A primer / probe composition, kit and use for simultaneous detection of shigella and salmonella

Abstract

This invention provides a primer / probe composition, kit, and application for the simultaneous detection of Shigella and Salmonella, belonging to the field of gene detection technology. The invention includes primer / probe sets for detecting Shigella and primer / probe sets for detecting Salmonella. This invention has the advantages of high detection sensitivity, strong specificity, high efficiency of dual simultaneous detection, good repeatability, good stability, and low risk of contamination, and is particularly suitable for the detection of low-load samples and rapid screening of monkey samples.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, and in particular relates to a primer / probe composition, kit and application for the simultaneous detection of Shigella and Salmonella. Background Technology

[0002] Monkeys, as important laboratory animal models and rare primate resources, are receiving increasing attention for their health and welfare. In monkey populations, bacterial intestinal infections are a major cause of morbidity and mortality, with Shigella (Shigellaspp.) and Salmonella (Salmonella spp.) being two key pathogens. Shigella infection in monkeys can cause typical bacterial dysentery, while Salmonella often leads to enteritis, sepsis, and carrier states, seriously threatening individual health and population stability, and potentially interfering with the results of scientific research based on monkey models. Therefore, establishing rapid and accurate detection methods for these two pathogens in monkey populations is of urgent practical significance for early disease diagnosis, infection control, and ensuring the quality of laboratory animals.

[0003] Traditionally, the identification of Shigella and Salmonella has relied on bacterial isolation and culture, biochemical tests, and serological methods. While these methods are the cornerstone of pathogen identification, they are typically time-consuming, cumbersome, and have limited sensitivity, making them unsuitable for the high-throughput, rapid screening needs of monkey population health monitoring. Molecular diagnostic techniques, particularly polymerase chain reaction (PCR), have been widely used in pathogen detection due to their high sensitivity and speed. However, conventional PCR techniques cannot provide precise quantification, and post-amplification electrophoresis analysis poses a risk of product contamination. Real-time quantitative PCR (qPCR), especially the TaqMan probe-based hydrolysis method, enables closed-tube detection and real-time quantification, effectively avoiding cross-contamination and significantly improving detection accuracy and reproducibility, making it one of the gold standards for pathogen molecular diagnosis.

[0004] Numerous studies on qPCR detection of Shigella and Salmonella have focused on human or environmental samples, typically using the ipaH (invasive plasmid antigen H) gene and invA (invasive A) gene as specific molecular targets, respectively, with their effectiveness and specificity widely validated. However, research on specific detection methods for simian strains is relatively limited, and existing detection methods are mostly limited to the independent detection of single pathogens. In actual monkey population health monitoring, disease outbreak investigations, or import quarantine, it is often necessary to screen for multiple potential pathogens simultaneously. Compared to single-pathogen detection, developing multiplex qPCR methods capable of simultaneously detecting two or more target pathogens in a single reaction tube can significantly save precious clinical samples, reagent costs, manpower, and time, and significantly improve detection efficiency and throughput. Despite the obvious advantages of multiplex detection technology, its development faces multiple challenges, including primer and probe design compatibility, fluorescence channel spectral cross-referencing, and competitive inhibition in the reaction system.

[0005] Currently, there are no publicly available reports on the establishment and systematic evaluation of a dual TaqMan qPCR simultaneous detection technology for Shigella and Salmonella of simian origin. Therefore, establishing a dual TaqMan real-time PCR detection method with high sensitivity, strong specificity, and good stability would provide an efficient and reliable molecular diagnostic tool for the prevention and control of diseases in non-human primates, the quality monitoring of laboratory animals, and related scientific research. Summary of the Invention

[0006] In view of this, one of the objectives of the present invention is to provide a primer / probe composition for the simultaneous detection of Shigella and Salmonella.

[0007] A second objective of this invention is to provide a reagent for the simultaneous detection of Shigella and Salmonella.

[0008] A third objective of this invention is to provide a kit for the simultaneous detection of Shigella and Salmonella.

