A multiplex PCR kit, method and device for detecting multiple genes of neonatal genetic diseases
By combining multiplex PCR kits and high-throughput sequencing technology to detect 37 pathogenic genes, the problems of low detection throughput and long cycle in newborn genetic disease screening have been solved, achieving efficient and accurate multi-gene screening and adapting to the simultaneous detection of multiple genetic diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHONGQING INST OF POPULATION & FAMILY PLANNING SCI & TECH
- Filing Date
- 2024-12-30
- Publication Date
- 2026-06-30
AI Technical Summary
Existing newborn genetic disease screening methods have limitations such as being specific to specific diseases, low throughput, long cycle time, and inability to achieve efficient detection of multiple genetic diseases simultaneously.
Using multiplex PCR kits and high-throughput sequencing technology, specific primer pairs were designed to jointly detect 37 pathogenic genes, including adapter elements, primer pools, and PCR reagents. Combined with the NGS platform, multiplex PCR targeted sequencing libraries were constructed to perform non-deletion mutation analysis and copy number calculation.
It enables simultaneous detection of multiple newborn genetic diseases, increases detection throughput, shortens the detection cycle, reduces costs, and improves the accuracy and universality of detection, adapting to the ever-expanding list of screening diseases.
Smart Images

Figure BDA0005219230680000041 
Figure BDA0005219230680000371 
Figure BDA0005219230680000373
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection, and in particular to a multiplex PCR kit, method, and apparatus for the combined detection of multiple genes in newborn genetic diseases. Background Technology
[0002] Birth defects have a significant negative impact on population quality, the national economy, and social stability. Newborn screening, as a tertiary prevention method for birth defect intervention, can assist in the diagnosis of common single-gene genetic diseases, enabling early diagnosis and treatment, reducing or preventing disabilities, thereby ensuring the quality of life for at-risk families and reducing the social burden.
[0003] Currently, hospitals primarily screen newborns for inherited metabolic diseases, such as congenital hypothyroidism, phenylketonuria, glucose-6-phosphate dehydrogenase deficiency, and congenital adrenal hyperplasia. In 2024, eleven more diseases were added: methylmalonic acidemia, primary carnitine deficiency, citrulline deficiency, medium-chain acyl-CoA dehydrogenase deficiency, propionic acidemia, isovaleric acidemia, glutaric acidemia type I, maple syrup diabetes, very long-chain acyl-CoA dehydrogenase deficiency, citrullineemia type I, and homocysteineemia type I. The specific newborn disease screening programs implemented vary depending on the economic conditions and medical level of different regions.
[0004] Given the complexity of genetic diseases involved in newborn screening, diseases caused by copy number variations (DMD, SMN1 / 2, HBA1 / 2) or gene base variations require different detection technologies. Chromosomal karyotype analysis, fluorescence in situ hybridization, chromosome microarray analysis, and multiplex ligation probe amplification are mainly used to detect copy number variations. For disease cases with a single candidate gene or a clearly identified pathogenic variant site, PCR and Sanger sequencing can be selected. For genetic diseases with unclear genes, high-throughput sequencing technologies, including next-generation sequencing technologies such as gene panels, whole exome sequencing (WES), and whole genome sequencing (WGS), can be selected for detection.
[0005] Current clinically mature newborn screening programs have limitations due to their disease-specific methods, low throughput, and long testing cycles. For example, different methods are used for congenital hypothyroidism, phenylketonuria, glucose-6-phosphate dehydrogenase deficiency, and congenital adrenal hyperplasia. Therefore, establishing a comprehensive testing technology that is both accurate and universally applicable is an urgent problem to be solved. Summary of the Invention
[0006] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a multiplex PCR kit, method and apparatus for the combined detection of multiple genes in newborn genetic diseases, in order to solve the problems in the prior art.
[0007] To achieve the above and other related objectives, the present invention provides a multiplex PCR kit for combined detection of multiple genes in newborn genetic diseases. The kit comprises a adapter element, a primer pool, and PCR reagents. The adapter element comprises a first nucleotide chain and a second nucleotide chain. The first nucleotide chain comprises a first universal sequence, a molecular tag, and a second universal sequence. The first universal sequence includes a sequence fragment that binds to sequencing primers. The molecular tag is a randomized or specific nucleotide sequence. The second nucleotide chain includes a complementary sequence to the second universal sequence to form a double strand upon annealing of the adapter element. The primer pool includes reagents for... Specific primers for detecting the following target genes: ACADM, ACADVL, ASS1, ATP7B, CFTR, CYP21A2, DMD, ETFDH, F8, F9, FBN1, G6PD, GAA, GALC, GCDH, GJB2, GJB3, GLA, HBA1, HBA2, HBB, HLCS, IDUA, MECP2, MMACHC, MMUT, NF1, PAH, PTPN11, SLC22A5, SLC25A13, SLC26A4, SMN1, SMN2, SOS1, SRY, UGT1A1.
[0008] The present invention also provides the use of the kit in constructing multiplex PCR targeted sequencing libraries for multi-gene joint detection of genetic diseases in newborns.
[0009] The present invention also provides a method for constructing a multiplex PCR targeted sequencing library for multi-gene joint detection of genetic diseases in newborns, the method comprising constructing the library using the aforementioned kit.
[0010] The present invention also provides multiplex PCR targeted sequencing libraries obtained by the method.
[0011] This invention also provides a method for combined detection of multiple genes in newborn genetic diseases, the method comprising the following steps:
[0012] 1) Sequencing of the aforementioned multiplex PCR targeted sequencing library;
[0013] 2) Perform non-deletion mutation analysis based on sequencing data or obtain the copy number of the target gene based on sequencing data: based on the number of reads in the sequencing data and the formula: The copy number of the corresponding gene was obtained by calculating and processing the calculation results as follows.
[0014] The present invention also provides an apparatus for detecting polygenic mutations in newborn genetic diseases, the apparatus comprising:
[0015] 1) Sequencing data acquisition module: used to acquire sequencing data of the multiplex PCR targeted sequencing library as described in claim 11;
[0016] 2) Copy number acquisition module: used to obtain the number of reads from the sequencing data and the formula: The calculation is performed, and the result is processed to obtain the copy number. The processing method is as follows: when the calculation result is between 0.1 and 0.5, the copy number is considered to be 1. For other calculation results, the copy number is obtained by rounding to the nearest integer.
[0017] 3) Gene mutation type analysis module: used to obtain the target gene mutation type based on the copy number of the module.
[0018] As described above, the multiplex PCR kit, method, and apparatus for multi-gene joint detection of genetic diseases in newborns according to the present invention have the following beneficial effects: It can simultaneously detect multiple genetic diseases involving 37 genes in newborn screening, with significant advantages of high throughput, short cycle time, and low cost. Compared with traditional clinical methods, the method of the present invention can fully realize the screening of relevant diseases and is more in line with the ever-expanding recommended screening disease list. With the development and maturity of high-throughput sequencing technology, the methodology on which the present invention is based has also been proven to have high accuracy. With the application of automated equipment, the subsequent testing process can be automated. The in-depth application of NGS expands the range of diseases to be screened and reduces false positives, especially for diseases for which there are no reliable biochemical markers. It can simultaneously perform the above routine items and other disease screenings that are desired but for which there are no efficient solutions. The testing cycle and cost can be well controlled, with significant social significance. Attached Figure Description
[0019] Figure 1 The diagram shown is a flowchart of the wet test procedure of this invention.
[0020] Figure 2 The results of capillary electrophoresis of the library presented in this invention are shown.
[0021] Figure 3.1 The results of the missing type analysis are shown as S02 (DMD:NM_004006.3:EX48-EX54 Del).
[0022] Figure 3.2 The result of the missing type analysis is shown as S20 (F8:Exon1-22dup).
[0023] Figure 4.1 The results are shown as NBS-P1 deletion type analysis results (--SEA / αα).
[0024] Figure 4.2The results are shown as NBS-P7 deletion type analysis results (DMD: Exon53-55del).
[0025] Figure 4.3 The results are shown as NBS-P9 deletion type analysis results (SMN1 / SMN2 = 1 / 1).
[0026] Figure 5 The diagram shows a device used for multi-gene combined detection of genetic diseases in newborns.
[0027] Figure 6 The diagram shown is a schematic representation of the electronic terminal of this invention. Detailed Implementation
[0028] This invention utilizes a multiplex PCR combined with NGS technique, selecting 37 relevant pathogenic genes with high incidence rates, those already screened clinically, those that are treatable and preventable, and those that may produce false negatives when screened using existing clinical methods. These genes are then subjected to combined gene screening. Specifically, the screening covers genes with high incidence rates such as PKU (PAH), methylmalonic acidemia (MMUT / MMACHC), cystic fibrosis (CFTR), thalassemia (HBA1 / HBA2, HBB), G6PD (G6PD), and deafness-related genes GJB2 and SLC2. Hot topics related to deafness include 6A2, GJB3, mtDNA-related conditions, primary carnitine deficiency (SLC22A5), glutaric acidemia (GCDH), total carboxylase synthase deficiency (ETFDH), multiple acetyl-CoA dehydrogenase deficiencies (HLCS), progressive spinal muscular atrophy (SMA) (SMN1 / SMN2), Duchenne muscular dystrophy (DMD), lysosomal diseases (IDUA, GLA, GALC), Wilson's disease (ATP7B), and neurofibromatosis (NF1). Leveraging the advantages of the NGS platform, the universality of newborn screening has been greatly improved, offering significant advantages in terms of higher efficiency and lower cost.
[0029] This invention provides a method and kit for the joint detection of multiple genes in newborns with genetic diseases. The method includes: designing multiplex PCR-specific primers targeting all exon regions of all target genes, some clearly pathogenic / potentially pathogenic intron regions, specific regions used in thalassemia detection to calculate HBA1 and HBA2 deletion subtypes, specific regions of internal reference genes, and mitochondrial DNA hotspot mutation regions. These primers are used for sequencing library construction, followed by high-throughput sequencing and data analysis to achieve joint detection of multiple genes.
[0030] This invention provides a multiplex PCR kit for combined detection of multiple genes in newborns with genetic diseases. The kit includes an adapter element (UMI-Adapter), a primer pool, and PCR reagents. The adapter element includes a first nucleotide chain and a second nucleotide chain. The first nucleotide chain includes a first universal sequence (US1), a molecular tag (UMI), and a second universal sequence (US2). The second nucleotide chain includes a complementary sequence of the second universal sequence (US2-R). The primer pool includes specific primers for detecting the following target genes: ACADM, AC... ADVL, ASS1, ATP7B, CFTR, CYP21A2, DMD, ETFDH, F8, F9, FBN1, G6PD, GAA, GALC, GCDH, GJB2, GJB3, GLA, HBA1, HBA2, HB B. HLCS, IDUA, MECP2, MMACHC, MMUT, NF1, PAH, PTPN11, SLC22A5, SLC25A13, SLC26A4, SMN1, SMN2, SOS1, SRY, UGT1A1.
[0031] The primers used to detect the target genes HBA1 and HBA2 include primers for detecting X-specific, Y-specific, and Z-specific regions on the HBA gene cluster, wherein the genomic location of the X-specific region is chr16: 170801-171701; the genomic location of the Y-specific region is chr16: 175048-175797; and the genomic location of the Z-specific region is chr16: 165401-169452 and / or chr16: 177538-183301.
[0032] In some embodiments of the present invention, each specific primer in the primer pool includes a third universal sequence (US3) and a gene-specific sequence (GS, or simply the specific sequence) from the 5' end to the 3' end.
[0033] In some embodiments of the present invention, the third universal sequence (US3) of each specific primer is identical.
[0034] The third universal sequence is another fragment that binds to the sequencing primers.
[0035] In some embodiments of the present invention, the length of the third universal sequence may be 15–33 bp. For example, 15–20 bp, 20–25 bp, 25–30 bp, or 30–33 bp. In a preferred embodiment, the length of the third universal sequence is 20–25 bp.
[0036] The specific sequences of each specific primer in the primer pool are different due to different detection regions, and thus have gene specificity.
[0037] In some embodiments of the present invention, examples of the sequences of the specific primers are as follows:
[0038] The underlined part is the third universal sequence, and the bolded part is the gene-specific sequence.
[0039] In some embodiments of the present invention, the nucleotide sequences of the specific primers used to detect the target gene in the primer pool are completely identical or complementary to the sequences between the corresponding sites on the following chromosomes:
[0040] ACADM-C01-R101 chr1:75724985-75725015
[0041] ACADM-C02-F101 chr1:75728300-75728330
[0042] ACADM-C04-F101 chr1:75732711-75732741
[0043] ACADM-C06-F101 chr1:75734666-75734696
[0044] ACADM-C08-F101 chr1:75745765-75745795
[0045] ACADM-C10-F101 chr1:75750347-75750377
[0046] ACADM-C12-F101 chr1:75762542-75762572
[0047] ACADM-D01-F101 chr1:75726761-75726791
[0048] ACADM-D02-F101 chr1:75731681-75731711
[0049] ACADM-D03-F101 chr1:75732901-75732931
[0050] ACADM-D05-F101 chr1:75750708-75750738
[0051] ACADM-D06-F101 chr1:75768976-75769006
[0052] ACADM-Dfi-R101 chr1:75724844-75724870
[0053] ACADM-Dth-F101 chr1:75762728-75762758
[0054] ACADVL-D01-R101 chr17:7217183-7217210
[0055] ACADVL-C01-R101 chr17:7220193-7220217
[0056] ACADVL-C02-F101 chr17:7219971-7219994
[0057] ACADVL-C03-F101 chr17:7220424-7220453
