characterized in that, The kit contains: The primers and probes according to claim 1, or any one of claims 5-7; And reagents for preparing single chromosome suspensions, said reagents being selected from at least one of: colchicine solution, hypotonic solution, erythrocyte lysis buffer, and chromosome release buffer.

9. The method of any one of claims 1-7, or the kit of claim 8, in the preparation of a product for screening carriers of spinal muscular atrophy.

10. A method for detecting copy number variations of a target gene based on single-chromosome digital droplet PCR, characterized in that, The steps included in any one of claims 1-7 are used to detect genetic diseases caused by gene duplication, deletion or conversion.