[0009] The fourth objective of this invention is to provide a method for simultaneously detecting Shigella and Salmonella for non-diagnostic purposes.

[0010] The fifth objective of this invention is to provide the application of the primer / probe composition, the reagent, the kit, or the method in the preparation of products that simultaneously monitor and / or control Shigella and Salmonella.

[0011] To achieve the above-mentioned objectives, the present invention provides the following technical solution: A primer / probe composition for the simultaneous detection of Shigella and Salmonella includes a primer / probe set for detecting Shigella and a primer / probe set for detecting Salmonella. The primer / probe set used for detecting Salmonella consists of: primer 1 with the nucleotide sequence shown in SEQ ID NO.4, primer 2 with the nucleotide sequence shown in SEQ ID NO.5, and probe 1 with the nucleotide sequence shown in SEQ ID NO.6; The primer / probe set for detecting Shigella includes combination 1 and combination 2; combination 1 consists of primer 3 with nucleotide sequence as shown in SEQ ID NO.15, primer 4 with nucleotide sequence as shown in SEQ ID NO.16, and probe 2 with nucleotide sequence as shown in SEQ ID NO.17; combination 2 consists of primer 5 with nucleotide sequence as shown in SEQ ID NO.18, primer 6 with nucleotide sequence as shown in SEQ ID NO.19, and probe 3 with nucleotide sequence as shown in SEQ ID NO.20.

[0012] The present invention provides a reagent for the simultaneous detection of Shigella and Salmonella, the reagent comprising the primer / probe composition.

[0013] The present invention provides a kit for the simultaneous detection of Shigella and Salmonella, the kit comprising the primer / probe composition or the reagent.

[0014] This invention provides the application of the primer / probe composition, the reagent, or the kit for the detection of Shigella and Salmonella for non-diagnostic purposes.

[0015] This invention provides a method for simultaneously detecting Shigella and Salmonella for non-diagnostic purposes, using the primer / probe composition, the reagent, or the kit to perform TaqMan quantitative PCR amplification on the analyte.

[0016] The preferred TaqMan real-time PCR amplification system is as follows: 5 μL 2×Master Mix, 0.8 μL primer mixture, 0.4 μL probe mixture, 1 μL DNA template, and ddH2O to make up to 10 μL.

[0017] Preferably, the working concentration of the primer mixture is 1.4 μM.

[0018] Preferably, the working concentration of the probe mixture is 0.7 μM.

[0019] Preferably, the TaqMan real-time PCR amplification program is as follows: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 20 s, 40 cycles; signals are acquired in the FAM and Cy5 channels.

[0020] The present invention provides the use of the primer / probe composition, the reagent, the kit, or the method in the preparation of products for simultaneous monitoring and / or control of Shigella and Salmonella.

[0021] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a primer / probe composition for the simultaneous detection of Shigella and Salmonella. This invention offers advantages such as high detection sensitivity, strong specificity, high efficiency of dual simultaneous detection, good repeatability, good stability, and low risk of contamination, making it particularly suitable for low-load sample detection and rapid screening of monkey samples. Cross-validation with various non-target pathogens, combined with sequencing of positive products, shows that the amplified fragments obtained using the primer / probe composition provided by this invention are highly consistent with the target gene sequence, thus ensuring the specificity and accuracy of the detection results. This invention maintains high specificity even in complex pathogen backgrounds. Attached Figure Description