[0058] ACADVL-C04-F101 chr17:7220430-7220460
[0059] ACADVL-C05-F101 chr17:7220665-7220694
[0060] ACADVL-C06-F101 chr17:7220814-7220844
[0061] ACADVL-C07-F101 chr17:7221470-7221498
[0062] ACADVL-C08-F101 chr17:7221842-7221870
[0063] ACADVL-C09-F101 chr17:7222059-7222084
[0064] ACADVL-C10-F101 chr17:7222615-7222643
[0065] ACADVL-C11-F101 chr17:7223016-7223046
[0066] ACADVL-C12-F101 chr17:7223547-7223577
[0067] ACADVL-C13-F101 chr17:7223650-7223680
[0068] ACADVL-C14-F101 chr17:7223920-7223950
[0069] ACADVL-C15-F101 chr17:7224056-7224086
[0070] ACADVL-C16-F101 chr17:7224278-7224308
[0071] ACADVL-C17-F101 chr17:7224354-7224379
[0072] ACADVL-C18-R201 chr17:7224896-7224917
[0073] ACADVL-C19-F101 chr17:7224854-7224884
[0074] ACADVL-Dfi-R101 chr17:7220032-7220052
[0075] ACADVL-Dth-F101 chr17:7225011-7225041
[0076] ASS1-C01-R101 chr9:130452449-130452476
[0077] ASS1-C02-F101 chr9:130454166-130454196
[0078] ASS1-C03-F101 chr9:130458346-130458366
[0079] ASS1-C04-F101 chr9:130463971-130464001
[0080] ASS1-C05-F101 chr9:130466597-130466623
[0081] ASS1-C06-F101 chr9:130470700-130470730
[0082] ASS1-C07-F101 chr9:130471360-130471390
[0083] ASS1-C08-F101 chr9:130476814-130476844
[0084] ASS1-C09-F101 chr9:130479601-130479631
[0085] ASS1-C10-F101 chr9:130480260-130480290
[0086] ASS1-C12-F101 chr9:130494826-130494856
[0087] ASS1-C13-F101 chr9:130499339-130499369
[0088] ASS1-C14-F101 chr9:130500854-130500884
[0089] ASS1-Dfi-R101 chr9:130444995-130445017
[0090] ASS1-Dth-F101 chr9:130500956-130500986
[0091] ATP7B-C01-R101 chr13:51934997-51935027
[0092] ATP7B-C01-F201 chr13:51934750-51934780
[0093] ATP7B-C02-F101 chr13:51935504-51935534
[0094] ATP7B-C03-F101 chr13:51937151-51937181
[0095] ATP7B-C04-F101 chr13:51937415-51937437
[0096] ATP7B-C04-R201 chr13:51937703-51937733
[0097] ATP7B-C05-F101 chr13:51939006-51939036
[0098] ATP7B-C06-F101 chr13:51941030-51941060
[0099] ATP7B-C07-F101 chr13:51942323-51942353
[0100] ATP7B-C08-F101 chr13:51944044-51944074
[0101] ATP7B-C09-F101 chr13:51946238-51946268
[0102] ATP7B-C10-F101 chr13:51949620-51949650
[0103] ATP7B-C11-F101 chr13:51949928-51949958
[0104] ATP7B-C12-F101 chr13:51950224-51950254
[0105] ATP7B-C13-F101 chr13:51957458-51957488
[0106] ATP7B-C14-F101 chr13:51958270-51958300
[0107] ATP7B-C14-R201 chr13:51958575-51958605
[0108] ATP7B-C15-F101 chr13:51960075-51960101
[0109] ATP7B-C16-F101 chr13:51961785-51961815
[0110] ATP7B-C17-R101 chr13:51965082-51965112
[0111] ATP7B-C18-F101 chr13:51968396-51968426
[0112] ATP7B-C19-F101 chr13:51970442-51970472
[0113] ATP7B-C20-F101 chr13:51973854-51973884
[0114] ATP7B-C20-F301 chr13:51974074-51974102
[0115] ATP7B-C20-R401 chr13:51974978-51975008
[0116] ATP7B-C20-F501 chr13:51974293-51974323
[0117] ATP7B-C20-R601 chr13:51974825-51974849
[0118] ATP7B-C20-F701 chr13:51974427-51974457
[0119] ATP7B-C21-F101 chr13:52011107-52011137
[0120] ATP7B-D01-R101 chr13:51947922-51947952
[0121] ATP7B-D02-F101 chr13:51972573-51972603
[0122] ATP7B-D02-F201 chr13:51972577-51972607
[0123] ATP7B-D03-F101 chr13:51995244-51995274
[0124] ATP7B-Dfi-F101 chr13:52011311-52011338
[0125] CFTR-C01-R101 chr7:117480208-117480238
[0126] CFTR-C02-F101 chr7:117504205-117504235
[0127] CFTR-C03-F101 chr7:117508983-117509013
[0128] CFTR-C04-R101 chr7:117531106-117531136
[0129] CFTR-C04-R201 chr7:117531135-117531166
[0130] CFTR-C06-F101 chr7:117535200-117535230
[0131] CFTR-C07-F101 chr7:117536440-117536479
[0132] CFTR-C08-R101 chr7:117540315-117540347
[0133] CFTR-C08-F201 chr7:117540096-117540126
[0134] CFTR-C09-R101 chr7:117542157-117542187
[0135] CFTR-C11-F101 chr7:117559409-117559439
[0136] CFTR-C11-R201 chr7:117559720-117559750
[0137] CFTR-C12-F101 chr7:117587672-117587702
[0138] CFTR-C14-R101 chr7:117592143-117592173
[0139] CFTR-C14-F301 chr7:117592090-117592120
[0140] CFTR-C14-R401 chr7:117592468-117592498
[0141] CFTR-C15-F101 chr7:117594875-117594905
[0142] CFTR-C16-F101 chr7:117602752-117602782
[0143] CFTR-C17-F101 chr7:117603491-117603521
[0144] CFTR-C17-R201 chr7:117603792-117603822
[0145] CFTR-C18-F101 chr7:117606551-117606581
[0146] CFTR-C19-F101 chr7:117610460-117610490
[0147] CFTR-C20-F201 chr7:117611571-117611601
[0148] CFTR-C21-F101 chr7:117614536-117614566
[0149] CFTR-C22-R101 chr7:117627765-117627795
[0150] CFTR-C22-R201 chr7:117627816-117627846
[0151] CFTR-C23-F101 chr7:117642390-117642420
[0152] CFTR-C24-F101 chr7:117652702-117652734
[0153] CFTR-C25-F101 chr7:117664635-117664666
[0154] CFTR-C27-R101 chr7:117667098-117667128
[0155] CFTR-C27-F201 chr7:117666886-117666916
[0156] CFTR-D01-R101 chr7:117505195-117505225
[0157] CFTR-D02-F101 chr7:117625891-117625921
[0158] CFTR-D03-F101 chr7:117642818-117642848
[0159] CFTR-D04-F101 chr7:117666570-117666600
[0160] CFTR-D05-F101 chr7:117715677-117715707
[0161] CFTR-Dfi-R101 chr7:117480133-117480163
[0162] CFTR-Dth-F101 chr7:117667072-117667102
[0163] CYP21A2-C01-R101 chr6:32038620-32038646
[0164] CYP21A2-C02-F101 chr6:32038562-32038591
[0165] CYP21A2-C03-R101 chr6:32039265-32039285
[0166] CYP21A2-C04-R101 chr6:32039495-32039525
[0167] CYP21A2-C05-F101 chr6:32039501-32039531
[0168] CYP21A2-C06-F101 chr6:32039587-32039616
[0169] CYP21A2-C07-F101 chr6:32039912-32039941
[0170] CYP21A2-C07-R201 chr6:32040266-32040291
[0171] CYP21A2-C08-F101 chr6:32040375-32040395
[0172] CYP21A2-C09-R101 chr6:32040796-32040821
[0173] CYP21A2-C10-R101 chr6:32041123-32041145
[0174] CYP21A2-C10-F201 chr6:32040879-32040905
[0175] ETFDH-C01-R101 chr4:158672512-158672542
[0176] ETFDH-C04-F101 chr4:158684465-158684495
[0177] ETFDH-C05-F101 chr4:158684971-158685001
[0178] ETFDH-C06-F101 chr4:158690249-158690280
[0179] ETFDH-C08-F101 chr4:158697473-158697502
[0180] ETFDH-C09-R101 chr:158699214-158699172
[0181] ETFDH-C11-F101 chr4:158706144-158706174
[0182] ETFDH-C12-F201 chr4:158706618-158706648
[0183] ETFDH-C13-R101 chr4:158708537-158708567
[0184] ETFDH-D02-F101 chr4:158700765-158700795
[0185] ETFDH-D03-R101 chr4:158708200-158708230
[0186] ETFDH-Dth-F101 chr4:158708498-158708528
[0187] FBN1-C01-R101 chr15:48411229-48411259
[0188] FBN1-C01-F201 chr15:48411109-48411139
[0189] FBN1-C02-F101 chr15:48412510-48412536
[0190] FBN1-C03-F101 chr15:48415489-48415519
[0191] FBN1-C03-R201 chr15:48415797-48415827
[0192] FBN1-C04-F101 chr15:48420630-48420660
[0193] FBN1-C05-F101 chr15:48421447-48421477
[0194] FBN1-C07-F101 chr15:48425276-48425305
[0195] FBN1-C09-R201 chr15:48427783-48427813
[0196] FBN1-C10-F101 chr15:48428272-48428302
[0197] FBN1-C11-F101 chr15:48430612-48430642
[0198] FBN1-C12-F101 chr15:48432825-48432855
[0199] FBN1-C13-F101 chr15:48434546-48434576
[0200] FBN1-C14-F101 chr15:48436863-48436893
[0201] FBN1-C15-F101 chr15:48437280-48437310
[0202] FBN1-C16-F101 chr15:48437698-48437728
[0203] FBN1-C17-F101 chr15:48441668-48441698
[0204] FBN1-C19-F101 chr15:48445335-48445365
[0205] FBN1-C20-F101 chr15:48446658-48446688
[0206] FBN1-C21-R101 chr15:48448952-48448988
[0207] FBN1-C22-F101 chr15:48452512-48452542
[0208] FBN1-C23-F101 chr15:48456562-48456592
[0209] FBN1-C24-F101 chr15:48460201-48460231
[0210] FBN1-C25-F101 chr15:48463009-48463039
[0211] FBN1-C26-F101 chr15:48463844-48463874
[0212] FBN1-C27-F101 chr15:48465526-48465556
[0213] FBN1-C28-F101 chr15:48465737-48465767
[0214] FBN1-C29-F101 chr15:48467880-48467910
[0215] FBN1-C31-F101 chr15:48470532-48470561
[0216] FBN1-C32-F101 chr15:48472496-48472526
[0217] FBN1-C33-F101 chr15:48474201-48474231
[0218] FBN1-C34-F101 chr15:48474487-48474517
[0219] FBN1-C37-F101 chr15:48485330-48485360
[0220] FBN1-C38-R101 chr15:48487226-48487256
[0221] FBN1-C39-F101 chr15:48487270-48487300
[0222] FBN1-C41-F101 chr15:48488315-48488345
[0223] FBN1-C42-F101 chr15:48489801-48489831
[0224] FBN1-C42-R201 chr15:48490088-48490118
[0225] FBN1-C43-F101 chr15:48492355-48492385
[0226] FBN1-C44-F101 chr15:48494125-48494155
[0227] FBN1-C45-F101 chr15:48495074-48495104
[0228] FBN1-C48-F101 chr15:48497203-48497233
[0229] FBN1-C49-F101 chr15:48498935-48498965
[0230] FBN1-C50-F101 chr15:48503711-48503741
[0231] FBN1-C51-F101 chr15:48504973-48505003
[0232] FBN1-C53-F101 chr15:48509999-48510029
[0233] FBN1-C54-F101 chr15:48513504-48513534
[0234] FBN1-C55-F101 chr15:48515342-48515372
[0235] FBN1-C56-R101 chr15:48516373-48516403
[0236] FBN1-C57-F101 chr15:48520569-48520599
[0237] FBN1-C58-F101 chr15:48526080-48526110
[0238] FBN1-C61-F101 chr15:48596230-48596260
[0239] FBN1-C63-F101 chr15:48610595-48610625
[0240] FBN1-C65-F101 chr15:48644545-48644575
[0241] FBN1-D01-R101 chr15:48427962-48427992
[0242] FBN1-D02-F101 chr15:48434131-48434161
[0243] FBN1-Dfi-F201 chr15:48645497-48645518
[0244] FBN1-Dfi-F101 chr15:48644704-48644731
[0245] G6PD-D01-R101 chrX:154518398-154518424
[0246] G6PD-D01-F201 chrX:154518185-154518215
[0247] G6PD-D02-F101 chrX:154533298-154533328
[0248] G6PD-D03-F101 chrX:154546696-154546726
[0249] G6PD-C02-F101 chrX:154532044-154532072
[0250] G6PD-C03-F101 chrX:154532219-154532244
[0251] G6PD-C04-F101 chrX:154532492-154532515
[0252] G6PD-C04-R201 chrX:154532858-154532884
[0253] G6PD-C05-F101 chrX:154532910-154532930
[0254] G6PD-C06-F101 chrX:154533506-154533530
[0255] G6PD-C06-R201 chrX:154533817-154533847
[0256] G6PD-C07-F101 chrX:154533940-154533970
[0257] G6PD-C08-F101 chrX:154534279-154534304
[0258] G6PD-C09-F101 chrX:154535093-154535119
[0259] G6PD-C09-R201 chrX:154535396-154535425
[0260] G6PD-C10-F101 chrX:154535825-154535848
[0261] G6PD-C11-F101 chrX:154535934-154535962
[0262] G6PD-C12-F101 chrX:154545987-154546016
[0263] GAA-C01-R101 chr17:80104808-80104830
[0264] GAA-C01-F201 chr17:80104868-80104893
[0265] GAA-C01-F301 chr17:80104726-80104752
[0266] GAA-C02-F101 chr17:80105683-80105709
[0267] GAA-C03-F101 chr17:80107488-80107512
[0268] GAA-C04-F101 chr17:80107647-80107671
[0269] GAA-C05-F101 chr17:80108232-80108260
[0270] GAA-C06-F101 chr17:80108388-80108414
[0271] GAA-C07-F101 chr17:80108596-80108619
[0272] GAA-C08-F101 chr17:80109858-80109887
[0273] GAA-C09-F101 chr17:80110591-80110618
[0274] GAA-C10-F101 chr17:80110899-80110926
[0275] GAA-C12-F101 chr17:80112468-80112493
[0276] GAA-C13-F101 chr17:80112790-80112814
[0277] GAA-C14-F101 chr17:80113128-80113152
[0278] GAA-C15-F101 chr17:80116922-80116948
[0279] GAA-C16-F101 chr17:80117520-80117546
[0280] GAA-C17-F101 chr17:80118107-80118130
[0281] GAA-C18-R101 chr17:80118878-80118901
[0282] GAA-C19-F101 chr17:80119238-80119260
[0283] GAA-D01-R101 chr17:80112868-80112897
[0284] GAA-Dfi-R201 chr17:80101924-80101951
[0285] GAA-Dfi-R101 chr17:80104642-80104663
[0286] GAA-Dth-F101 chr17:80119260-80119290
[0287] GALC-D02-R101 chr14:87981557-87981592
[0288] GALC-D03-F101 chr14:87986974-87987004
[0289] GALC-D04-F101 chr14:87992253-87992283
[0290] GALC-D05-F101 chr14:87992283-87992313
[0291] GALC-D06-F101 chr14:87993312-87993342
[0292] GALC-C02-F101 chr14:87939864-87939894
[0293] GALC-C03-F101 chr14:87941315-87941345
[0294] GALC-C04-F101 chr14:87945512-87945542
[0295] GALC-C05-F101 chr14:87947650-87947680
[0296] GALC-C07-F101 chr14:87950577-87950607
[0297] GALC-C12-F101 chr14:87982047-87982077
[0298] GALC-C13-F101 chr14:87984287-87984317
[0299] GALC-C14-F101 chr14:87986447-87986477
[0300] GALC-C15-F101 chr14:87988103-87988133
[0301] GALC-C17-R101 chr14:87993174-87993193
[0302] GALC-Dfi-F101 chr14:87993139-87993165
[0303] GCDH-C01-R101 chr19:12891495-12891525
[0304] GCDH-C02-F101 chr19:12891430-12891457
[0305] GCDH-C03-F101 chr19:12891774-12891799
[0306] GCDH-C04-F101 chr19:12892083-12892105
[0307] GCDH-C05-F101 chr19:12893441-12893470
[0308] GCDH-C06-F101 chr19:12895930-12895960
[0309] GCDH-C07-F101 chr19:12896168-12896193
[0310] GCDH-C07-R201 chr19:12896434-12896459
[0311] GCDH-C08-F101 chr19:12896829-12896858
[0312] GCDH-C09-F101 chr19:12897269-12897292
[0313] GCDH-C10-F101 chr19:12897662-12897689
[0314] GCDH-C11-F101 chr19:12899423-12899453
[0315] GCDH-D02-F101 chr19:12898007-12898037
[0316] GCDH-D03-R101 chr19:12899853-12899879
[0317] GCDH-D04-F101 chr19:12913857-12913887
[0318] GCDH-Dfi-R101 chr19:12891356-12891378
[0319] GCDH-Dth-F101 chr19:12899442-12899473
[0320] GJB2-C01-R101 chr13:20189092-20189122
[0321] GJB2-C01-F201 chr13:20189360-20189390
[0322] GJB2-C01-R301 chr13:20189332-20189356
[0323] GJB2-C01-F401 chr13:20189113-20189143
[0324] GJB3-C01-R101 chr1:34784952-34784982
[0325] GJB3-C01-F201 chr1:34785355-34785385
[0326] GJB3-C01-R301 chr1:34785152-34785182
[0327] GJB3-C01-R401 chr1:34785408-34785431
[0328] GJB3-C01-F501 chr1:34785079-34785101
[0329] GJB3-Dfi-R101 chr1:34781778-34781798
[0330] GJB3-Dth-F101 chr1:34785515-34785542
[0331] GLA-C01-R101 chrX:101398056-101398085
[0332] GLA-C02-R101 chrX:101398515-101398545
[0333] GLA-C03-F101 chrX:101398729-101398759
[0334] GLA-C04-F101 chrX:101400540-101400570
[0335] GLA-C05-F101 chrX:101401591-101401621
[0336] GLA-C06-F101 chrX:101403759-101403789
[0337] GLA-C07-R101 chrX:101407917-101407944
[0338] GLA-D01-R101 chrX:101399823-101399853
[0339] GLA-D02-F101 chrX:101401155-101401185
[0340] GLA-Dfi-F101 chrX:101407874-101407904
[0341] HBA1-C01-R101 chr16:176910-176934
[0342] HBA1-C02-F101 chr16:176861-176883
[0343] HBA1-C02-R201 chr16:177153-177175
[0344] HBA1-C03-F101 chr16:177182-177204
[0345] HBA1-Dfi-R101 chr16:176722-176746
[0346] HBA2-C02-F201 chr16:173194-173218
[0347] HBA2-C03-F101 chr16:173440-173461
[0348] HBB-C01-R101 chr11:5225741-5225771
[0349] HBB-C02-R101 chr11:5226793-5226823
[0350] HBB-C02-R201 chr11:5226812-5226842
[0351] HBB-C03-F101 chr11:5226879-5226909
[0352] HLCS-C01-R101 chr21:36754443-36754473
[0353] HLCS-C02-R101 chr21:36756738-36756768
[0354] HLCS-C02-R201 chr21:36756765-36756792
[0355] HLCS-C04-F101 chr21:36764948-36764978
[0356] HLCS-C05-F101 chr21:36767035-36767063
[0357] HLCS-C06-F101 chr21:36896798-36896828
[0358] HLCS-C06-R201 chr21:36897141-36897171
[0359] HLCS-C07-F101 chr21:36930195-36930219
[0360] HLCS-C08-F101 chr21:36936401-36936431
[0361] HLCS-C08-R201 chr21:36937432-36937467
[0362] HLCS-C08-F301 chr21:36936612-36936638
[0363] HLCS-C08-R401 chr21:36937212-36937242
[0364] HLCS-C08-F501 chr21:36936747-36936777
[0365] HLCS-C09-R101 chr21:36939030-36939067
[0366] HLCS-C10-F101 chr21:36961971-36962001
[0367] HLCS-D01-R101 chr21:36756994-36757024
[0368] HLCS-D02-F101 chr21:36892450-36892480
[0369] HLCS-D03-F101 chr21:36900570-36900597
[0370] HLCS-D04-F101 chr21:36962825-36962855
[0371] IDUA-C02-F101 chr4:1000770-1000797
[0372] IDUA-C03-F101 chr4:1001351-1001380
[0373] IDUA-C04-F101 chr4:1001643-1001667
[0374] IDUA-C04-R201 chr4:1001907-1001927
[0375] IDUA-C05-F101 chr4:1001943-1001962
[0376] IDUA-C06-F201 chr4:1002265-1002286
[0377] IDUA-C08-R201 chr4:1003512-1003532
[0378] IDUA-C08-F301 chr4:1003042-1003067
[0379] IDUA-C09-F101 chr4:1003472-1003494
[0380] IDUA-C10-F101 chr4:1003958-1003985
[0381] IDUA-C12-R101 chr4:987308-987333
[0382] IDUA-C13-F101 chr4:987725-987750
[0383] IDUA-D01-R101 chr4:991950-991974
[0384] IDUA-D02-F101 chr4:992072-992099
[0385] IDUA-Dth-F101 chr4:1004323-1004347
[0386] MECP2-C01-R101 chrX:154030566-154030594
[0387] MECP2-C01-F201 chrX:154031176-154031205
[0388] MECP2-C01-R401 chrX:154031292-154031322
[0389] MECP2-C01-F501 chrX:154030716-154030739
[0390] MECP2-C01-R601 chrX:154031077-154031101
[0391] MECP2-C02-R101 chrX:154032450-154032480
[0392] MECP2-C02-R201 chrX:154032576-154032606
[0393] MECP2-D03-F101 chrX:154092125-154092155