[0022] Figure 1 Amplification curves of single probe qPCR for Salmonella invA gene using different primers; Figure 2 Amplification curves of single probe qPCR for the Shigella ipaH gene using different primers; the darker curves correspond to the Shigella T1 probe. Figure 3 The average Ct values ​​corresponding to single probe qPCR performed using different primers for the Salmonella invA gene and the Shigella ipaH gene; Figure 4 The results show the results of screening primer and probe reaction concentrations using Group 1; where A is the amplification curve result of Salmonella template test; B is the amplification curve result of Shigella template test; C is the average Ct value; the darker curves in Figures A and B correspond to a final primer concentration of 1.4 µM and a final probe concentration of 0.7 µM. Figure 5 The results show the results of screening primer and probe reaction concentrations using Group 2; where A represents the amplification curve results of Salmonella template test; B represents the amplification curve results of Shigella template test; C represents the average Ct value; the darker curves in Figures A and B correspond to a final primer concentration of 1.4 µM and a final probe concentration of 0.7 µM. Figure 6 The amplification curves of Salmonella during the screening of optimal annealing temperatures are shown below; where A represents annealing temperature 58℃; B represents annealing temperature 59℃; C represents annealing temperature 60℃; D represents annealing temperature 61℃; E represents annealing temperature 62℃; and F represents the average Ct value. Figure 7The amplification curves of Shigella at the optimal annealing temperature screening are shown; where G is the annealing temperature of 58℃; H is the annealing temperature of 59℃; I is the annealing temperature of 60℃; J is the annealing temperature of 61℃; K is the annealing temperature of 62℃; and L is the average Ct value. Figure 8 The amplification curves of Salmonella during the screening of optimal annealing extension time are shown below; where A represents annealing extension time of 10 s; B represents annealing extension time of 20 s; C represents annealing extension time of 30 s; D represents annealing extension time of 40 s; E represents annealing extension time of 50 s; and F represents the average Ct value. Figure 9 The amplification curves of Shigella were used to screen for the optimal annealing extension time; where G represents an annealing extension time of 10 s; H represents an annealing extension time of 20 s; I represents an annealing extension time of 30 s; J represents an annealing extension time of 40 s; K represents an annealing extension time of 50 s; and L represents the average Ct value. Figure 10 The results show the sensitivity detection results; where A is the Salmonella amplification curve; B is the Salmonella fluorescence standard curve; C is the Shigella amplification curve; D is the Shigella fluorescence standard curve; and E is the electrophoresis image of the Salmonella PCR sensitivity test (amplification length 422bp). The markers from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lane 1 is 10... 6 Copy / µL, lane 2 is 10 5 Copies / µL, lane 3 is 10 4 Copy / µL, lane 4 is 10 3 Copy / µL, lane 5 is 10 2 Copy / µL, lane 6 is 10 1 Copy / µL, lane 7 is 10 0 Copy / µL, lane 8 is the negative control (water); Figure 11 The results are for specific detection; where A is the double qPCR amplification curve of Salmonella; B is the electrophoresis diagram for specific verification of Salmonella by conventional PCR, M is the DL2000 Marker, and 1-16 are test samples (corresponding to sample numbers in Table 12); C is the double qPCR amplification curve of Shigella; B is the electrophoresis diagram for specific verification of Shigella by conventional PCR, M is the DL2000 Marker, and 1-16 are test samples (corresponding to sample numbers in Table 12). Figure 12 The results are for Salmonella testing in the stability test; where A represents the test results for high, medium, and low concentrations on day 0 of storage; B represents the test results for high, medium, and low concentrations on day 7 of storage; and C represents the test results for high, medium, and low concentrations on day 14 of storage. Figure 13 The results are for the detection of Shigella in the stability test; where A is the detection result of high, medium and low concentrations on day 0 of storage; B is the detection result of high, medium and low concentrations on day 7 of storage; and C is the detection result of high, medium and low concentrations on day 14 of storage. Detailed Implementation