[0394] MECP2-D01-R101 chrX:154058030-154058060
[0395] MECP2-D02-F101 chrX:154058336-154058366
[0396] MECP2-D03-R101 chrX:154073164-154073194
[0397] MECP2-Dfi-F101 chrX:154092179-154092209
[0398] MMACHC-C01-R101 chr1:45500423-45500453
[0399] MMACHC-C03-F101 chr1:45508115-45508145
[0400] MMACHC-C04-R101 chr1:45509003-45509033
[0401] MMACHC-C04-F201 chr1:45508952-45508981
[0402] MMACHC-C04-F301 chr1:45508914-45508944
[0403] MMACHC-Dfi-R101 chr1:45500374-45500404
[0404] MMACHC-Dth-F101 chr1:45509195-45509216
[0405] MMUT-C02-F101 chr6:49435397-49435429
[0406] MMUT-C04-F101 chr6:49441791-49441821
[0407] MMUT-C06-F101 chr6:49447592-49447622
[0408] MMUT-C08-R101 chr6:49451683-49451714
[0409] MMUT-C08-F201 chr6:49451469-49451499
[0410] MMUT-C09-F201 chr6:49453608-49453641
[0411] MMUT-C11-R101 chr6:49457930-49457960
[0412] MMUT-C11-R201 chr6:49458090-49458128
[0413] MMUT-C12-R101 chr6:49459321-49459345
[0414] MMUT-C12-F201 chr6:49459196-49459226
[0415] MMUT-Dfi-F201 chr6:49463073-49463103
[0416] MMUT-Dfi-F101 chr6:49459404-49459434
[0417] NF1-C02-F101 chr17:31155880-31155910
[0418] NF1-C03-F101 chr17:31158943-31158973
[0419] NF1-C04-R101 chr17:31163386-31163425
[0420] NF1-C06-F101 chr17:31181251-31181281
[0421] NF1-C07-F101 chr17:31181538-31181568
[0422] NF1-C08-F101 chr17:31182453-31182486
[0423] NF1-C08-R201 chr17:31182906-31182943
[0424] NF1-C09-F101 chr17:31200329-31200368
[0425] NF1-C10-F101 chr17:31200930-31200960
[0426] NF1-C11-F101 chr17:31201328-31201359
[0427] NF1-C12-F101 chr17:31206122-31206152
[0428] NF1-C13-R101 chr17:31214617-31214651
[0429] NF1-C14-F101 chr17:31218928-31218961
[0430] NF1-C15-R101 chr17:31222001-31222040
[0431] NF1-C16-F101 chr17:31223394-31223428
[0432] NF1-C17-R101 chr17:31225261-31225298
[0433] NF1-C18-F101 chr17:31226394-31226424
[0434] NF1-C19-F101 chr17:31227126-31227153
[0435] NF1-C20-F101 chr17:31227454-31227484
[0436] NF1-C21-R101 chr17:31229215-31229245
[0437] NF1-C21-F201 chr17:31229245-31229275
[0438] NF1-C21-R301 chr17:31229471-31229509
[0439] MMACHC-C02-F101 chr1:45507483-45507504
[0440] NF1-C23-R101 chr17:31230424-31230461
[0441] NF1-C24-F101 chr17:31230786-31230813
[0442] NF1-C25-R101 chr17:31232212-31232242
[0443] NF1-C26-F101 chr17:31232657-31232687
[0444] NF1-C27-R101 chr17:31233204-31233234
[0445] NF1-C27-F201 chr17:31232987-31233017
[0446] NF1-C28-F101 chr17:31235555-31235590
[0447] NF1-C29-F101 chr17:31235859-31235898
[0448] NF1-C30-F101 chr17:31248877-31248907
[0449] NF1-C31-F101 chr17:31252891-31252921
[0450] NF1-C33-R101 chr17:31259146-31259180
[0451] NF1-C34-R101 chr17:31260527-31260557
[0452] NF1-C35-F101 chr17:31261606-31261638
[0453] NF1-C37-R101 chr17:31326022-31326052
[0454] NF1-C37-R201 chr17:31326300-31326330
[0455] NF1-C37-F301 chr17:31325973-31326003
[0456] NF1-C38-F101 chr17:31327455-31327485
[0457] NF1-C38-F201 chr17:31327439-31327478
[0458] NF1-C40-F101 chr17:31334790-31334820
[0459] NF1-C42-R101 chr17:31336872-31336902
[0460] NF1-C42-R201 chr17:31336929-31336960
[0461] NF1-C43-R101 chr17:31337565-31337595
[0462] NF1-C44-F101 chr17:31337706-31337736
[0463] NF1-C45-R101 chr17:31338151-31338181
[0464] NF1-C46-F101 chr17:31338622-31338652
[0465] NF1-C47-F101 chr17:31340436-31340467
[0466] NF1-C48-F101 chr17:31342968-31342998
[0467] NF1-C49-F101 chr17:31349046-31349076
[0468] NF1-C50-F101 chr17:31350142-31350172
[0469] NF1-C51-F101 chr17:31352188-31352218
[0470] NF1-C52-F101 chr17:31356337-31356367
[0471] NF1-C53-F101 chr17:31356919-31356949
[0472] NF1-C56-F101 chr17:31358773-31358804
[0473] NF1-C57-R201 chr17:31360743-31360773
[0474] NF1-C58-F101 chr17:31373969-31373999
[0475] NF1-D01-R101 chr17:31203213-31203243
[0476] NF1-D02-F101 chr17:31207111-31207141
[0477] NF1-D03-F101 chr17:31236401-31236431
[0478] NF1-D04-F101 chr17:31257647-31257677
[0479] NF1-D05-F101 chr17:31299422-31299454
[0480] NF1-D08-F101 chr17:31362212-31362241
[0481] NF1-D10-F101 chr17:31378837-31378867
[0482] NF1-Dfi-R101 chr17:31095351-31095374
[0483] NF1-Dth-F101 chr17:31374113-31374143
[0484] PAH-C01-R101 chr12:102839228-102839258
[0485] PAH-C02-F101 chr12:102840355-102840385
[0486] PAH-C03-F101 chr12:102843540-102843570
[0487] PAH-C04-F101 chr12:102844295-102844325
[0488] PAH-C05-F101 chr12:102846821-102846851
[0489] PAH-C06-F101 chr12:102851625-102851655
[0490] PAH-C07-F101 chr12:102852739-102852767
[0491] PAH-C08-F101 chr12:102855083-102855109
[0492] PAH-C09-F101 chr12:102866554-102866584
[0493] PAH-C10-F101 chr12:102877356-102877386
[0494] PAH-C11-F101 chr12:102894685-102894715
[0495] PAH-C12-F101 chr12:102912741-102912771
[0496] PAH-C13-F101 chr12:102916977-102917007
[0497] PAH-D01-R101 chr12:102854823-102854853
[0498] PAH-D02-F101 chr12:102913664-102913694
[0499] PAH-Dfi-F101 chr12:102917061-102917091
[0500] PAH-Dth-R101 chr12:102839194-102839218
[0501] PTPN11-C02-F101 chr12:112446212-112446242
[0502] PTPN11-C03-F101 chr12:112450263-112450293
[0503] PTPN11-C04-R101 chr12:112453397-112453425
[0504] PTPN11-C05-F101 chr12:112454482-112454512
[0505] PTPN11-C06-F101 chr12:112455829-112455859
[0506] PTPN11-C08-F101 chr12:112477599-112477629
[0507] PTPN11-C09-F101 chr12:112477794-112477825
[0508] PTPN11-C10-F101 chr12:112481964-112481994
[0509] PTPN11-C11-F101 chr12:112486394-112486424
[0510] PTPN11-C12-F101 chr12:112488385-112488415
[0511] PTPN11-C13-R101 chr12:112489202-112489232
[0512] PTPN11-C14-F101 chr12:112502102-112502132
[0513] PTPN11-C15-F101 chr12:112504629-112504659
[0514] PTPN11-D01-F101 chr12:112457251-112457281
[0515] PTPN11-D02-F101 chr12:112504064-112504094
[0516] PTPN11-D03-F101 chr12:112505702-112505732
[0517] PTPN11-Dfi-R101 chr12:112419111-112419133
[0518] SLC22A5-C01-R101 chr5:132370227-132370249
[0519] SLC22A5-C01-F201 chr5:132370090-132370113
[0520] SLC22A5-C02-F101 chr5:132378337-132378367
[0521] SLC22A5-C03-F101 chr5:132384103-132384132
[0522] SLC22A5-C04-F101 chr5:132385287-132385317
[0523] SLC22A5-C05-F101 chr5:132386921-132386951
[0524] SLC22A5-C06-F101 chr5:132388838-132388868
[0525] SLC22A5-C07-F101 chr5:132390614-132390644
[0526] SLC22A5-C07-R201 chr5:132390918-132390948
[0527] SLC22A5-C08-F101 chr5:132392369-132392395
[0528] SLC22A5-C09-F101 chr5:132393603-132393633
[0529] SLC22A5-C10-F101 chr5:132394082-132394112
[0530] SLC22A5-D01-R101 chr5:132378245-132378275
[0531] SLC22A5-Dfi-R101 chr5:132369977-132370001
[0532] SLC22A5-Dth-F101 chr5:132394243-132394273
[0533] SLC25A13-C01-F101 chr7:96121150-96121180
[0534] SLC25A13-C02-F101 chr7:96121613-96121643
[0535] SLC25A13-C03-R101 chr7:96122007-96122037
[0536] SLC25A13-C04-F101 chr7:96131701-96131731
[0537] SLC25A13-C06-F101 chr7:96169998-96170028
[0538] SLC25A13-C08-F101 chr7:96184185-96184215
[0539] SLC25A13-C09-F101 chr7:96184815-96184849
[0540] SLC25A13-C10-F101 chr7:96189251-96189281
[0541] SLC25A13-C11-F101 chr7:96189516-96189546
[0542] SLC25A13-C12-F101 chr7:96191062-96191092
[0543] SLC25A13-C13-F101 chr7:96192993-96193025
[0544] SLC25A13-C15-F101 chr7:96234741-96234771
[0545] SLC25A13-C17-F101 chr7:96296776-96296806
[0546] SLC25A13-C18-F101 chr7:96321717-96321740
[0547] SLC25A13-D01-R101 chr7:96169962-96169992
[0548] SLC25A13-D02-F101 chr7:96284550-96284589
[0549] SLC25A13-D03-F101 chr7:96309465-96309495
[0550] SLC25A13-Dfi-F101 chr7:96321880-96321901
[0551] SLC25A13-Dth-R101 chr7:96121214-96121245
[0552] SLC26A4-C01-R101 chr7:107661819-107661842
[0553] SLC26A4-C02-F101 chr7:107663243-107663273
[0554] SLC26A4-C03-F101 chr7:107672073-107672103
[0555] SLC26A4-C05-F101 chr7:107674872-107674908
[0556] SLC26A4-C07-F101 chr7:107683306-107683336
[0557] SLC26A4-C08-F101 chr7:107689002-107689032
[0558] SLC26A4-C09-F101 chr7:107690083-107690113
[0559] SLC26A4-C10-F101 chr7:107694355-107694385
[0560] SLC26A4-C12-R101 chr7:107696073-107696103
[0561] SLC26A4-C13-F101 chr7:107697998-107698028
[0562] SLC26A4-C14-F101 chr7:107699994-107700024
[0563] SLC26A4-C15-F101 chr7:107701039-107701069
[0564] SLC26A4-C16-R101 chr7:107702051-107702081
[0565] SLC26A4-C17-F101 chr7:107704267-107704297
[0566] SLC26A4-C18-R101 chr7:107710257-107710288
[0567] SLC26A4-C19-F101 chr7:107712465-107712495
[0568] SLC26A4-C20-F101 chr7:107715365-107715398
[0569] SLC26A4-Dfi-R101 chr7:107660926-107660955
[0570] SLC26A4-Dth-F101 chr7:107715388-107715418
[0571] SOS1-D01-F101 chr2:38962654-38962684
[0572] SOS1-D02-R101 chr2:38985446-38985476
[0573] SOS1-D04-F101 chr2:39034653-39034683
[0574] SOS1-D05-F101 chr2:39034778-39034808
[0575] SOS1-D06-F101 chr2:39124108-39124132
[0576] SOS1-D07-F101 chr2:39124620-39124647
[0577] SOS1-C01-R101 chr2:38986029-38986059
[0578] SOS1-C01-F201 chr2:38986079-38986108
[0579] SOS1-C01-F301 chr2:38985969-38985999
[0580] SOS1-C02-F101 chr2:38987380-38987417
[0581] SOS1-C04-F101 chr2:38994907-38994937
[0582] SOS1-C04-F201 chr2:38995164-38995194
[0583] SOS1-C04-F301 chr2:38995132-38995162
[0584] SOS1-C07-F101 chr2:39006295-39006325
[0585] SOS1-C10-R101 chr2:39012327-39012357
[0586] SOS1-C10-F201 chr2:39012094-39012129
[0587] SOS1-C12-F101 chr2:39013780-39013811
[0588] SOS1-C14-F101 chr2:39022527-39022557
[0589] SOS1-C14-R201 chr2:39023260-39023293
[0590] SOS1-C14-F301 chr2:39022729-39022759
[0591] SOS1-C14-R401 chr2:39023039-39023069
[0592] SOS1-C15-F101 chr2:39023919-39023949
[0593] SOS1-C16-F101 chr2:39035107-39035137
[0594] SOS1-C17-F101 chr2:39035287-39035317
[0595] SOS1-C18-F101 chr2:39051052-39051087
[0596] SOS1-C19-F101 chr2:39054558-39054588
[0597] SOS1-C19-R201 chr2:39054863-39054893
[0598] SOS1-C21-F101 chr2:39058632-39058662
[0599] SOS1-C22-F101 chr2:39067557-39067587
[0600] SOS1-C23-F101 chr2:39120180-39120203
[0601] SOS1-Dfi-F101 chr2:39120379-39120407
[0602] SOS1-C10-R201 chr2:38995197-38995220
[0603] CFTR-C08-R201 chr7:117540128-117540157
[0604] ASS1-C05-R101 chr9:130458659-130458679
[0605] GJB2-H04-R01 chr13:20192856-20192874
[0606] UGT1A1-C01-R101 chr2:233760499-233760529
[0607] UGT1A1-C01-F201 chr2:233760929-233760959
[0608] UGT1A1-C01-F301 chr2:233760447-233760477
[0609] UGT1A1-C01-R401 chr2:233760993-233761023
[0610] UGT1A1-C01-F501 chr2:233760596-233760626
[0611] UGT1A1-C02-F101 chr2:233766921-233766957
[0612] UGT1A1-C03-F101 chr2:233767736-233767766
[0613] UGT1A1-C04-F101 chr2:233768170-233768200
[0614] UGT1A1-C04-R201 chr2:233768455-233768485
[0615] UGT1A1-C05-R101 chr2:233772507-233772536
[0616] UGT1A1-C05-F201 chr2:233772281-233772305
[0617] UGT1A1-D01-R101 chr2:233769636-233769666
[0618] UGT1A1-Dfi-R101 chr2:233760356-233760385
[0619] UGT1A1-Dth-F101 chr2:233772525-233772555
[0620] ACADVL-H01-F01 chr17:7222105-7222127
[0621] ATP7B-H02-F01 chr13:52011683-52011707
[0622] CFTR-H01-F01 chr7:117479180-117479209
[0623] CFTR-H02-F01 chr7:117479450-117479480
[0624] CFTR-H03-F01 chr7:117479694-117479719
[0625] CFTR-H04-F01 chr7:117479962-117479991
[0626] CFTR-H05-F01 chr7:117498253-117498283
[0627] CFTR-H06-F01 chr7:117504195-117504225
[0628] CFTR-H08-F01 chr7:117559277-117559307
[0629] CFTR-H10-F01 chr7:117589251-117589281
[0630] CFTR-H11-F01 chr7:117602689-117602719
[0631] CFTR-H13-F01 chr7:117609966-117609998
[0632] CFTR-H14-F01 chr7:117611428-117611458
[0633] CFTR-H15-F01 chr7:117626154-117626184
[0634] CFTR-H16-F01 chr7:117627395-117627425
[0635] CFTR-H17-F01 chr7:117627702-117627732
[0636] CFTR-H18-F01 chr7:117639756-117639786
[0637] CFTR-H19-F01 chr7:117642308-117642338
[0638] CFTR-H20-F01 chr7:117664567-117664597
[0639] CFTR-H21-F01 chr7:117665532-117665562
[0640] CYP21A2-H02-F01 chr6:32040960-32040983
[0641] FBN1-H01-F01 chr15:48428382-48428412
[0642] FBN1-H02-F01 chr15:48465584-48465614
[0643] G6PD-H01-F01 chrX:154534390-154534418
[0644] GAA-H01-F01 chr17:80104323-80104353
[0645] GAA-H03-R01 chr17:80108925-80108955
[0646] GAA-H04-F01 chr17:80117777-80117800
[0647] GALC-H01-F01 chr14:87993134-87993159
[0648] GJB2-H01-F01 chr13:20189563-20189585
[0649] GJB2-H02-F01 chr13:20192656-20192679
[0650] GJB2-H03-F01 chr13:20192983-20193009
[0651] GLA-H02-F01 chrX:101399689-101399719
[0652] GLA-H03-F01 chrX:101401544-101401574
[0653] MECP2-H01-F01 chrX:154030211-154030241
[0654] MECP2-H02-F01 chrX:154097597-154097624
[0655] NF1-H01-F01 chr17:31094825-31094855
[0656] NF1-H02-F01 chr17:31181337-31181372
[0657] NF1-H03-F01 chr17:31183211-31183250
[0658] NF1-H04-R01 chr17:31200426-31200456
[0659] NF1-H06-F01 chr17:31202972-31203002
[0660] NF1-H08-F01 chr17:31215697-31215727
[0661] NF1-H11-R01 chr17:31227216-31227243
[0662] NF1-H12-R01 chr17:31229021-31229050
[0663] NF1-H14-F01 chr17:31327416-31327446
[0664] NF1-H16-F01 chr17:31337556-31337586
[0665] NF1-H18-R01 chr17:31358671-31358701
[0666] PAH-H01-F01 chr12:102843749-102843779
[0667] PAH-H02-R01 chr12:102855239-102855270
[0668] PAH-H04-F01 chr12:102865741-102865771
[0669] PAH-H05-F01 chr12:102890723-102890753
[0670] PAH-H06-F01 chr12:102912730-102912760
[0671] SLC25A13-H01-F01 chr7:96204821-96204851
[0672] SLC26A4-H01-F01 chr7:107660680-107660710
[0673] SLC26A4-H02-F01 chr7:107683319-107683354
[0674] SLC26A4-H03-F01 chr7:107694350-107694380
[0675] SLC26A4-H05-F01 chr7:107715475-107715505
[0676] ATP7B-Y01-F01 chr13:51944106-51944136
[0677] ATP7B-Y02-F01 chr13:51964983-51965013
[0678] GAA-Y01-F01 chr17:80108332-80108362
[0679] NF1-Y01-R01 chr17:31231972-31232009
[0680] NF1-Y02-F01 chr17:31330647-31330677
[0681] NF1-Y03-F01 chr17:31334384-31334414
[0682] PAH-Y01-F01 chr12:102843502-102843532
[0683] PAH-Y02-F01 chr12:102894883-102894913
[0684] SLC26A4-Y01-F01 chr7:107661541-107661571
[0685] ACADM-C11-R101 chr1:75761276-75761308
[0686] ACADVL-C18-R101 chr17:7224852-7224881
[0687] ETFDH-C03-R101 chr4:158682372-158682401
[0688] ETFDH-C12-R101 chr4:158706754-158706779
[0689] FBN1-C09-R101 chr15:48427729-48427758
[0690] FBN1-C30-R101 chr15:48468571-48468598
[0691] FBN1-C59-R101 chr15:48534261-48534300
[0692] GAA-C11-R101 chr17:80112141-80112162
[0693] GALC-C08-R101 chr14:87963531-87963573
[0694] GALC-C09-R101 chr14:87965650-87965687
[0695] GALC-C16-R101 chr14:87988592-87988622
[0696] HLCS-C03-R101 chr21:36759900-36759930
[0697] MMACHC-C02-R101 chr1:45507540-45507570
[0698] MMUT-C10-R101 chr6:49456282-49456329
[0699] NF1-C18-R201 chr17:31226704-31226733
[0700] NF1-C41-R101 chr17:31336492-31336532
[0701] SLC25A13-C16-R101 chr7:96277391-96277431
[0702] SOS1-C08-R101 chr2:39007204-39007252
[0703] CYP21A2-H01-R01 chr6:32038153-32038177
[0704] NF1-H10-R01 chr17:31226482-31226507
[0705] ATP7B-C19-F201 chr13:51970507-51970539
[0706] ETFDH-C03-F201 chr4:158682222-158682250
[0707] G6PD-C01-F101 chrX:154531909-154531930
[0708] GALC-C01-F101 chr14:87934674-87934703
[0709] IDUA-C07-F201 chr4:1002738-1002758
[0710] MMUT-C07-F102 chr6:49448698-49448736
[0711] NF1-C32-F101 chr17:31258259-31258291
[0712] NF1-C36-R101 chr17:31265444-31265475
[0713] SLC26A4-C16-F201 chr7:107701869-107701898
[0714] SOS1-C06-R101 chr2:38997468-38997500
[0715] F8-C01-R101 chrX:154837775-154837802
[0716] F8-C02-F101 chrX:154860385-154860420
[0717] F8-C03-F101 chrX:154861670-154861701
[0718] F8-C04-F101 chrX:154863019-154863049
[0719] F8-C05-F101 chrX:154895998-154896027
[0720] F8-C06-F101 chrX:154899778-154899806
[0721] F8-C07-F101 chrX:154901327-154901355
[0722] F8-C08-F101 chrX:154901971-154901998
[0723] F8-C09-F101 chrX:154903847-154903894
[0724] F8-C10-F101 chrX:154904232-154904261
[0725] NF1-C21-R401 chr17:31229354-31229378
[0726] ACADVL-H02-F01 chr17:7217684-7217710