[0023] This invention provides a primer / probe composition for the simultaneous detection of Shigella and Salmonella, comprising a primer / probe set for detecting Shigella and a primer / probe set for detecting Salmonella; the primer / probe set for detecting Salmonella consists of: primer 1 with the nucleotide sequence shown in SEQ ID NO.4 (CGTTTCCTGCGGTACTGTTAA), primer 2 with the nucleotide sequence shown in SEQ ID NO.5 (TTCAATCAAGATAAGACGACTGGTA), and probe 1 with the nucleotide sequence shown in SEQ ID NO.6 (TTACCACGCTCTTTCGTCTGGCATT), wherein the 5' end of probe 1 is labeled with FAM and the 3' end is labeled with a quenching group BHQ1; the primer / probe set for detecting Shigella includes combination 1 and combination 2; combination 1 consists of: primer 3 with the nucleotide sequence shown in SEQ ID NO.15 (CGCTCTGCTCTCCCTGGG), primer 2 with the nucleotide sequence shown in SEQ ID NO.6 (CGTTTCCTGCTCTCCCTGGG), primer 3 with the nucleotide sequence shown in SEQ ID NO.4 (CGTTTC ... Primer 4 as shown in ID NO. 16 (CCACAAAATGGAGAGTTCTGACTTT) and probe 2 as shown in SEQ ID NO. 17 (CAGGGAAATGTTCCGCCTCGAA); combination 2 consists of primer 5 as shown in SEQ ID NO. 18 (CCTCTGCGGAGCTTCGAC), primer 6 as shown in SEQ ID NO. 19 (CCGGAGATTGTTCCATGTGAG), and probe 3 as shown in SEQ ID NO. 20 (CGCGACACGGTCCTCACAGC); both probe 2 and probe 3 are labeled with Cy5 at the 5' end and with the quencher group BHQ2 at the 3' end.

[0024] This invention designs specific primers and probes for the conserved gene sequences of Shigella and Salmonella, respectively, and uses a dual-channel fluorescent labeling scheme to specifically recognize the two pathogens, reducing signal confusion between different amplification products.

[0025] The Shigella and Salmonella strains used in this invention are preferably monkey-derived Shigella and Salmonella. This invention selects the conserved gene *ipaH* of Shigella and the conserved gene *invA* of Salmonella as dual detection targets. Using the specific primers and TaqMan probes provided in this invention, simultaneous amplification and fluorescence detection of the two pathogen nucleic acids are performed in the same reaction system. The detection channel for Salmonella is FAM, and the detection channel for Shigella is Cy5. The nucleotide sequence of the Salmonella *invA* gene in this invention is shown in SEQ ID NO.23: GTGCTGCTTTCTCTACTTAACAGTGCTCGTTTACGACCTGAATTACTGATTCTGGTACTAATGGTGATGATCATTTCTATGTTCGTCATTCCATTACCTACCTAT CTGGTTGATTTCCTGATCGCACTGAATATCGTACTGGCGATATTGGTGTTTATGGGGTCGTTCTACATTGACAGAATCCTCAGTTTTTCAACGTTTCCTGCGGTACTGTTAATTACCACGCTCTTTCGTCTGGCATTATCGATCAGTACCAGTCGTCTTATCTTGATTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTGGCGGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTACTTATACCATGCTGACCATTGGTGATGGTCTTGTCGCCCAGATCCCCGCATTGTTGATTGCGATTAGTGCCGGTTTTATCGTGACCCGCGTAAATGGCGATAGCGATAATATGGGGCGGAATATCATGACGCAGCTGTTGAACAACCCATTTGTATTGGTTGTTACGGCTATTTTGACCATTTCAATGGGAACTCTGCCGGGATTCCCATCTGCTGAAGTTGAGGATGTTATTCGCAAAGGGATCCGTCAGACCTCTGGCAGTACCTTCCTCAGCCTTGACCCGGAAGCCTCCGCTAATTTGATGGATCTCATTACACTTAAGTTGTGGTTAATTCCGTTAACGAACGAGACCTTAACCTGCTAAATAGG. The nucleotide sequence of the Shigella ipaH gene is shown in SEQ ID NO.24: TGGAAAAACTCAGTTCCTCTGCGGAGCTTCGACAGCAGTCTTTCGCTGTTGCTGCTGATGCCACTGAGAGCTGTGAGGACCGTGTCGCGCTC ACATGGAACAATCTCCGGAAAACCCTCCTGGTCCATCAGGCATCAGAAGG CCTTTTCGATAATGATACCGGCGCTCTGCTCTCCCTGGGCAGGGAAATGTTCCGCCTCGAAATTCTGGAGGACATTGCCCGGGATAAAGTCAGAACTCTCCATTTTGTGGATGAGATAGAAGTCTACCTGGCCTTCCGGA CCATGCTCGCAGAGAAACTTCAGCTCTCCACTGCCGTGAAGGAAATGCGTTTCTATGGCGTGTCGGGAGTGACAGCAAATGACCTCCGCACTGCCGAAGCCATGGTCAGAAGCCGTGAAGAGAAAGAATTACCGGACTG.