[0727] HLCS-C01-F301 chr21:36966530-36966549
[0728] MTHFR-H01-R101 chr1:11796395-11796421
[0729] MTHFR-C08-R101 chr1:11794469-11794499
[0730] MTRR-H01-R101 chr5:7870916-7870943
[0731] SRY-H01-F01 chrY:2787632-2787662
[0732] MECP2-C01-F202 chrX:154030542-154030563
[0733] MECP2-C01-F302 chrX:154030802-154030831
[0734] ACADVL-C19-F201 chr17:7224539-7224568
[0735] IDUA-C10-F201 chr4:1003113-1003135
[0736] F8-C10-F201 chrX:154904316-154904346
[0737] F8-C11-F101 chrX:154904754-154904787
[0738] F8-C11-F201 chrX:154904806-154904836
[0739] F8-C12-F101 chrX:154906328-154906365
[0740] F8-C13-F101 chrX:154928497-154928526
[0741] F8-C13-R201 chrX:154931740-154931769
[0742] F8-C13-F301 chrX:154928670-154928699
[0743] F8-C13-R401 chrX:154931508-154931536
[0744] F8-C13-F501 chrX:154928893-154928921
[0745] F8-C13-R601 chrX:154931350-154931380
[0746] F8-C13-F701 chrX:154929075-154929108
[0747] F8-C13-R801 chrX:154931132-154931160
[0748] F8-C13-F901 chrX:154929246-154929273
[0749] F8-C13-R1001 chrX:154930942-154930969
[0750] F8-C13-F1101 chrX:154929480-154929508
[0751] F8-C13-R1201 chrX:154930778-154930804
[0752] F8-C13-F1301 chrX:154929629-154929657
[0753] F8-C13-R1401 chrX:154930555-154930584
[0754] F8-C13-F1501 chrX:154929850-154929879
[0755] F8-C13-R1601 chrX:154930370-154930399
[0756] F8-C13-F1701 chrX:154929979-154930009
[0757] F8-C14-F101 chrX:154947654-154947683
[0758] F8-C14-F201 chrX:154947734-154947762
[0759] F8-C15-F101 chrX:154953794-154953827
[0760] F8-C16-F101 chrX:154956917-154956942
[0761] F8-C16-F201 chrX:154956968-154957002
[0762] F8-C17-F101 chrX:154960948-154960970
[0763] F8-C18-F101 chrX:154965910-154965946
[0764] F8-C19-F101 chrX:154966343-154966377
[0765] F8-C19-F201 chrX:154966498-154966525
[0766] F8-C20-F101 chrX:154969235-154969268
[0767] F8-C20-F201 chrX:154969400-154969429
[0768] F8-C21-F101 chrX:154984614-154984643
[0769] F8-C22-F101 chrX:154987119-154987148
[0770] F8-C23-F101 chrX:154992796-154992825
[0771] F8-C23-F201 chrX:154992976-154993006
[0772] F8-C24-F101 chrX:154996899-154996927
[0773] F8-C25-F101 chrX:154999402-154999432
[0774] F8-C26-F101 chrX:155022346-155022371
[0775] F8-D02-F101 chrX:154885990-154886014
[0776] F8-D03-F101 chrX:155026616-155026646
[0777] F8-Dfi-F101 chrX:155022462-155022490
[0778] F8-Dth-R101 chrX:154837625-154837650
[0779] F8-H01-F01 chrX:154863052-154863082
[0780] F8-H02-F01 chrX:154902053-154902081
[0781] F8-H03-F01 chrX:154902381-154902410
[0782] F8-H04-F01 chrX:154902741-154902770
[0783] F8-H05-F01 chrX:154904558-154904588
[0784] F8-H07-F01 chrX:154957124-154957154
[0785] F8-H11-F01 chrX:154997049-154997078
[0786] F8-H12-F01 chrX:154999565-154999594
[0787] F8-H13-F01 chrX:155020702-155020728
[0788] F8-H14-F01 chrX:155022615-155022645
[0789] NF1-C01-R101 chr17:31095414-31095442
[0790] G6PD-C01-R101 chrX:154532171-154532201
[0791] ETFDH-C09-F201 chr4:158698984-158699020
[0792] ETFDH-C09-R201 chr4:158699105-158699139
[0793] SOS1-C06-R201 chr2:38997380-38997413
[0794] SOS1-C09-R201 chr2:39010662-39010693
[0795] MMUT-C09-F201 chr6:49453608-49453641
[0796] SLC26A4-C04-F201 chr7:107674221-107674249
[0797] SLC26A4-C06-R102 chr7:107683368-107683406
[0798] SLC26A4-C06-F101 chr7:107683153-107683188
[0799] FBN1-C47-R101 chr15:48496246-48496274
[0800] NF1-C38-F301 chr17:31327676-31327703
[0801] NF1-C39-R301 chr17:31330407-31330441
[0802] GAA-C01-R301 chr17:80105180-80105199
[0803] F9-C01-R101 chrX:139530941-139530976
[0804] F9-C02-F101 chrX:139536943-139536978
[0805] F9-C03-F101 chrX:139537193-139537228
[0806] F9-C04-F101 chrX:139541030-139541065
[0807] F9-C05-F101 chrX:139548290-139548325
[0808] F9-C06-F101 chrX:139550929-139550964
[0809] F9-C06-F201 chrX:139551117-139551152
[0810] F9-C07-F101 chrX:139560647-139560682
[0811] F9-C08-R101 chrX:139561723-139561751
[0812] F9-C08-F101 chrX:139561873-139561901
[0813] F9-C08-F201 chrX:139561694-139561721
[0814] F9-Dfi-R101 chrX:139530820-139530855
[0815] F9-Dth-F101 chrX:139561985-139562020
[0816] F9-H01-F101 chrX:139530590-139530625
[0817] F9-H02-F101 chrX:139540859-139540894
[0818] F9-H04-F101 chrX:139563042-139563077
[0819] GLA-C01-R201 chrX:101398116-101398147
[0820] G6PD-C01-R102 chrX:154532117-154532140
[0821] G6PD-C02-R101 chrX:154532247-154532271
[0822] NF1-C01-F102 chr17:31095320-31095341
[0823] GJB2-C02-F201 chr13:20192821-20192841
[0824] MECP2-C03-R103 chrX:154097672-154097698
[0825] IDUA-C01-F101 chr4:1000576-1000598
[0826] IDUA-C02-R101 chr4:1001030-1001056
[0827] IDUA-C06-R101 chr4:1002333-1002358
[0828] IDUA-C07-R102 chr4:1002854-1002876
[0829] IDUA-C08-R102 chr4:1003113-1003136
[0830] IDUA-C11-F102 chr4:1004221-1004243
[0831] PTPN11-C01-R102 chr12:112419176-112419198
[0832] HLCS-C01-F101 chr21:36966612-36966638
[0833] HLCS-C01-R201 chr21:36966445-36966467
[0834] UGT1A1-H01-F01 chr2:233756961-233756990
[0835] UGT1A1-H01-R01 chr2:233757040-233757066
[0836] DMD-C1-F02 chrX:33211219-33211251
[0837] DMD-C2-F01 chrX:33019950-33019980
[0838] DMD-C3-R01 chrX:32849922-32849952
[0839] DMD-C4-F01 chrX:32844618-32844648
[0840] DMD-C5-F01 chrX:32823171-32823201
[0841] DMD-C6-F01 chrX:32816396-32816432
[0842] DMD-C7-R01 chrX:32809684-32809714
[0843] DMD-C8-F01 chrX:32699060-32699097
[0844] DMD-C9-F01 chrX:32697808-32697840
[0845] DMD-C11-R01 chrX:32644349-32644382
[0846] DMD-C12-R01 chrX:32614475-32614510
[0847] DMD-C13-R01 chrX:32595949-32595980
[0848] DMD-C14-R01 chrX:32573866-32573896
[0849] DMD-C15-R01 chrX:32573695-32573725
[0850] DMD-C16-F01 chrX:32565631-32565665
[0851] DMD-C18-F01 chrX:32517948-32517978
[0852] DMD-C20-F01 chrX:32491208-32491240
[0853] DMD-C21-F01 chrX:32484870-32484900
[0854] DMD-C22-F01 chrX:32472115-32472145
[0855] DMD-C23-F21 chrX:32468616-32468642
[0856] DMD-C24-R01 chrX:32464759-32464789
[0857] DMD-C25-R01 chrX:32463614-32463644
[0858] DMD-C26-F03 chrX:32454583-32454618
[0859] DMD-C27-F01 chrX:32448388-32448418
[0860] DMD-C28-F01 chrX:32441084-32441118
[0861] DMD-C29-F01 chrX:32438177-32438212
[0862] DMD-C30-R01 chrX:32411944-32411979
[0863] DMD-C31-F01 chrX:32390022-32390052
[0864] DMD-C32-F01 chrX:32389452-32389482
[0865] DMD-C33-F01 chrX:32386244-32386276
[0866] DMD-C34-F01 chrX:32380461-32380495
[0867] DMD-C35-F01 chrX:32364971-32365001
[0868] DMD-C37-R01 chrX:32363008-32363038
[0869] DMD-C38-F01 chrX:32348350-32348385
[0870] DMD-C39-R01 chrX:32346100-32346136
[0871] DMD-C41-R01 chrX:32342313-32342343
[0872] DMD-C42-R01 chrX:32310296-32310331
[0873] DMD-C42-F01 chrX:32309989-32310021
[0874] DMD-C43-F01 chrX:32287471-32287501
[0875] DMD-C44-F01 chrX:32216813-32216843
[0876] DMD-C45-R01 chrX:31968534-31968564
[0877] DMD-C46-R02 chrX:31932292-31932322
[0878] DMD-C47-R01 chrX:31929765-31929798
[0879] DMD-C48-F01 chrX:31875109-31875142
[0880] DMD-C49-F01 chrX:31836633-31836663
[0881] DMD-C50-F01 chrX:31819894-31819924
[0882] DMD-C51-R01 chrX:31774230-31774265
[0883] DMD-C51-F01 chrX:31773900-31773935
[0884] DMD-C52-R01 chrX:31729768-31729799
[0885] DMD-C53-R01 chrX:31679619-31679654
[0886] DMD-C55-R01 chrX:31627882-31627915
[0887] DMD-C56-R01 chrX:31507496-31507526
[0888] DMD-C57-F01 chrX:31496739-31496769
[0889] DMD-C58-R01 chrX:31479123-31479153
[0890] DMD-C59-R01 chrX:31478394-31478430
[0891] DMD-C59-F02 chrX:31478063-31478085
[0892] DMD-C60-R01 chrX:31444688-31444718
[0893] DMD-C61-F01 chrX:31348421-31348456
[0894] DMD-C62-F01 chrX:31323489-31323519
[0895] DMD-C64-R01 chrX:31223152-31223182
[0896] DMD-C65-R01 chrX:31209757-31209788
[0897] DMD-C65-F01 chrX:31209438-31209468
[0898] DMD-C66-R01 chrX:31206773-31206804
[0899] DMD-C67-R01 chrX:31204165-31204190
[0900] DMD-C68-R01 chrX:31182927-31182957
[0901] DMD-C69-R01 chrX:31180501-31180532
[0902] DMD-C70-F01 chrX:31178570-31178600
[0903] DMD-C71-R01 chrX:31178007-31178037
[0904] DMD-C72-R01 chrX:31173638-31173668
[0905] DMD-C73-F01 chrX:31172286-31172316
[0906] DMD-C74-R01 chrX:31169621-31169651
[0907] DMD-C75-F04 chrX:31147367-31147392
[0908] DMD-C75-F01 chrX:31147211-31147246
[0909] DMD-C76-F01 chrX:31146202-31146232
[0910] DMD-C77-R01 chrX:31134247-31134279
[0911] DMD-C78-R01 chrX:31126772-31126802
[0912] DMD-C79-R01 chrX:31121957-31121991
[0913] DMD-D01-F01 chrX:33339179-33339209
[0914] DMD-D03-F01 chrX:32412121-32412151
[0915] DMD-D04-F01 chrX:32411882-32411912
[0916] DMD-D05-F01 chrX:32342798-32342828
[0917] DMD-D07-R01 chrX:32127503-32127533
[0918] DMD-D08-F01 chrX:31862714-31862744
[0919] DMD-D09-F01 chrX:31508097-31508127
[0920] DMD-D12-F01 chrX:31240147-31240177
[0921] DMD-D15-F01 chrX:31127120-31127150
[0922] DMD-H01-R01 chrX:31261321-31261351
[0923] DMD-C1-R01 chrX:33211452-33211482
[0924] DMD-C2-R01 chrX:33020330-33020360
[0925] DMD-C3-F01 chrX:32849601-32849640
[0926] DMD-C4-R01 chrX:32844884-32844914
[0927] DMD-C5-R01 chrX:32823407-32823438
[0928] DMD-C6-R01 chrX:32816660-32816690
[0929] DMD-C7-F01 chrX:32809411-32809450
[0930] DMD-C8-R01 chrX:32699296-32699334
[0931] DMD-C9-R01 chrX:32698018-32698048
[0932] DMD-C10-F01 chrX:32644902-32644937
[0933] DMD-C11-F02 chrX:32644015-32644040
[0934] DMD-C12-F01 chrX:32614247-32614283
[0935] DMD-C13-F01 chrX:32595585-32595616
[0936] DMD-C14-F01 chrX:32573601-32573635
[0937] DMD-C15-F01 chrX:32573389-32573426
[0938] DMD-C16-R01 chrX:32565894-32565924
[0939] DMD-C17-R01 chrX:32545379-32545407
[0940] DMD-C18-R01 chrX:32518228-32518258
[0941] DMD-C19-R01 chrX:32501936-32501972
[0942] DMD-C21-R01 chrX:32485136-32485169
[0943] DMD-C22-R01 chrX:32472353-32472383
[0944] DMD-C24-F01 chrX:32464502-32464532
[0945] DMD-C25-F01 chrX:32463390-32463420
[0946] DMD-C26-R01 chrX:32454959-32454995
[0947] DMD-C27-R01 chrX:32448650-32448688
[0948] DMD-C28-R01 chrX:32441350-32441383
[0949] DMD-C29-R01 chrX:32438427-32438463
[0950] DMD-C30-F01 chrX:32411715-32411748
[0951] DMD-C31-R01 chrX:32390279-32390313
[0952] DMD-C32-R01 chrX:32389694-32389724
[0953] DMD-C33-R01 chrX:32386525-32386560
[0954] DMD-C34-R01 chrX:32380841-32380875
[0955] DMD-C35-R01 chrX:32365234-32365270
[0956] DMD-C36-F01 chrX:32364528-32364563
[0957] DMD-C37-F01 chrX:32362739-32362769
[0958] DMD-C38-R01 chrX:32348579-32348615
[0959] DMD-C39-F01 chrX:32345761-32345792
[0960] DMD-C40-R01 chrX:32343342-32343374
[0961] DMD-C41-F01 chrX:32342046-32342081
[0962] DMD-C43-F21 chrX:32287577-32287605
[0963] DMD-C44-R01 chrX:32217065-32217100
[0964] DMD-C45-F02 chrX:31968259-31968301
[0965] DMD-C46-F01 chrX:31931981-31932012
[0966] DMD-C47-F01 chrX:31929547-31929577
[0967] DMD-C48-R01 chrX:31875395-31875428
[0968] DMD-C49-R01 chrX:31836891-31836921
[0969] DMD-C50-R01 chrX:31820126-31820163
[0970] DMD-C52-F01 chrX:31729578-31729608
[0971] DMD-C53-F01 chrX:31679235-31679269
[0972] DMD-C54-F01 chrX:31657939-31657971
[0973] DMD-C55-F01 chrX:31627621-31627654
[0974] DMD-C56-F01 chrX:31507226-31507257
[0975] DMD-C57-R01 chrX:31496978-31497015
[0976] DMD-C58-F02 chrX:31478926-31478956
[0977] DMD-C60-F01 chrX:31444377-31444414
[0978] DMD-C61-R01 chrX:31348727-31348758
[0979] DMD-C62-R01 chrX:31323691-31323721
[0980] DMD-C63-F01 chrX:31260790-31260826
[0981] DMD-C64-F01 chrX:31222937-31222967
[0982] DMD-C66-F01 chrX:31206525-31206563
[0983] DMD-C68-F01 chrX:31182659-31182693
[0984] DMD-C69-F01 chrX:31180321-31180351
[0985] DMD-C70-R01 chrX:31178851-31178881
[0986] DMD-C71-F01 chrX:31177730-31177763
[0987] DMD-C72-F01 chrX:31173400-31173434
[0988] DMD-C73-R01 chrX:31172541-31172571
[0989] DMD-C74-F01 chrX:31169378-31169414
[0990] DMD-C76-R01 chrX:31146474-31146511
[0991] DMD-C77-F01 chrX:31134006-31134036
[0992] DMD-C78-F01 chrX:31126586-31126616
[0993] DMD-C79-F01 chrX:31121864-31121894
[0994] DMD-D10-F01 chrX:31266715-31266740
[0995] DMD-Y01-F01 chrX:31147495-31147525
[0996] DMD-Y02-F01 chrX:31201002-31201032
[0997] DMD-Y03-R01 chrX:31206760-31206790
[0998] DMD-Y04-F01 chrX:31206986-31207016
[0999] DMD-Y05-F01 chrX:31208222-31208252
[1000] DMD-Y06-F01 chrX:31210874-31210904
[1001] DMD-Y07-F01 chrX:31222878-31222908
[1002] DMD-Y08-F01 chrX:31261621-31261651
[1003] DMD-Y10-F01 chrX:31364110-31364140
[1004] DMD-Y12-F01 chrX:31609474-31609504
[1005] DMD-Y13-R01 chrX:31879621-31879652
[1006] DMD-Y14-F01 chrX:31964982-31965012
[1007] DMD-Y16-F01 chrX:32348703-32348733
[1008] DMD-Y17-F01 chrX:32380615-32380645
[1009] DMD-Y18-F01 chrX:32442111-32442147
[1010] DMD-Y19-F01 chrX:32452553-32452583
[1011] DMD-Y20-F01 chrX:32461119-32461149
[1012] DMD-Y21-F01 chrX:32461357-32461387
[1013] DMD-Y22-R01 chrX:32626485-32626515
[1014] DMD-Y24-F01 chrX:32697971-32698001
[1015] DMD-Y25-F01 chrX:32738670-32738700
[1016] DMD-Y26-F01 chrX:32809585-32809615
[1017] DMD-Y27-F01 chrX:32823764-32823794
[1018] DMD-Y28-F01 chrX:33014507-33014537
[1019] DMD-Y29-F01 chrX:33174294-33174324
[1020] DMD-H01-F01 chrX:31261123-31261153
[1021] DMD-C67-F02 chrX:31203869-31203897
[1022] G6PD-C02-R102 chrX:154532271-154532293
[1023] HBA2-H03-R01 chr16:173748-173778
[1024] HBB-H02-F01 chr11:5225321-5225351
[1025] HBB-H03-F01 chr11:5225526-5225556
[1026] HBB-H04-F01 chr11:5225756-5225786
[1027] HBB-H08-R01 chr11:5227237-5227267
[1028] HBB-H09-F01 chr11:5227179-5227209
[1029] HBA1-Dth-F102 chr16:173563-173585
[1030] HBA2-C02-F202 chr16:173287-173306
[1031] HBB-C02-F101 chr11:5226494-5226530
[1032] HBA1-C01-R102 chr16:176828-176846
[1033] HBB-H06-F01 chr11:5227038-5227067
[1034] HBB-H05-R01 chr11:5226298-5226336
[1035] HBA-SEA-F001 chr16:165242-165262
[1036] HBB-H10-R01 chr11:5226975-5226997
[1037] HBA-163.3-R001 chr16:185359-185384
[1038] HBA-44.6-F001 chr16:144182-144207
[1039] HBA-61.9-R001 chr16:208085-208110
[1040] HBA-27.6-F001 chr16:148131-148158
[1041] HBA-THAI-F001 chr16:149636-149663
[1042] HBA-Qinz-F001 chr16:153404-153428
[1043] THAL-W-001 chr16:166965-166992
[1044] THAL-W-002 chr16:167833-167857
[1045] THAL-W-003 chr16:168393-168424
[1046] THAL-Z-003 chr16:165772-165741
[1047] HBAP1-E02-F001 chr16:168895-168920
[1048] THAL-X-001 chr16:170995-171023
[1049] THAL-X-003 chr16:171159-171187
[1050] THAL-X-004 chr16:171017-171054
[1051] THAL-X-006 chr16:171919-171947
[1052] THAL-30.8-F001 chr16:171162-171191
[1053] THAL-Y-001 chr16:175133-175156
[1054] THAL-Y-004 chr16:175659-175682
[1055] THAL-Y-005 chr16:175266-175292
[1056] THAL-Y-006 chr16:175769-175795
[1057] THAL-Y-007 chr16:175727-175753
[1058] THAL-Z-001 chr16:180341-180319
[1059] THAL-Z-002 chr16:178063-178086
[1060] THAL-Z-004 chr16:180647-180672
[1061] THAL-Z-005 chr16:181275-181298
[1062] THAL-Z-006 chr16:181747-181773
[1063] HBQ1-C03-R001 chr16:181166-181142
[1064] HBZP1-E02-R001 chr16:163217-163239
[1065] HBM-C02-F001 chr16:166246-166266
[1066] SMN1-C01-R101 chr5:70925293-70925323
[1067] SMN1-C02-F101 chr5:70938739-70938771
[1068] SMN1-C03-F101 chr5:70941337-70941367
[1069] SMN1-C04-F101 chr5:70942290-70942320
[1070] SMN1-C05-F101 chr5:70942638-70942668
[1071] SMN2-C08-F202 chr5:70076416-70076456
[1072] SMN1-D03-F101 chr5:70952391-70952421
[1073] SMN1-Dth-F101 chr5:70952409-70952439
[1074] SMN2-D03-R101 chr5:70071404-70071434
[1075] SMN2-H01-F01 chr5:70924974-70925004
[1076] SMN2-H03-F01 chr5:70941375-70941405
[1077] SMN2-H06-F01 chr5:70944466-70944496
[1078] SMN1-D04-F101 chr5:70965837-70965861
[1079] SMN1-C08-R101 chr5:70952004-70952041
[1080] TREC-B01-R03 chr14:22386852-22386830
[1081] KREC-B02-F02 chr2:88859568-88859601, where the information preceding the chromosome location is the gene name and a code given for ease of recording.
[1082] In some embodiments of the present invention, the primer pool further includes primers for detecting internal reference genes. The internal reference genes of the present invention are as follows: RPP30, GAPDH, RPL19, RPS27A, RPS18, ACTB, PGK1, NONO, USP11, and SRY.
[1083] In some embodiments of the present invention, the nucleotide sequence of the primers used to detect the internal reference gene is identical or complementary to the sequences at corresponding sites on the following chromosomes:
[1084] RPP-IC-R02 chr10:90896390-90896422
[1085] RPP-IC-R03 chr10:90876536-90876566
[1086] GAPDH-exon-2 chr12:6536344-6536375
[1087] RPL19-exon-2 chr17:39201078-39201113
[1088] RPL19-exon-4 chr17:39202870-39202905
[1089] RPL19-exon-5 chr17:39203947-39203982
[1090] RPS27A-exon-1 chr2:55232985-55233020
[1091] RPS27A-exon-2 chr2:55233314-55233349
[1092] RPS27A-exon-3 chr2:55234011-55234046
[1093] RPS18-exon-2 chr6:33272520-33272555
[1094] RPS18-exon-5 chr6:33276040-33276075
[1095] ACTB-exon-2 chr7:5527989-5528018
[1096] ACTB-exon-4 chr7:5529036-5529070
[1097] PGK1-exon-2 chrX:78109800-78109835
[1098] PGK1-exon-5 chrX:78117219-78117254
[1099] PGK1-exon-8 chrX:78123145-78123180
[1100] NONO-exon-3 chrX:71294179-71294214
[1101] USP11-exon-5 chrX:47240254-47240289
[1102] USP11-exon-10 chrX:47242121-47242148
[1103] SRY-C01-R101 chrY:2787197-2787227
[1104] SRY-C01-F201 chrY:2787342-2787372
[1105] SRY-C01-F301 chrY:2787108-2787138
[1106] SRY-C01-R401 chrY:2787419-2787449, where the information preceding the chromosome location is the gene name and a code given for ease of recording.
[1107] In some embodiments of the present invention, the molar concentration of each primer in the primer pool is the same, or the concentration of a small number of primers with low amplification efficiency is higher, for example, twice the concentration of other primers.
[1108] In some embodiments of the present invention, the concentration of each primer in the primer pool is not specifically limited, for example, it can be from 25nM to 500nM, specifically for example, 50nM, as long as each primer can be diluted to a final working concentration of 2nM to 100nM, for example, 4nM.
[1109] In some embodiments of the present invention, the first universal sequence includes a sequence fragment that binds to a sequencing primer. The sequence fragment that binds to the sequencing primer is the same as or complementary to the sequencing primer.
[1110] In this invention, sequencing primers refer to the fixed sequences in the sequencing instrument.
[1111] In this invention, a adapter element that simultaneously comprises three parts: a fragment that binds to an oligonucleotide chain on the flow cell of a sequencing chip, a first index sequence, and a sequence fragment that binds to a sequencing primer is called a full-length adapter element.
[1112] A adapter element that consists only of a sequence fragment that binds to the sequencing primer is called a non-full-length adapter element.
[1113] The molecular tag (Unique Molecular Indentifier, UMI) is a randomized or specific short nucleotide sequence, typically designed as a completely random nucleotide chain (e.g., NNNNNN) or a partially degenerate nucleotide chain (e.g., NNNRNYN) with random bases.
[1114] In some embodiments of the present invention, the length of the molecular tag can be any length from 5 to 15 bp, for example, 5 to 7 bp, 7 to 9 bp, 9 to 11 bp, 11 to 13 bp, or 13 to 15 bp.
[1115] In this invention, since the adhesive end of the connector element T has a second universal sequence of about 10 bp for forming a double strand to meet the requirements of the linkage reaction, the molecular tag of this invention can exist in the connector element in single-strand form. When preparing the connector element, the molecular tag does not need to have a matching antisense chain to form a double strand.
[1116] The second universal sequence (US2) is used to form the adapter element into a double strand during annealing. In one embodiment, the second universal sequence is a sequence that is neither identical nor complementary in the human genome.
[1117] In some embodiments of the present invention, the 3' end of the second universal sequence (US2) is a base T.
[1118] In some embodiments of the present invention, the sequence length of the second universal sequence (US2) can be any length from 8 to 20 bp. For example, 8 to 10 bp, 10 to 12 bp, 12 to 14 bp, 14 to 16 bp, 16 to 18 bp, or 18 to 20 bp.
[1119] In some embodiments of the present invention, the complementary sequence of the second universal sequence is reverse complementary to the second universal sequence. The complementary sequence of the second universal sequence has a phosphorylation modification group at the 5' end and a phosphorylation modification group, an amino modification group, or a dideoxynucleotide modification group at the 3' end.
[1120] The first and second nucleotide chains anneal to form a DNA double helix. In some embodiments of the invention, the 3' end of the adapter element after annealing is a sticky end with a T base protrusion. This sticky end is used for TA ligation.
[1121] An example nucleotide sequence of the linker element described in this invention is as follows:
[1122] In this diagram, a single underscore indicates the first universal sequence (US1) (italicized text indicates the fragment that binds to the sequencing primer), a double underscore indicates the molecular tag (UMI), and a wavy underscore indicates the second universal sequence (US2).
[1123] Example of the complementary sequence US2-R of the second universal sequence:
[1124] 5'Phosphorylation-GGTGCACTAA-Phosphorylation3'(SEQ ID NO.2)
[1125] In some embodiments of the present invention, the kit further includes universal primers (UC) that work in conjunction with specific primers in the primer pool to specifically amplify the target region.
[1126] There are multiple universal primers.
[1127] In some embodiments of the present invention, the universal primers include a first universal primer (UC1) and a second universal primer (UC2).
[1128] An example of the sequence of the first universal primer is as follows:
[1129] In some embodiments of the present invention, the second universal primer includes a fragment that binds to an oligonucleotide chain on the flow cell of a sequencing chip, a second index sequence (Index2), and a sequence fragment that binds to the sequencing primer.
[1130] In some embodiments of the present invention, the 3' end of the second universal primer sequence is identical to the third universal sequence.
[1131] In some embodiments of the present invention, the universal primer further includes a third universal primer (UC3).
[1132] In some embodiments of the present invention, the third universal primer includes a fragment that binds to an oligonucleotide chain on the flow cell of a sequencing chip, a first index sequence (Index1), and a sequence fragment that binds to the sequencing primer.
[1133] The first index sequence can be designed using methods commonly used in existing technologies. The function of the first index sequence is to reconstruct and classify each sequencing data (read) as belonging to a certain sample.
[1134] In some embodiments of the present invention, the 3' end of the third universal primer is wholly or partially identical to or complementary to the first universal sequence.
[1135] An example of the second universal primer UC2 sequence is shown below:
[1136] In this diagram, a single underline indicates a fragment that binds to an oligonucleotide chain on the flow cell of the sequencing chip, bold indicates the second index sequence Index2, and wavy underline indicates the third universal sequence (US3).
[1137] An example of the third universal primer UC3 sequence is shown below:
[1138] In this diagram, a single underline indicates a fragment that binds to an oligonucleotide chain on the flow cell of the sequencing chip, bold indicates the first index sequence Index1, and wavy underlines indicate sequences that are partially identical or complementary to the sequence fragments in the first universal sequence US1 that bind to the sequencing primers.
[1139] In some embodiments of the present invention, the PCR reagent includes PCR buffer, Mg 2+ dNTPs, DNA polymerase, or any one or more of the following in water:
[1140] The Mg 2+ The concentration is not specifically limited, as long as it can reduce Mg 2+ Dilute to the working concentration.
[1141] In some embodiments of the present invention, Mg 2+ The working concentration is 1.5–5 mM. For example, Mg 2+ The working concentrations are 1.5–2 mM, 2–2.5 mM, 2.5–3 mM, 3–3.5 mM, 3.5–4 mM, 4–4.5 mM, and 4.5–5 mM.
[1142] In some embodiments of the present invention, the Mg 2+ Provided by MgCl2. In some embodiments of the invention, the MgCl2 is contained in the PCR buffer.
[1143] The PCR reagents can be homemade or commercially available kits, such as 2x WHSeq PCR Mix (W.W. Hennessy, XW7001).
[1144] In some embodiments of the present invention, the kit also includes reagents commonly used for constructing sequencing libraries, which are commercially available. For example, the kit may include DNA fragmentation, end repair, dA tailing reagents, ligation reagents, magnetic bead purification and recovery reagents, anhydrous ethanol, and nuclease-free water.
[1145] The present invention also provides the use of the kit in constructing multiplex PCR targeted sequencing libraries for multi-gene joint detection of genetic diseases in newborns.
[1146] The present invention also provides a method for constructing a multiplex PCR targeted sequencing library for multi-gene joint detection of genetic diseases in newborns, the method comprising constructing the library using the aforementioned kit.
[1147] In some embodiments of the present invention, the construction steps of the multiplex PCR targeted sequencing library are as follows:
[1148] 1.1) The fragmented, end-repaired, phosphorylated, and 3'-add-A nucleic acid samples were ligated with adapter elements and purified to obtain a pretext library with adapter elements;
[1149] 1.2) Perform PCR amplification on the pretext library obtained in step 1.1 using the primer pool and the first universal primer pair to enrich the target region;
[1150] 1.3) Purify and recover the amplification product from step 1.2, mix it with the second universal primer and the third universal primer, and perform PCR amplification again to introduce adapter elements at both ends of the amplification product from step 1.2.
[1151] 1.4) The amplification product from step 1.3 is purified and recovered to obtain the multiplex PCR targeted sequencing library.
[1152] In step 1.1), fragmentation, end repair, and 3' A addition can be performed by purchasing a commercial kit and following its instructions.
[1153] In some embodiments of the present invention, based on the reaction system of step 1.2), the concentration of each specific primer in step 1.2) is 5–100 nM. For example, the concentration of each specific primer is 5–20 nM, 20–40 nM, 40–60 nM, 60–80 nM, or 80–100 nM.
[1154] In some embodiments of the present invention, the number of PCR amplification cycles in step 1.2) is 5 to 12. 5 to 12 cycles ensure the specificity of PCR amplification.
[1155] In step 1.2), during the first amplification cycle, the specific primer binds to the target region in the pre-library for extension. This extension process completes the 5' end single-stranded portion of the adapter element, forming double-stranded DNA and creating the binding site for the first universal primer. In the second and subsequent amplification cycles, both the specific primer and the first universal primer can perform bidirectional amplification, enriching the target region. Step 1.2) produces double-stranded DNA with the following structure: from the 5' end to the 3' end (with the same direction of reversal), the sequences are: first universal sequence (US1), molecular tag UMI, second universal sequence (US2), target region insertion sequence (TS), specific sequence (GS), and third universal sequence (US3).
[1156] The purification and recovery in steps 1.3) and 1.4) can be performed using commercially available kits and conventional techniques in the field, such as magnetic bead purification and recovery.
[1157] In some embodiments of the present invention, the number of PCR amplification cycles in step 1.3) is 15 to 30 cycles. Preferably, the number of PCR amplification cycles in step 1.3) is 20 to 25 cycles.
[1158] Step 1.1) Use a non-full-length connector element that does not contain the first index sequence;
[1159] In step 1.3), the primers used for amplification are the third universal primer and the second universal primer.
[1160] In some embodiments of the present invention, the multiplex PCR targeted sequencing library obtained in step 1.4) is a complete target region sequencing library, which can be sequenced after passing quality control.
[1161] The present invention also provides multiplex PCR targeted sequencing libraries obtained by the method.
[1162] This invention provides a method for combined detection of multiple genes in newborns with genetic diseases, the method comprising the following steps:
[1163] 1) Sequencing of the above multiplex PCR targeted sequencing libraries;
[1164] 2) Perform non-deletion mutation analysis on sequencing data or obtain the copy number of the target gene based on the sequencing data;
[1165] 3) Deletion mutation analysis: Reads from each primer in the test sample and control sample were counted. Then, based on UMI information, the sequencing reads were deduplicated to obtain the deduplicated data for each sample. The deduplicated data of each sample were aligned to the human reference genome (GRCh38). The results were then analyzed based on the number of reads in the sequencing data and the formula: The copy number of the corresponding gene is obtained by calculating and processing the results as follows: when the result is between 0.1 and 0.5, the copy number is considered to be 1; for other results, the copy number is obtained by rounding to the nearest integer. In the formula, P... S1 IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the sample; S1 P represents the number of reads obtained from primer sequencing of the sample to be tested, which is used to detect the internal reference gene; NC IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the control sample; NCThe number of reads obtained from primer sequencing used to detect the internal reference gene in the control samples is shown. The control samples are those without target genes or missing internal reference genes. The internal reference genes in the test samples are not missing, and the copy number of each sample is 2. It should be noted that, to ensure the accuracy and stability of the analysis, the internal reference genes used in this invention are as follows: RPP30, GAPDH, RPL19, RPS27A, RPS18, ACTB, PGK1, NONO, USP11, and SRY.
[1166] In some embodiments of the present invention, the primers used to detect the internal reference gene detect the following positions of the internal reference gene: GAPDH-exon-2, RPL19-exon-2, RPL19-exon-4, RPL19-exon-5, RPS27A-exon-1, RPS27A-exon-2, RPS27A-exon-3, RPS18-exon-2, RPS18-exon-5, ACTB-exon-2, ACTB-exon-4, PGK1-exon-2, PGK1-exon-5, PGK1-exon-8, NONO-exon-3, USP11-exon-5, USP11-exon-10.
[1167] The type of HBA gene deletion mutation was determined based on the obtained copy number and the table below:
[1168]
[1169] Analysis of deletion mutations in target genes other than HBA: If the copy number is 0, the target gene is homozygous deletion; if the copy number is 1, the target gene is heterozygous deletion; if the copy number is 2, the target gene has no deletion mutation.
[1170] In some embodiments of the present invention, the method for analyzing non-deletion mutations is existing technology. For example, after base calibration of the sequence, software is used to analyze SNP and Indel variations, and then software is used to annotate the detected variations. Specifically, after base calibration of the sequence, SNP and Indel variations are analyzed using GATK software (v4.1.0.0). Finally, Annovar software (2020-06-08 00:46:07 -0400) is used to annotate the detected variations.
[1171] This invention also provides a device for detecting polygenic mutations in newborns to detect genetic diseases, such as... Figure 5 As shown, the device includes:
[1172] 1) Sequencing data acquisition module: used to acquire sequencing data of the multiplex PCR targeted sequencing library, wherein the multiplex PCR targeted sequencing library is constructed using the multiplex PCR kit for multi-gene joint detection of neonatal genetic diseases;
[1173] 2) Copy number acquisition module: used to obtain the number of reads from the sequencing data and the formula: The calculation is performed, and the result is processed to obtain the copy number. The processing method is as follows: when the calculation result is between 0.1 and 0.5, the copy number is considered to be 1; for other calculation results, the copy number is obtained by rounding to the nearest integer. In the formula, P... S1 IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the sample; S1 P represents the number of reads obtained from primer sequencing of the sample to be tested, which is used to detect the internal reference gene; NC IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the control sample; NC The number of reads obtained from primer sequencing used to detect the internal reference gene in the control sample;
[1174] 3) Gene mutation type analysis module: used to obtain the target gene mutation type based on the copy number of the module.
[1175] In some embodiments of the present invention, the gene mutation type analysis module includes a deletion mutation analysis submodule, which is used to analyze the gene deletion mutation type of HBA based on the obtained copy number and the table below:
[1176]
[1177] In some embodiments of the present invention, the deletion mutation analysis submodule is also used to analyze other target gene deletion mutation types besides HBA according to the following method: if the copy number is 0, the target gene is homozygous deletion; if the copy number is 1, the target gene is heterozygous deletion; if the copy number is 2, the target gene has not undergone deletion mutation.
[1178] In some embodiments of the present invention, the gene mutation type analysis module further includes a non-deletion mutation analysis submodule, which is used to analyze SNP and Indel variations and annotate them after base calibration of the sequence.
[1179] The non-deletion mutation analysis submodule can be obtained by integrating existing software.