[0026] This invention selects the Shigella ipaH gene and the Salmonella invA gene as detection targets. These genes have good conservation and specificity, which is beneficial to improving amplification efficiency and detection capability. The TaqMan probe method is used for real-time fluorescent PCR detection. Compared with the endpoint PCR electrophoresis interpretation method, it can collect fluorescence signals in real time during the amplification process, thereby improving signal recognition sensitivity.

[0027] The present invention also provides a reagent for the simultaneous detection of Shigella and Salmonella, the reagent comprising the primer / probe composition.

[0028] The present invention also provides a kit for the simultaneous detection of Shigella and Salmonella, the kit comprising the primer / probe composition or the reagent.

[0029] This invention provides the application of the primer / probe composition, reagent, or kit in the simultaneous detection of Shigella and Salmonella for non-diagnostic purposes. The non-diagnostic purposes of this invention include: baseline microbial surveys and colony monitoring of laboratory monkeys, ornamental monkeys, and wild monkey populations; screening for pathogenic bacteria contamination and environmental health risk assessment in monkey breeding farms, enclosures, drinking water, feed, and breeding environments; tracing the source and analysis of transmission pathways of foodborne pathogenic bacteria contamination from monkey feces, anal swabs, and breeding waste; quality grading, introduction quarantine, and baseline health screening of non-human primate laboratory animals; ecological distribution and epidemiological surveys of monkey-derived pathogens in wildlife habitats, surrounding water bodies, and environmental media; evaluation and verification of the antibacterial efficacy of antimicrobial drugs, disinfectants, and probiotics against monkey-derived Shigella and Salmonella; genotyping, molecular tracing, drug resistance profiles, and genetic evolutionary mechanisms of monkey-derived strains; and methodological verification of the specificity, sensitivity, repeatability, and sample suitability of detection kits and dual-fluorescence PCR methods.

[0030] This invention provides a method for simultaneously detecting Shigella and Salmonella for non-diagnostic purposes, using the primer / probe composition, the reagent, or the kit to perform TaqMan quantitative PCR amplification on the analyte.

[0031] In the method of this invention, the TaqMan real-time PCR amplification system is as follows: 5 μL 2×Master Mix, 0.8 μL primer mixture, 0.4 μL probe mixture, 1 μL DNA template, and ddH2O to make up to 10 μL. The primer mixture in this invention is a mixture of primers for detecting Salmonella and primers for detecting Shigella, with each primer mixed in equal volumes and concentrations; the probe mixture is a mixture of probes for detecting Salmonella and probes for detecting Shigella, with each probe mixed in equal volumes and concentrations. For example, when using a primer / probe set for detecting Salmonella and combination 1 for detecting Shigella, primers 1, 2, 3, and 4 of the same concentration are mixed in equal volumes to obtain a primer mixture; probes 1 and 2 of the same concentration are mixed in equal volumes to obtain a probe mixture.

[0032] In the amplification system of this invention, the working concentration of the primer mixture is preferably 1.4 μM; the working concentration of the probe mixture is preferably 0.7 μM. This invention optimizes the working concentrations of the dual primer and probe mixtures, enabling both amplification systems to maintain good amplification efficiency and channel signal balance under the same reaction conditions, thus reducing mutual competitive inhibition.