[1180] The device for detecting polygenic mutations in newborn genetic diseases is based on the same principle as the aforementioned method. In the above-mentioned method and device embodiments, the definitions, calculation methods, implementation methods, and preferred implementation methods of the same features can be used interchangeably and will not be repeated.
[1181] It should be noted that the division of the various modules in the above device is merely a logical functional division. In actual implementation, they can be fully or partially integrated into a single physical entity, or they can be physically separated. Furthermore, these modules can be implemented entirely in software via processing element calls; they can be fully implemented in hardware; or some modules can be implemented by processing element calls to software, while others are implemented in hardware. For example, the copy number acquisition module can be a separate processing element, or it can be integrated into a chip in the above device. Alternatively, it can be stored as program code in the memory of the above device, and its function can be called and executed by a processing element of the device. The implementation of other modules is similar. Moreover, these modules can be fully or partially integrated together, or they can be implemented independently. The processing element mentioned here can be an integrated circuit with signal processing capabilities. In the implementation process, each step of the above method or each of the above modules can be completed through integrated logic circuits in the hardware of the processor element or through software instructions.
[1182] For example, these modules can be one or more integrated circuits configured to implement the above methods, such as one or more Application Specific Integrated Circuits (ASICs), one or more digital signal processors (DSPs), or one or more Field Programmable Gate Arrays (FPGAs). As another example, when a module is implemented using processing element scheduler code, the processing element can be a general-purpose processor, such as a Central Processing Unit (CPU) or other processor capable of calling program code. Furthermore, these modules can be integrated together to form a system-on-a-chip (SOC).
[1183] The present invention also provides a computer-readable storage medium having a computer program stored thereon, which, when executed by a processor, implements the aforementioned detection method.
[1184] Those skilled in the art will understand that all or part of the steps of the above-described method embodiments can be implemented using computer program-related hardware. The aforementioned computer program can be stored in a computer-readable storage medium. When executed, the program performs the steps of the above-described method embodiments; and the aforementioned storage medium includes various media capable of storing program code, such as ROM, RAM, magnetic disks, or optical disks.
[1185] The present invention also provides a computer processing device, including a processor and the aforementioned computer-readable storage medium, wherein the processor executes a computer program on the computer-readable storage medium to implement the steps of the aforementioned detection method.
[1186] The present invention also provides an electronic terminal, the structural schematic diagram of which is shown below. Figure 6 As shown. The electronic terminal provided in this example includes: a processor 21, a memory 22, a communicator 23, a communication interface 24, and a system bus 25; the memory 22 and the communication interface 24 are connected to the processor 21 and the communicator 23 through the system bus 25 and complete mutual communication. The memory 22 is used to store computer programs, the communication interface 24 is used to communicate with other devices, and the processor 21 and the communicator 23 are used to run computer programs so that the terminal executes the detection method.
[1187] The system bus mentioned above can be a Peripheral Component Interconnect (PCI) bus or an Extended Industry Standard Architecture (EISA) bus, etc. This system bus can be divided into address bus, data bus, control bus, etc. For ease of representation, only one thick line is used in the diagram, but this does not indicate that there is only one bus or one type of bus. The communication interface is used to enable communication between the database access device and other devices (e.g., clients, read-write libraries, and read-only libraries). Memory may include Random Access Memory (RAM) and may also include non-volatile memory, such as at least one disk storage device.
[1188] The processors mentioned above can be general-purpose processors, including central processing units (CPUs), network processors (NPs), etc.; they can also be digital signal processors (DSPs), application-specific integrated circuits (ASICs), field-programmable gate arrays (FPGAs), or other programmable logic devices, discrete gate or transistor logic devices, or discrete hardware components.
[1189] The present invention also provides a computer program product, including a computer program that, when executed by a processor, implements the steps of the detection method.
[1190] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[1191] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.
[1192] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[1193] Example 1
[1194] This embodiment presents a method and kit for combined detection of multiple genes in newborns, and the specific steps are as follows:
[1195] 1. Primer design and primer pool preparation:
[1196] Specific primers were designed for 37 human genetic diseases with high incidence and significant clinical significance for screening. The gene list is as follows:
[1197] ACADM ACADVL ASS1 ATP7B CFTR CYP21A2 DMD ETFDH F8 F9 FBN1 G6PD GAA GALC GCDH GJB2 GJB3 GLA HBA1 HBA2 HBB HLCS IDUA MECP2 MMACHC MMUT NF1 PAH PTPN11 SLC22A5 SLC25A13 SLC26A4 SMN1 SMN2 SOS1 SRY UGT1A1
[1198] The specific primer design includes all exon regions of all target genes and some clearly pathogenic / potentially pathogenic intron regions. In addition, it includes specific regions used in thalassemia testing to calculate HBA1 and HBA2 deletion subtypes, specific regions of internal reference genes, and mitochondrial DNA hotspot mutation regions. The third universal sequence in the primers is: ACACGACGCTCTTCCGATCT (SEQ ID NO.7), and the nucleotide sequence of the specific sequence is completely identical or complementary to the sequences at the corresponding sites on the following chromosomes:
[1199] chr1:75724985-75725015 chr7:107697998-107698028
[1200] chr1:75728300-75728330 chr7:107699994-107700024
[1201] chr1:75732711-75732741 chr7:107701039-107701069
[1202] chr1:75734666-75734696 chr7:107702051-107702081
[1203] chr1:75745765-75745795 chr7:107704267-107704297
[1204] chr1:75750347-75750377 chr7:107710257-107710288
[1205] chr1:75762542-75762572 chr7:107712465-107712495
[1206] chr1:75726761-75726791 chr7:107715365-107715398
[1207] chr1:75731681-75731711 chr7:107660926-107660955
[1208] chr1:75732901-75732931 chr7:107715388-107715418
[1209] chr1:75750708-75750738 chr2:38962654-38962684
[1210] chr1:75768976-75769006 chr2:38985446-38985476
[1211] chr1:75724844-75724870 chr2:39034653-39034683
[1212] chr1:75762728-75762758 chr2:39034778-39034808
[1213] chr17:7217183-7217210 chr2:39124108-39124132
[1214] chr17:7220193-7220217 chr2:39124620-39124647
[1215] chr17:7219971-7219994 chr2:38986029-38986059
[1216] chr17:7220424-7220453 chr2:38986079-38986108
[1217] chr17:7220430-7220460 chr2:38985969-38985999
[1218] chr17:7220665-7220694 chr2:38987380-38987417
[1219] chr17:7220814-7220844 chr2:38994907-38994937
[1220] chr17:7221470-7221498 chr2:38995164-38995194
[1221] chr17:7221842-7221870 chr2:38995132-38995162
[1222] chr17:7222059-7222084 chr2:39006295-39006325
[1223] chr17:7222615-7222643 chr2:39012327-39012357
[1224] chr17:7223016-7223046 chr2:39012094-39012129
[1225] chr17:7223547-7223577 chr2:39013780-39013811
[1226] chr17:7223650-7223680 chr2:39022527-39022557
[1227] chr17:7223920-7223950 chr2:39023260-39023293
[1228] chr17:7224056-7224086 chr2:39022729-39022759
[1229] chr17:7224278-7224308 chr2:39023039-39023069
[1230] chr17:7224354-7224379 chr2:39023919-39023949
[1231] chr17:7224896-7224917 chr2:39035107-39035137
[1232] chr17:7224854-7224884 chr2:39035287-39035317
[1233] chr17:7220032-7220052 chr2:39051052-39051087
[1234] chr17:7225011-7225041 chr2:39054558-39054588
[1235] chr9:130452449-130452476 chr2:39054863-39054893
[1236] chr9:130454166-130454196 chr2:39058632-39058662
[1237] chr9:130458346-130458366 chr2:39067557-39067587
[1238] chr9:130463971-130464001 chr2:39120180-39120203
[1239] chr9:130466597-130466623 chr2:39120379-39120407
[1240] chr9:130470700-130470730 chr2:38995197-38995220
[1241] chr9:130471360-130471390 chr7:117540128-117540157
[1242] chr9:130476814-130476844 chr9:130458659-130458679
[1243] chr9:130479601-130479631 chr13:20192856-20192874
[1244] chr9:130480260-130480290 chr2:233760499-233760529
[1245] chr9:130494826-130494856 chr2:233760929-233760959
[1246] chr9:130499339-130499369 chr2:233760447-233760477
[1247] chr9:130500854-130500884 chr2:233760993-233761023
[1248] chr9:130444995-130445017 chr2:233760596-233760626
[1249] chr9:130500956-130500986 chr2:233766921-233766957
[1250] chr13:51934997-51935027 chr2:233767736-233767766
[1251] chr13:51934750-51934780 chr2:233768170-233768200
[1252] chr13:51935504-51935534 chr2:233768455-233768485
[1253] chr13:51937151-51937181 chr2:233772507-233772536
[1254] chr13:51937415-51937437 chr2:233772281-233772305
[1255] chr13:51937703-51937733 chr2:233769636-233769666
[1256] chr13:51939006-51939036 chr2:233760356-233760385
[1257] chr13:51941030-51941060 chr2:233772525-233772555
[1258] chr13:51942323-51942353 chr17:7222105-7222127
[1259] chr13:51944044-51944074 chr13:52011683-52011707
[1260] chr13:51946238-51946268 chr7:117479180-117479209
[1261] chr13:51949620-51949650 chr7:117479450-117479480
[1262] chr13:51949928-51949958 chr7:117479694-117479719
[1263] chr13:51950224-51950254 chr7:117479962-117479991
[1264] chr13:51957458-51957488 chr7:117498253-117498283
[1265] chr13:51958270-51958300 chr7:117504195-117504225
[1266] chr13:51958575-51958605 chr7:117559277-117559307
[1267] chr13:51960075-51960101 chr7:117589251-117589281
[1268] chr13:51961785-51961815 chr7:117602689-117602719
[1269] chr13:51965082-51965112 chr7:117609966-117609998
[1270] chr13:51968396-51968426 chr7:117611428-117611458
[1271] chr13:51970442-51970472 chr7:117626154-117626184
[1272] chr13:51973854-51973884 chr7:117627395-117627425
[1273] chr13:51974074-51974102 chr7:117627702-117627732
[1274] chr13:51974978-51975008 chr7:117639756-117639786
[1275] chr13:51974293-51974323 chr7:117642308-117642338
[1276] chr13:51974825-51974849 chr7:117664567-117664597
[1277] chr13:51974427-51974457 chr7:117665532-117665562
[1278] chr13:52011107-52011137 chr6:32040960-32040983
[1279] chr13:51947922-51947952 chr15:48428382-48428412
[1280] chr13:51972573-51972603 chr15:48465584-48465614
[1281] chr13:51972577-51972607 chrX:154534390-154534418
[1282] chr13:51995244-51995274 chr17:80104323-80104353
[1283] chr13:52011311-52011338 chr17:80108925-80108955
[1284] chr7:117480208-117480238 chr17:80117777-80117800
[1285] chr7:117504205-117504235 chr14:87993134-87993159
[1286] chr7:117508983-117509013 chr13:20189563-20189585
[1287] chr7:117531106-117531136 chr13:20192656-20192679
[1288] chr7:117531135-117531166 chr13:20192983-20193009
[1289] chr7:117535200-117535230 chrX:101399689-101399719
[1290] chr7:117536440-117536479 chrX:101401544-101401574
[1291] chr7:117540315-117540347 chrX:154030211-154030241
[1292] chr7:117540096-117540126 chrX:154097597-154097624
[1293] chr7:117542157-117542187 chr17:31094825-31094855
[1294] chr7:117559409-117559439 chr17:31181337-31181372
[1295] chr7:117559720-117559750 chr17:31183211-31183250
[1296] chr7:117587672-117587702 chr17:31200426-31200456
[1297] chr7:117592143-117592173 chr17:31202972-31203002
[1298] chr7:117592090-117592120 chr17:31215697-31215727
[1299] chr7:117592468-117592498 chr17:31227216-31227243
[1300] chr7:117594875-117594905 chr17:31229021-31229050
[1301] chr7:117602752-117602782 chr17:31327416-31327446
[1302] chr7:117603491-117603521 chr17:31337556-31337586
[1303] chr7:117603792-117603822 chr17:31358671-31358701
[1304] chr7:117606551-117606581 chr12:102843749-102843779
[1305] chr7:117610460-117610490 chr12:102855239-102855270
[1306] chr7:117611571-117611601 chr12:102865741-102865771
[1307] chr7:117614536-117614566 chr12:102890723-102890753
[1308] chr7:117627765-117627795 chr12:102912730-102912760
[1309] chr7:117627816-117627846 chr7:96204821-96204851
[1310] chr7:117642390-117642420 chr7:107660680-107660710
[1311] chr7:117652702-117652734 chr7:107683319-107683354
[1312] chr7:117664635-117664666 chr7:107694350-107694380
[1313] chr7:117667098-117667128 chr7:107715475-107715505
[1314] chr7:117666886-117666916 chr13:51944106-51944136
[1315] chr7:117505195-117505225 chr13:51964983-51965013
[1316] chr7:117625891-117625921 chr17:80108332-80108362
[1317] chr7:117642818-117642848 chr17:31231972-31232009
[1318] chr7:117666570-117666600 chr17:31330647-31330677
[1319] chr7:117715677-117715707 chr17:31334384-31334414
[1320] chr7:117480133-117480163 chr12:102843502-102843532
[1321] chr7:117667072-117667102 chr12:102894883-102894913
[1322] chr6:32038620-32038646 chr7:107661541-107661571
[1323] chr6:32038562-32038591 chr1:75761276-75761308
[1324] chr6:32039265-32039285 chr17:7224852-7224881
[1325] chr6:32039495-32039525 chr4:158682372-158682401
[1326] chr6:32039501-32039531 chr4:158706754-158706779
[1327] chr6:32039587-32039616 chr15:48427729-48427758
[1328] chr6:32039912-32039941 chr15:48468571-48468598
[1329] chr6:32040266-32040291 chr15:48534261-48534300
[1330] chr6:32040375-32040395 chr17:80112141-80112162
[1331] chr6:32040796-32040821 chr14:87963531-87963573
[1332] chr6:32041123-32041145 chr14:87965650-87965687
[1333] chr6:32040879-32040905 chr14:87988592-87988622
[1334] chr4:158672512-158672542 chr21:36759900-36759930
[1335] chr4:158684465-158684495 chr1:45507540-45507570
[1336] chr4:158684971-158685001 chr6:49456282-49456329
[1337] chr4:158690249-158690280 chr17:31226704-31226733
[1338] chr4:158697473-158697502 chr17:31336492-31336532
[1339] chr:158699214-158699172 chr7:96277391-96277431
[1340] chr4:158706144-158706174 chr2:39007204-39007252
[1341] chr4:158706618-158706648 chr6:32038153-32038177
[1342] chr4:158708537-158708567 chr17:31226482-31226507
[1343] chr4:158700765-158700795 chr13:51970507-51970539
[1344] chr4:158708200-158708230 chr4:158682222-158682250
[1345] chr4:158708498-158708528 chrX:154531909-154531930
[1346] chr15:48411229-48411259 chr14:87934674-87934703
[1347] chr15:48411109-48411139 chr4:1002738-1002758
[1348] chr15:48412510-48412536 chr6:49448698-49448736
[1349] chr15:48415489-48415519 chr17:31258259-31258291
[1350] chr15:48415797-48415827 chr17:31265444-31265475
[1351] chr15:48420630-48420660 chr7:107701869-107701898
[1352] chr15:48421447-48421477 chr2:38997468-38997500
[1353] chr15:48425276-48425305 chrX:154837775-154837802
[1354] chr15:48427783-48427813 chrX:154860385-154860420
[1355] chr15:48428272-48428302 chrX:154861670-154861701
[1356] chr15:48430612-48430642 chrX:154863019-154863049
[1357] chr15:48432825-48432855 chrX:154895998-154896027
[1358] chr15:48434546-48434576 chrX:154899778-154899806
[1359] chr15:48436863-48436893 chrX:154901327-154901355
[1360] chr15:48437280-48437310 chrX:154901971-154901998
[1361] chr15:48437698-48437728 chrX:154903847-154903894
[1362] chr15:48441668-48441698 chrX:154904232-154904261
[1363] chr15:48445335-48445365 chr17:31229354-31229378
[1364] chr15:48446658-48446688 chr17:7217684-7217710
[1365] chr15:48448952-48448988 chr21:36966530-36966549
[1366] chr15:48452512-48452542 chr1:11796395-11796421
[1367] chr15:48456562-48456592 chr1:11794469-11794499
[1368] chr15:48460201-48460231 chr5:7870916-7870943
[1369] chr15:48463009-48463039 chrY:2787632-2787662
[1370] chr15:48463844-48463874 chrX:154030542-154030563
[1371] chr15:48465526-48465556 chrX:154030802-154030831
[1372] chr15:48465737-48465767 chr17:7224539-7224568
[1373] chr15:48467880-48467910 chr4:1003113-1003135
[1374] chr15:48470532-48470561 chrX:154904316-154904346
[1375] chr15:48472496-48472526 chrX:154904754-154904787
[1376] chr15:48474201-48474231 chrX:154904806-154904836
[1377] chr15:48474487-48474517 chrX:154906328-154906365
[1378] chr15:48485330-48485360 chrX:154928497-154928526
[1379] chr15:48487226-48487256 chrX:154931740-154931769
[1380] chr15:48487270-48487300 chrX:154928670-154928699
[1381] chr15:48488315-48488345 chrX:154931508-154931536
[1382] chr15:48489801-48489831 chrX:154928893-154928921
[1383] chr15:48490088-48490118 chrX:154931350-154931380
[1384] chr15:48492355-48492385 chrX:154929075-154929108
[1385] chr15:48494125-48494155 chrX:154931132-154931160
[1386] chr15:48495074-48495104 chrX:154929246-154929273
[1387] chr15:48497203-48497233 chrX:154930942-154930969
[1388] chr15:48498935-48498965 chrX:154929480-154929508
[1389] chr15:48503711-48503741 chrX:154930778-154930804
[1390] chr15:48504973-48505003 chrX:154929629-154929657
[1391] chr15:48509999-48510029 chrX:154930555-154930584
[1392] chr15:48513504-48513534 chrX:154929850-154929879
[1393] chr15:48515342-48515372 chrX:154930370-154930399
[1394] chr15:48516373-48516403 chrX:154929979-154930009
[1395] chr15:48520569-48520599 chrX:154947654-154947683
[1396] chr15:48526080-48526110 chrX:154947734-154947762
[1397] chr15:48596230-48596260 chrX:154953794-154953827
[1398] chr15:48610595-48610625 chrX:154956917-154956942
[1399] chr15:48644545-48644575 chrX:154956968-154957002
[1400] chr15:48427962-48427992 chrX:154960948-154960970
[1401] chr15:48434131-48434161 chrX:154965910-154965946
[1402] chr15:48645497-48645518 chrX:154966343-154966377
[1403] chr15:48644704-48644731 chrX:154966498-154966525
[1404] chrX:154518398-154518424 chrX:154969235-154969268
[1405] chrX:154518185-154518215 chrX:154969400-154969429
[1406] chrX:154533298-154533328 chrX:154984614-154984643
[1407] chrX:154546696-154546726 chrX:154987119-154987148
[1408] chrX:154532044-154532072 chrX:154992796-154992825
[1409] chrX:154532219-154532244 chrX:154992976-154993006
[1410] chrX:154532492-154532515 chrX:154996899-154996927
[1411] chrX:154532858-154532884 chrX:154999402-154999432
[1412] chrX:154532910-154532930 chrX:155022346-155022371
[1413] chrX:154533506-154533530 chrX:154885990-154886014
[1414] chrX:154533817-154533847 chrX:155026616-155026646
[1415] chrX:154533940-154533970 chrX:155022462-155022490
[1416] chrX:154534279-154534304 chrX:154837625-154837650
[1417] chrX:154535093-154535119 chrX:154863052-154863082
[1418] chrX:154535396-154535425 chrX:154902053-154902081
[1419] chrX:154535825-154535848 chrX:154902381-154902410
[1420] chrX:154535934-154535962 chrX:154902741-154902770
[1421] chrX:154545987-154546016 chrX:154904558-154904588
[1422] chr17:80104808-80104830 chrX:154957124-154957154
[1423] chr17:80104868-80104893 chrX:154997049-154997078
[1424] chr17:80104726-80104752 chrX:154999565-154999594
[1425] chr17:80105683-80105709 chrX:155020702-155020728
[1426] chr17:80107488-80107512 chrX:155022615-155022645
[1427] chr17:80107647-80107671 chr17:31095414-31095442
[1428] chr17:80108232-80108260 chrX:154532171-154532201
[1429] chr17:80108388-80108414 chr4:158698984-158699020
[1430] chr17:80108596-80108619 chr4:158699105-158699139
[1431] chr17:80109858-80109887 chr2:38997380-38997413
[1432] chr17:80110591-80110618 chr2:39010662-39010693
[1433] chr17:80110899-80110926 chr6:49453608-49453641
[1434] chr17:80112468-80112493 chr7:107674221-107674249
[1435] chr17:80112790-80112814 chr7:107683368-107683406
[1436] chr17:80113128-80113152 chr7:107683153-107683188
[1437] chr17:80116922-80116948 chr15:48496246-48496274
[1438] chr17:80117520-80117546 chr17:31327676-31327703
[1439] chr17:80118107-80118130 chr17:31330407-31330441
[1440] chr17:80118878-80118901 chr17:80105180-80105199
[1441] chr17:80119238-80119260 chrX:139530941-139530976
[1442] chr17:80112868-80112897 chrX:139536943-139536978
[1443] chr17:80101924-80101951 chrX:139537193-139537228
[1444] chr17:80104642-80104663 chrX:139541030-139541065
[1445] chr17:80119260-80119290 chrX:139548290-139548325
[1446] chr14:87981557-87981592 chrX:139550929-139550964
[1447] chr14:87986974-87987004 chrX:139551117-139551152
[1448] chr14:87992253-87992283 chrX:139560647-139560682
[1449] chr14:87992283-87992313 chrX:139561723-139561751
[1450] chr14:87993312-87993342 chrX:139561873-139561901
[1451] chr14:87939864-87939894 chrX:139561694-139561721
[1452] chr14:87941315-87941345 chrX:139530820-139530855
[1453] chr14:87945512-87945542 chrX:139561985-139562020
[1454] chr14:87947650-87947680 chrX:139530590-139530625
[1455] chr14:87950577-87950607 chrX:139540859-139540894
[1456] chr14:87982047-87982077 chrX:139563042-139563077
[1457] chr14:87984287-87984317 chrX:101398116-101398147
[1458] chr14:87986447-87986477 chrX:154532117-154532140
[1459] chr14:87988103-87988133 chrX:154532247-154532271
[1460] chr14:87993174-87993193 chr17:31095320-31095341
[1461] chr14:87993139-87993165 chr13:20192821-20192841
[1462] chr19:12891495-12891525 chrX:154097672-154097698
[1463] chr19:12891430-12891457 chr4:1000576-1000598
[1464] chr19:12891774-12891799 chr4:1001030-1001056
[1465] chr19:12892083-12892105 chr4:1002333-1002358
[1466] chr19:12893441-12893470 chr4:1002854-1002876
[1467] chr19:12895930-12895960 chr4:1003113-1003136
[1468] chr19:12896168-12896193 chr4:1004221-1004243
[1469] chr19:12896434-12896459 chr12:112419176-112419198
[1470] chr19:12896829-12896858 chr21:36966612-36966638
[1471] chr19:12897269-12897292 chr21:36966445-36966467
[1472] chr19:12897662-12897689 chr2:233756961-233756990
[1473] chr19:12899423-12899453 chr2:233757040-233757066
[1474] chr19:12898007-12898037 chrX:33211219-33211251
[1475] chr19:12899853-12899879 chrX:33019950-33019980
[1476] chr19:12913857-12913887 chrX:32849922-32849952
[1477] chr19:12891356-12891378 chrX:32844618-32844648
[1478] chr19:12899442-12899473 chrX:32823171-32823201
[1479] chr13:20189092-20189122 chrX:32816396-32816432
[1480] chr13:20189360-20189390 chrX:32809684-32809714
[1481] chr13:20189332-20189356 chrX:32699060-32699097
[1482] chr13:20189113-20189143 chrX:32697808-32697840
[1483] chr1:34784952-34784982 chrX:32644349-32644382
[1484] chr1:34785355-34785385 chrX:32614475-32614510
[1485] chr1:34785152-34785182 chrX:32595949-32595980
[1486] chr1:34785408-34785431 chrX:32573866-32573896
[1487] chr1:34785079-34785101 chrX:32573695-32573725
[1488] chr1:34781778-34781798 chrX:32565631-32565665
[1489] chr1:34785515-34785542 chrX:32517948-32517978
[1490] chrX:101398056-101398085 chrX:32491208-32491240
[1491] chrX:101398515-101398545 chrX:32484870-32484900
[1492] chrX:101398729-101398759 chrX:32472115-32472145
[1493] chrX:101400540-101400570 chrX:32468616-32468642
[1494] chrX:101401591-101401621 chrX:32464759-32464789
[1495] chrX:101403759-101403789 chrX:32463614-32463644
[1496] chrX:101407917-101407944 chrX:32454583-32454618
[1497] chrX:101399823-101399853 chrX:32448388-32448418
[1498] chrX:101401155-101401185 chrX:32441084-32441118
[1499] chrX:101407874-101407904 chrX:32438177-32438212
[1500] chr16:176910-176934 chrX:32411944-32411979
[1501] chr16:176861-176883 chrX:32390022-32390052
[1502] chr16:177153-177175 chrX:32389452-32389482
[1503] chr16:177182-177204 chrX:32386244-32386276
[1504] chr16:176722-176746 chrX:32380461-32380495
[1505] chr16:173194-173218 chrX:32364971-32365001
[1506] chr16:173440-173461 chrX:32363008-32363038
[1507] chr11:5225741-5225771 chrX:32348350-32348385
[1508] chr11:5226793-5226823 chrX:32346100-32346136
[1509] chr11:5226812-5226842 chrX:32342313-32342343
[1510] chr11:5226879-5226909 chrX:32310296-32310331
[1511] chr21:36754443-36754473 chrX:32309989-32310021
[1512] chr21:36756738-36756768 chrX:32287471-32287501
[1513] chr21:36756765-36756792 chrX:32216813-32216843
[1514] chr21:36764948-36764978 chrX:31968534-31968564
[1515] chr21:36767035-36767063 chrX:31932292-31932322
[1516] chr21:36896798-36896828 chrX:31929765-31929798
[1517] chr21:36897141-36897171 chrX:31875109-31875142
[1518] chr21:36930195-36930219 chrX:31836633-31836663
[1519] chr21:36936401-36936431 chrX:31819894-31819924
[1520] chr21:36937432-36937467 chrX:31774230-31774265
[1521] chr21:36936612-36936638 chrX:31773900-31773935
[1522] chr21:36937212-36937242 chrX:31729768-31729799
[1523] chr21:36936747-36936777 chrX:31679619-31679654
[1524] chr21:36939030-36939067 chrX:31627882-31627915
[1525] chr21:36961971-36962001 chrX:31507496-31507526
[1526] chr21:36756994-36757024 chrX:31496739-31496769
[1527] chr21:36892450-36892480 chrX:31479123-31479153
[1528] chr21:36900570-36900597 chrX:31478394-31478430
[1529] chr21:36962825-36962855 chrX:31478063-31478085
[1530] chr4:1000770-1000797 chrX:31444688-31444718
[1531] chr4:1001351-1001380 chrX:31348421-31348456
[1532] chr4:1001643-1001667 chrX:31323489-31323519
[1533] chr4:1001907-1001927 chrX:31223152-31223182
[1534] chr4:1001943-1001962 chrX:31209757-31209788
[1535] chr4:1002265-1002286 chrX:31209438-31209468
[1536] chr4:1003512-1003532 chrX:31206773-31206804
[1537] chr4:1003042-1003067 chrX:31204165-31204190
[1538] chr4:1003472-1003494 chrX:31182927-31182957
[1539] chr4:1003958-1003985 chrX:31180501-31180532
[1540] chr4:987308-987333 chrX:31178570-31178600
[1541] chr4:987725-987750 chrX:31178007-31178037
[1542] chr4:991950-991974 chrX:31173638-31173668
[1543] chr4:992072-992099 chrX:31172286-31172316
[1544] chr4:1004323-1004347 chrX:31169621-31169651
[1545] chrX:154030566-154030594 chrX:31147367-31147392
[1546] chrX:154031176-154031205 chrX:31147211-31147246
[1547] chrX:154031292-154031322 chrX:31146202-31146232
[1548] chrX:154030716-154030739 chrX:31134247-31134279
[1549] chrX:154031077-154031101 chrX:31126772-31126802
[1550] chrX:154032450-154032480 chrX:31121957-31121991
[1551] chrX:154032576-154032606 chrX:33339179-33339209
[1552] chrX:154092125-154092155 chrX:32412121-32412151
[1553] chrX:154058030-154058060 chrX:32411882-32411912
[1554] chrX:154058336-154058366 chrX:32342798-32342828
[1555] chrX:154073164-154073194 chrX:32127503-32127533
[1556] chrX:154092179-154092209 chrX:31862714-31862744
[1557] chr1:45500423-45500453 chrX:31508097-31508127
[1558] chr1:45508115-45508145 chrX:31240147-31240177
[1559] chr1:45509003-45509033 chrX:31127120-31127150
[1560] chr1:45508952-45508981 chrX:31261321-31261351
[1561] chr1:45508914-45508944 chrX:33211452-33211482
[1562] chr1:45500374-45500404 chrX:33020330-33020360
[1563] chr1:45509195-45509216 chrX:32849601-32849640
[1564] chr6:49435397-49435429 chrX:32844884-32844914
[1565] chr6:49441791-49441821 chrX:32823407-32823438
[1566] chr6:49447592-49447622 chrX:32816660-32816690
[1567] chr6:49451683-49451714 chrX:32809411-32809450
[1568] chr6:49451469-49451499 chrX:32699296-32699334
[1569] chr6:49453608-49453641 chrX:32698018-32698048
[1570] chr6:49457930-49457960 chrX:32644902-32644937
[1571] chr6:49458090-49458128 chrX:32644015-32644040
[1572] chr6:49459321-49459345 chrX:32614247-32614283
[1573] chr6:49459196-49459226 chrX:32595585-32595616
[1574] chr6:49463073-49463103 chrX:32573601-32573635
[1575] chr6:49459404-49459434 chrX:32573389-32573426
[1576] chr17:31155880-31155910 chrX:32565894-32565924
[1577] chr17:31158943-31158973 chrX:32545379-32545407
[1578] chr17:31163386-31163425 chrX:32518228-32518258
[1579] chr17:31181251-31181281 chrX:32501936-32501972
[1580] chr17:31181538-31181568 chrX:32485136-32485169
[1581] chr17:31182453-31182486 chrX:32472353-32472383
[1582] chr17:31182906-31182943 chrX:32464502-32464532
[1583] chr17:31200329-31200368 chrX:32463390-32463420
[1584] chr17:31200930-31200960 chrX:32454959-32454995
[1585] chr17:31201328-31201359 chrX:32448650-32448688
[1586] chr17:31206122-31206152 chrX:32441350-32441383
[1587] chr17:31214617-31214651 chrX:32438427-32438463
[1588] chr17:31218928-31218961 chrX:32411715-32411748
[1589] chr17:31222001-31222040 chrX:32390279-32390313
[1590] chr17:31223394-31223428 chrX:32389694-32389724
[1591] chr17:31225261-31225298 chrX:32386525-32386560
[1592] chr17:31226394-31226424 chrX:32380841-32380875
[1593] chr17:31227126-31227153 chrX:32365234-32365270
[1594] chr17:31227454-31227484 chrX:32364528-32364563
[1595] chr17:31229215-31229245 chrX:32362739-32362769
[1596] chr17:31229245-31229275 chrX:32348579-32348615
[1597] chr17:31229471-31229509 chrX:32345761-32345792
[1598] chr1:45507483-45507504 chrX:32343342-32343374
[1599] chr17:31230424-31230461 chrX:32342046-32342081
[1600] chr17:31230786-31230813 chrX:32287577-32287605
[1601] chr17:31232212-31232242 chrX:32217065-32217100
[1602] chr17:31232657-31232687 chrX:31968259-31968301
[1603] chr17:31233204-31233234 chrX:31931981-31932012
[1604] chr17:31232987-31233017 chrX:31929547-31929577
[1605] chr17:31235555-31235590 chrX:31875395-31875428
[1606] chr17:31235859-31235898 chrX:31836891-31836921
[1607] chr17:31248877-31248907 chrX:31820126-31820163
[1608] chr17:31252891-31252921 chrX:31729578-31729608
[1609] chr17:31259146-31259180 chrX:31679235-31679269
[1610] chr17:31260527-31260557 chrX:31657939-31657971
[1611] chr17:31261606-31261638 chrX:31627621-31627654
[1612] chr17:31326022-31326052 chrX:31507226-31507257
[1613] chr17:31326300-31326330 chrX:31496978-31497015
[1614] chr17:31325973-31326003 chrX:31478926-31478956
[1615] chr17:31327455-31327485 chrX:31444377-31444414
[1616] chr17:31327439-31327478 chrX:31348727-31348758
[1617] chr17:31334790-31334820 chrX:31323691-31323721
[1618] chr17:31336872-31336902 chrX:31260790-31260826
[1619] chr17:31336929-31336960 chrX:31222937-31222967
[1620] chr17:31337565-31337595 chrX:31206525-31206563
[1621] chr17:31337706-31337736 chrX:31182659-31182693
[1622] chr17:31338151-31338181 chrX:31180321-31180351
[1623] chr17:31338622-31338652 chrX:31178851-31178881
[1624] chr17:31340436-31340467 chrX:31177730-31177763
[1625] chr17:31342968-31342998 chrX:31173400-31173434
[1626] chr17:31349046-31349076 chrX:31172541-31172571
[1627] chr17:31350142-31350172 chrX:31169378-31169414
[1628] chr17:31352188-31352218 chrX:31146474-31146511
[1629] chr17:31356337-31356367 chrX:31134006-31134036
[1630] chr17:31356919-31356949 chrX:31126586-31126616
[1631] chr17:31358773-31358804 chrX:31121864-31121894
[1632] chr17:31360743-31360773 chrX:31266715-31266740
[1633] chr17:31373969-31373999 chrX:31147495-31147525
[1634] chr17:31203213-31203243 chrX:31201002-31201032
[1635] chr17:31207111-31207141 chrX:31206760-31206790
[1636] chr17:31236401-31236431 chrX:31206986-31207016
[1637] chr17:31257647-31257677 chrX:31208222-31208252
[1638] chr17:31299422-31299454 chrX:31210874-31210904
[1639] chr17:31362212-31362241 chrX:31222878-31222908
[1640] chr17:31378837-31378867 chrX:31261621-31261651
[1641] chr17:31095351-31095374 chrX:31364110-31364140
[1642] chr17:31374113-31374143 chrX:31609474-31609504
[1643] chr12:102839228-102839258 chrX:31879621-31879652
[1644] chr12:102840355-102840385 chrX:31964982-31965012
[1645] chr12:102843540-102843570 chrX:32348703-32348733
[1646] chr12:102844295-102844325 chrX:32380615-32380645
[1647] chr12:102846821-102846851 chrX:32442111-32442147
[1648] chr12:102851625-102851655 chrX:32452553-32452583
[1649] chr12:102852739-102852767 chrX:32461119-32461149
[1650] chr12:102855083-102855109 chrX:32461357-32461387
[1651] chr12:102866554-102866584 chrX:32626485-32626515
[1652] chr12:102877356-102877386 chrX:32697971-32698001
[1653] chr12:102894685-102894715 chrX:32738670-32738700
[1654] chr12:102912741-102912771 chrX:32809585-32809615
[1655] chr12:102916977-102917007 chrX:32823764-32823794
[1656] chr12:102854823-102854853 chrX:33014507-33014537
[1657] chr12:102913664-102913694 chrX:33174294-33174324
[1658] chr12:102917061-102917091 chrX:31261123-31261153
[1659] chr12:102839194-102839218 chrX:31203869-31203897
[1660] chr12:112446212-112446242 chrX:154532271-154532293
[1661] chr12:112450263-112450293 chr16:173748-173778
[1662] chr12:112453397-112453425 chr11:5225321-5225351
[1663] chr12:112454482-112454512 chr11:5225526-5225556
[1664] chr12:112455829-112455859 chr11:5225756-5225786
[1665] chr12:112477599-112477629 chr11:5227237-5227267
[1666] chr12:112477794-112477825 chr11:5227179-5227209
[1667] chr12:112481964-112481994 chr16:173563-173585
[1668] chr12:112486394-112486424 chr16:173287-173306
[1669] chr12:112488385-112488415 chr11:5226494-5226530
[1670] chr12:112489202-112489232 chr16:176828-176846
[1671] chr12:112502102-112502132 chr11:5227038-5227067
[1672] chr12:112504629-112504659 chr11:5226298-5226336
[1673] chr12:112457251-112457281 chr16:165242-165262
[1674] chr12:112504064-112504094 chr11:5226975-5226997
[1675] chr12:112505702-112505732 chr16:185359-185384
[1676] chr12:112419111-112419133 chr16:144182-144207
[1677] chr5:132370227-132370249 chr16:208085-208110
[1678] chr5:132370090-132370113 chr16:148131-148158
[1679] chr5:132378337-132378367 chr16:149636-149663
[1680] chr5:132384103-132384132 chr16:153404-153428
[1681] chr5:132385287-132385317 chr16:166965-166992
[1682] chr5:132386921-132386951 chr16:167833-167857
[1683] chr5:132388838-132388868 chr16:168393-168424
[1684] chr5:132390614-132390644 chr16:165772-165741
[1685] chr5:132390918-132390948 chr16:168895-168920
[1686] chr5:132392369-132392395 chr16:170995-171023
[1687] chr5:132393603-132393633 chr16:171159-171187
[1688] chr5:132394082-132394112 chr16:171017-171054
[1689] chr5:132378245-132378275 chr16:171919-171947
[1690] chr5:132369977-132370001 chr16:171162-171191
[1691] chr5:132394243-132394273 chr16:175133-175156
[1692] chr7:96121150-96121180 chr16:175659-175682
[1693] chr7:96121613-96121643 chr16:175266-175292
[1694] chr7:96122007-96122037 chr16:175769-175795
[1695] chr7:96131701-96131731 chr16:175727-175753
[1696] chr7:96169998-96170028 chr16:180341-180319
[1697] chr7:96184185-96184215 chr16:178063-178086
[1698] chr7:96184815-96184849 chr16:180647-180672
[1699] chr7:96189251-96189281 chr16:181275-181298
[1700] chr7:96189516-96189546 chr16:181747-181773
[1701] chr7:96191062-96191092 chr16:181166-181142
[1702] chr7:96192993-96193025 chr16:163217-163239
[1703] chr7:96234741-96234771 chr16:166246-166266
[1704] chr7:96296776-96296806 chr5:70925293-70925323
[1705] chr7:96321717-96321740 chr5:70938739-70938771
[1706] chr7:96169962-96169992 chr5:70941337-70941367
[1707] chr7:96284550-96284589 chr5:70942290-70942320
[1708] chr7:96309465-96309495 chr5:70942638-70942668
[1709] chr7:96321880-96321901 chr5:70076416-70076456
[1710] chr7:96121214-96121245 chr5:70952391-70952421
[1711] chr7:107661819-107661842 chr5:70952409-70952439
[1712] chr7:107663243-107663273 chr5:70071404-70071434
[1713] chr7:107672073-107672103 chr5:70924974-70925004
[1714] chr7:107674872-107674908 chr5:70941375-70941405
[1715] chr7:107683306-107683336 chr5:70944466-70944496
[1716] chr7:107689002-107689032 chr5:70965837-70965861
[1717] chr7:107690083-107690113 chr5:70952004-70952041
[1718] chr7:107694355-107694385 chr14:22386852-22386830
[1719] chr7:107696073-107696103 chr2:88859568-88859601.
[1720] All synthesized primers were mixed in equimolar amounts to form the primer pool GSP-NBS, with each primer in the pool having a final concentration of 50 nM and a final reaction concentration of 4 nM.
[1721] 2. Perform quality control and quantification on the sample DNA:
[1722] The purity of the extracted DNA was determined using a UV spectrophotometer, with OD260 / OD280 between 1.6 and 2.0. The concentration was determined using a Qubit spectrophotometer, with a total extraction volume of ≥100 ng and a concentration of ≥2 ng / μL.
[1723] The samples in Example 1 were 20 clinical DNA samples with reported variant information provided by the cooperating hospital. These included 4 cases of thalassemia deletion type, 2 cases of DMD deletion type positive, 1 case of large F8 gene duplication, 1 case of thalassemia point variant, and no other known deletion variants.
[1724] 3. Pretext library construction:
[1725] The genomic DNA sample was produced by Novizan. The Universal Plus DNA Library Prep Kit for Illumina V2 (Vazyme#ND627) was fragmented, end-repaired, and A-added, then ligated to a UMI-Adatper. The pretext library with UMI tags at both ends was purified and recovered using VAHTS DNA Clean Beads (Vazyme#N411).
[1726] The first nucleotide chain sequence of the universal linker element UMI-Adatper is as follows:
[1727] 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNNNNNTTAGTGCACC*T-3'
[1728] The complementary sequence (i.e., the second nucleotide chain of the universal linker element UMI-Adatper)
[1729] 5'Phosphorylation-GGTGCACTAA-Phosphorylation3'
[1730] 4. Target area enrichment:
[1731] The GSP-NBS primer pool and universal primer UC1-Primer from step 1 were used to enrich the target region of the pre-library obtained in step 3 with the UMI molecular tag. The reaction program was: [95℃ 13 min; 98℃ 2 min; (98℃ 15 s, 68℃ 10 min) 6 cycles; 72℃ 5 min; 4℃ Hold; hot cap 105℃]. After the reaction, the mixture was purified and recovered using magnetic beads. The sequence of primer UC1-Primer is as follows: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'. The reaction system is as follows:
[1732] Reagent Name One reaction (μL) PCR Mix 25μL UC1-Primer (10uM) 1μL GSP-NBS 4μL UMI Pre-document Library 20μL Total 50μL
[1733] 5. Add tags to the document library:
[1734] The product recovered in step 3 was amplified by PCR using primers with indexes. Index1 and Index2 primers required for sequencing were added. The reaction program was [95℃ 13 min; 98℃ 2 min; (98℃ 15 s, 60℃ 30 s, 72℃ 30 s) 21 cycles; 72℃ 5 min; 4℃ Hold; hot cap 105℃]. After the reaction was completed, the product was purified and recovered by magnetic beads.
[1735] The sequence of Index2-Primer, i.e., the second universal primer UC2, is as follows:
[1736] 5'-AATGATACGGCGACCACCGAGATCTACAC[CTCTCTAT]ACACGACGCTCTCCG ATCT-3'
[1737] The sequence of Index1-Primer, i.e., the third universal primer UC3, is as follows:
[1738] 5'-CAAGCAGAAGACGGCATACGAGAT[GCAGCGTAG]GTCTCGTGGGCTCGG-3'
[1739] The reaction system is as follows:
[1740] Reagent Name One reaction (μL) PCR Mix 25μL Index1-Primer (10uM) 2.5μL Index2-Primer (10uM) 2.5μL GS-PCR product recovery 20μL Total 50μL
[1741] 6. Document Quality Control:
[1742] Capillary electrophoresis was used to detect the distribution of fragments in the library. The fragment length was within 380 bp ± 20%. The results are attached. Figure 2 The library concentration is detected by Qubit. A library concentration greater than 1 ng / μL and with normal fragment distribution are considered to be of acceptable quality.
[1743] 7. All libraries to be sequenced were mixed at the same quality and sequenced using the BGI T7 sequencing platform.
[1744] 8. Bioinformatics Analysis:
[1745] After sequencing, different samples are distinguished based on index information. Then, the sequencing reads are deduplicated according to UMI information to obtain the deduplicated data for each sample. The deduplicated sequencing data of each sample are aligned to the human reference genome (GRCh38) using BWA software, and then mutation analysis is performed. The sequencing data is required to completely cover all exon regions, part of the UTR regions, and part of the hotspot mutation regions of the 37 target genes. Therefore, the method of this invention can detect point mutations and small insertion / deletion mutations in all exon regions, part of the UTR regions, and part of the hotspot mutation regions of the 37 genes involved in this invention, and detect deletion variants in related genes. Since it is currently difficult to find samples or reference materials where every target gene of this invention has mutations, the embodiments of this invention only show the mutation detection results of some target genes.
[1746] 9. Missing type analysis:
[1747] The raw sequencing data underwent quality control and filtering. Reads from each primer in the test sample and control sample were counted, and duplicates were removed based on UMI tags. The copy number of the amplified region by each primer was calculated based on the number of reads after deduplication, and the gene copy number / deletion type was then deduced. The specific calculation method is as follows:
[1748]
[1749]
[1750] 10. Non-missing type analysis:
[1751] After base calibration of the sequences, SNP and Indel variations were analyzed using GATK software (v4.1.0.0). Finally, the detected variations were annotated using Annovar software (2020-06-08 00:46:07 -0400). This invention, while ensuring a certain sequencing depth, provides highly reliable variation information in the regions covered by the primer amplification products.
[1752] 11. Results Analysis and Statistics:
[1753] The quality control information for the bioinformatics data of the 20 samples is as follows:
[1754]
[1755] Summary of variant detection results in Example 1:
[1756]
[1757]
[1758] The detection results of deletion variants can be displayed graphically. The detection results of deletion variant analysis for samples S02 and S20 are shown below. Figure 3.1 and Figure 3.2 In sample S02, exons 48-54 of the DMD gene showed obvious heterozygous deletion, while exons 1-22 of the F8 gene in sample S20 showed obvious duplication.
[1759] In summary, when the method of this invention was used to test 20 samples in this batch, the results were consistent with the known variation information, and the accuracy was 100%.
[1760] The same method was also used to test samples containing mutations in other target genes, and the results were consistent with known variant information, as detailed below:
[1761]
[1762]
[1763] Example 2
[1764] 1. The accuracy of the reagent kit in this invention is verified by testing the manufacturer's reference sample tray. Mutation information in the manufacturer's reference sample tray is verified by qPCR / MLPA.
[1765]
[1766] 2. The library construction experiment was the same as in Example 1. After the library passed the quality control, sequencing was performed. After obtaining the number of reads of the NBS primers through bioinformatics analysis, deletion and non-deletion type analysis was performed.
[1767] 3. Quality control measures for the bioinformatics data of the samples in Example 2 include:
[1768]
[1769]
[1770] 4. The missing and non-missing type analyses of the reference sample yielded the following results, all consistent with the expected values:
[1771]
[1772] For detailed case studies of missing type analysis results, please refer to [link / example]. Figures 4.1 to 4.3 Case studies are presented for deletion variants in thalassemia, DMD, and SMA.
[1773] In this Example 2, the test results for the enterprise reference plate all conform to the variation information provided in the sample report, with an accuracy of 100%.
[1774] Based on the two embodiments specifically described in this invention, the method and kit of this invention can establish a PCR targeted library preparation method for newborn multi-gene detection, which has significant advantages such as high efficiency, accuracy, and high throughput.
[1775] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.
Claims
1. A multiplex PCR kit for combined detection of multiple genes in newborn genetic diseases, characterized in that, The kit includes adapter elements, a primer pool, and PCR reagents. The adapter element comprises a first nucleotide chain and a second nucleotide chain. The first nucleotide chain includes a first universal sequence, a molecular tag, and a second universal sequence. The first universal sequence includes a sequence fragment that binds to sequencing primers. The molecular tag is a randomized or specific nucleotide sequence. The second nucleotide chain includes a complementary sequence to the second universal sequence to form a double strand upon annealing of the adapter element. The primer pool includes specific primers for detecting the following target genes: ACADM and ACADV. L, ASS1, ATP7B, CFTR, CYP21A2, DMD, ETFDH, F8, F9, FBN1, G6PD, GAA, GALC, GCDH, GJB2, GJB3, GLA, HBA1, HBA2, HBB, HLCS, IDUA, MECP2, MMACHC, MMUT, NF1, PAH, PTPN11, SLC22A5, SLC25A13, SLC26A4, SMN1, SMN2, SOS1, SRY, UGT1A1.
2. The multiplex PCR kit according to claim 1, characterized in that, The primers used to detect the target genes HBA1 and HBA2 include primers for detecting X-specific, Y-specific, and Z-specific regions on the HBA gene cluster, wherein the genomic location of the X-specific region is chr16: 170801-171701; the genomic location of the Y-specific region is chr16: 175048-175797; and the genomic location of the Z-specific region is chr16: 165401-169452 and / or chr16: 177538-183301.
3. The multiplex PCR kit according to claim 1, characterized in that, The primer pool contains a third universal sequence and a specific sequence from the 5' end to the 3' end. Preferably, the third universal sequence of each specific primer is the same. Preferably, the third universal sequence is another fragment that binds to the sequencing primer. Preferably, the nucleotide sequence of the specific sequence used to detect the target gene is completely identical to or complementary to the sequences at the corresponding sites on the following chromosomes: chr1:75724985-75725015chr7:107697998-107698028 chr1:75728300-75728330chr7:107699994-107700024 chr1:75732711-75732741chr7:107701039-107701069 chr1:75734666-75734696chr7:107702051-107702081 chr1:75745765-75745795chr7:107704267-107704297 chr1:75750347-75750377chr7:107710257-107710288 chr1:75762542-75762572chr7:107712465-107712495 chr1:75726761-75726791chr7:107715365-107715398 chr1:75731681-75731711chr7:107660926-107660955 chr1:75732901-75732931chr7:107715388-107715418 chr1:75750708-75750738chr2:38962654-38962684 chr1:75768976-75769006chr2:38985446-38985476 chr1:75724844-75724870chr2:39034653-39034683 chr1:75762728-75762758chr2:39034778-39034808 4. The multiplex PCR kit according to claim 1, characterized in that, The primer pool also includes primers for detecting an internal reference gene; preferably, the internal reference gene is selected from any of the following: RPP30, GAPDH, RPL19, RPS27A, RPS18, ACTB, PGK1, NONO, USP11, SRY; more preferably, the primers for detecting the internal reference gene detect the following positions of the internal reference gene: GAPDH-exon-2, RPL19-exon-2, RPL19-exon-4, RPL19-exon-4. n-5, RPS27A-exon-1, RPS27A-exon-2, RPS27A-exon-3, RPS18-exon-2, RPS18-exon-5, ACTB-exon-2, A CTB-exon-4, PGK1-exon-2, PGK1-exon-5, PGK1-exon-8, NONO-exon-3, USP11-exon-5, USP11-exon-10.
5. The multiplex PCR kit according to claim 4, characterized in that, The nucleotide sequence of the primer used to detect the internal reference gene is identical or complementary to the sequence at the corresponding site on the following chromosomes: chr10:90896390-90896422chr7:5529036-5529070 chr10:90876536-90876566chrX:78109800-78109835 chr12:6536344-6536375chrX:78117219-78117254 chr17:39201078-39201113chrX:78123145-78123180 chr17:39202870-39202905chrX:71294179-71294214 chr17:39203947-39203982chrX:47240254-47240289 chr2:55232985-55233020chrX:47242121-47242148 chr2:55233314-55233349chrY:2787197-2787227 chr2:55234011-55234046chrY:2787342-2787372 chr6:33272520-33272555chrY:2787108-2787138 chr6:33276040-33276075chrY:2787419-2787449 chr7:5527989-5528018.
6. The multiplex PCR kit according to claim 1, characterized in that, It also includes one or more of the following features: 1) The first base at the 3' end of the second universal sequence is T, and / or the complementary sequence of the second universal sequence has a phosphorylation modification group at the 5' end, and / or the 3' end has a phosphorylation modification group, an amino modification group or a dideoxy modification group; 2) The first universal sequence further includes a fragment that binds to an oligonucleotide chain on the flow cell of the sequencing chip and / or a first index sequence, wherein the first index sequence is located at the 5' end of the first universal sequence.
7. The kit according to claim 1, characterized in that, The kit also includes universal primers, which include one or more of a first universal primer, a second universal primer, or a third universal primer. The sequence of the first universal primer is the same as or complementary to the sequence fragment that binds to the sequencing primer. The second universal primer includes a fragment that binds to an oligonucleotide chain on the flow cell of the sequencing chip, a second index sequence, and a sequence fragment that binds to the sequencing primer. The third universal primer includes a fragment that binds to an oligonucleotide chain on the flow cell of the sequencing chip, a first index sequence, and a sequence fragment that binds to the sequencing primer.
8. Use of the kit according to any one of claims 1 to 7 in constructing a multiplex PCR targeted sequencing library for multi-gene joint detection of neonatal genetic diseases.
9. A method for constructing a multiplex PCR targeted sequencing library for multi-gene joint detection of genetic diseases in newborns, characterized in that, The construction method includes library construction using the kit described in any one of claims 1 to 7.
10. The method according to claim 9, characterized in that, The construction steps of the multiplex PCR targeted sequencing library are as follows: 1.1) The fragmented, end-repaired, phosphorylated, and 3'-A-treated nucleic acid samples were ligated with adapter elements and purified to obtain a pretext library with adapter elements; 1.2) Perform PCR amplification on the pretext library obtained in step 1.1 using the primer pool and the first universal primer pair to enrich the target region; 1.3) Purify and recover the amplification product from step 1.2, mix it with the second universal primer and the third universal primer, and perform PCR amplification again to introduce adapter elements at both ends of the amplification product from step 1.
2. 1.4) The amplification product from step 1.3 is purified and recovered to obtain the multiplex PCR targeted sequencing library.
11. The multiplex PCR targeted sequencing library obtained by the method of claim 9 or 10.
12. A method for combined detection of multiple genes in newborn genetic diseases, characterized in that, The detection method includes the following steps: 1) Sequencing the multiplex PCR targeted sequencing library as described in claim 11; 2) Perform non-deletion mutation analysis based on sequencing data or obtain the copy number of the target gene based on sequencing data: based on the number of reads in the sequencing data and the formula: The copy number of the corresponding gene is obtained by calculating and processing the results as follows: when the result is between 0.1 and 0.5, the copy number is considered to be 1; for other results, the copy number is obtained by rounding to the nearest integer. In the formula, P... S1 IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the sample; S1 P represents the number of reads obtained from primer sequencing of the sample to be tested, which is used to detect the internal reference gene; NC IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the control sample; NC This represents the number of reads obtained from primer sequencing used to detect the internal reference gene in the control sample. 3) Gene deletion mutation type analysis: The target gene deletion mutation is determined based on the obtained copy number. The gene deletion mutation type of HBA is determined by calculating the obtained copy number and the following table: The analysis methods for deletion mutations in target genes other than HBA are as follows: if the copy number is 0, the target gene is homozygous deletion; if the copy number is 1, the target gene is heterozygous deletion; if the copy number is 2, the target gene has no deletion mutation.
13. A device for detecting polygenic mutations in newborns with genetic diseases, characterized in that, The device includes: 1) Sequencing data acquisition module: used to acquire sequencing data of the multiplex PCR targeted sequencing library as described in claim 11; 2) Copy number acquisition module: used to obtain the number of reads from the sequencing data and the formula: The calculation is performed, and the result is processed to obtain the copy number. The processing method is as follows: when the calculation result is between 0.1 and 0.5, the copy number is considered to be 1; for other calculation results, the copy number is obtained by rounding to the nearest integer. In the formula, P... S1 IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the sample; S1 P represents the number of reads obtained from primer sequencing of the sample to be tested, which is used to detect the internal reference gene; NC IC represents the number of reads obtained from primer sequencing used to detect mutations in the target gene in the control sample; NC This represents the number of reads obtained from primer sequencing used to detect the internal reference gene in the control sample. 3) Gene mutation type analysis module: used to obtain the target gene mutation type based on the copy number of the module.
14. The apparatus according to claim 13, characterized in that, The gene mutation type analysis module includes a deletion mutation analysis submodule, which is used to analyze the gene deletion mutation types of HBA based on the obtained copy number and the table below: And / or, the deletion mutation analysis submodule is also used to analyze other target gene deletion mutation types besides HBA according to the following method: if the copy number is 0, the target gene is a homozygous deletion; if the copy number is 1, the target gene is a heterozygous deletion. If the copy number is 2, then the target gene has not undergone a deletion mutation.
15. The apparatus according to claim 13, characterized in that, The gene mutation type analysis module also includes a non-deletion mutation analysis submodule, which is used to analyze and annotate SNP and Indel variations after base calibration of the sequence.
16. A computer-readable storage medium, characterized in that, It stores a computer program that, when executed by a processor, implements the detection method of claim 12.
17. A computer-readable storage medium, characterized in that, It stores a computer program that, when executed by a processor, implements the detection method of claim 12.
18. A computer processing device, characterized in that, The device includes a processor and the computer-readable storage medium of claim 17, wherein the processor executes a computer program on the computer-readable storage medium to implement the steps of the detection method of claim 12.
19. An electronic terminal, characterized in that, include: Processor, memory, communicator, communication interface, and system bus; The memory and communication interface are connected to the processor and communicator via a system bus and communicate with each other. The memory is used to store computer programs, the communication interface is used to communicate with other devices, and the processor and communicator are used to run the computer programs, so that the electronic terminal performs the steps of the detection method of claim 12.
20. A computer program product, characterized in that, Includes a computer program that, when executed by a processor, implements the steps of the detection method of claim 12.