[0033] In the method for simultaneous detection of Shigella and Salmonella of this invention, the TaqMan quantitative PCR amplification program is as follows: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 20 s, for 40 cycles; signals are acquired in the FAM and Cy5 channels. The annealing time is preferably 20 s. The annealing temperature and annealing time provided by this invention balance amplification efficiency and specificity.

[0034] The present invention provides the use of the primer / probe composition, the reagent, the kit, or the method in the preparation of products for simultaneous monitoring and / or control of Shigella and Salmonella.

[0035] The reagents and instruments used in the specific embodiments of this invention include: 6× Loading Buffer (Fermentas (MBI) Inc., USA), 2× GUeasy antibody-modified Taq probe qPCR Master Mix (Anhui General Biotechnology Co., Ltd.), DL2000 DNA Marker (Takara Bio Engineering (Dalian) Co., Ltd.), 2x PCR Taq Mix (Beijing Meilaibo Medical Technology Co., Ltd.), agarose (Biowest, Spain), RNase-free H2O (Walgene, South Korea), 50TAE (BIONEER, South Korea), GelRed (Biotium, USA), Real-Time PCR 384-well plate (Roche, Germany), 10µl / 200µl / 1000µl pipette tips (AXYGEN, USA), and 1.5ml / 0.5ml centrifuge tubes (AXYGEN, USA). 2720 ​​PCR instrument (ABI, USA), Mupid (Mupid2plus) electrophoresis tank (TAKARA, Japan), EUV-LDUV gel imaging system (Korea Biotech, South Korea), Centrifuge (MICRO 17TR) centrifuge (Hanil, South Korea), laminar flow hood (Suzhou Purification Company), 2.5µl / 10µl / 100µl / 200µl / 1000µl pipettes (Eppendorf, Germany), Eppendorf epMotion 5070 autopilot workstation (Eppendorf, Germany), Autoclave (LS-B50L) sterilizer (Jiangyin Binjiang Company, China), Freezer Big (DW-40L262) refrigerator (Qingdao Haier Company), Vortex (Voltex-Genie2) vortex mixer (SI, USA), oven Dry (DHG-9240A) forced-air drying oven (Shanghai Yiheng Company), Balance (BT-214) balance (Denver, USA), Roche LightCycler® 480II real-time fluorescence quantitative PCR system (Roche, Germany) In a specific embodiment of the present invention, the statistical method is as follows: the coefficient of variation (CV) is calculated using the mean and standard deviation of the Ct values, and the formula is CV = standard deviation / mean Ct.

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1 A primer / probe composition for the simultaneous detection of Shigella and Salmonella.

[0038] The primer / probe set used for detecting Salmonella is as follows: primer 1 with nucleotide sequence as shown in SEQ ID NO.4 (CGTTTCCTGCGGTACTGTTAA), primer 2 with nucleotide sequence as shown in SEQ ID NO.5 (TTCAATCAAGATAAGACGACTGGTA), and probe 1 with nucleotide sequence as shown in SEQ ID NO.6 (TTACCACGCTCTTTCGTCTGGCATT). The 5' end of probe 1 is labeled with FAM, and the 3' end is labeled with the quencher group BHQ1. Primer / probe set for detecting Shigella: primer 3 with nucleotide sequence as shown in SEQ ID NO.15 (CGCTCTGCTCTCCCTGGG), primer 4 with nucleotide sequence as shown in SEQ ID NO.16 (CCACAAAATGGAGAGTTCTGACTTT), and probe 2 with nucleotide sequence as shown in SEQ ID NO.17 (CAGGGAAATGTTCCGCCTCGAA); probe 2 is labeled with Cy5 at the 5' end and with the quencher group BHQ2 at the 3' end.

[0039] Example 2 A primer / probe composition for the simultaneous detection of Shigella and Salmonella.

[0040] The primer / probe set used for detecting Salmonella is as follows: primer 1 with nucleotide sequence as shown in SEQ ID NO.4 (CGTTTCCTGCGGTACTGTTAA), primer 2 with nucleotide sequence as shown in SEQ ID NO.5 (TTCAATCAAGATAAGACGACTGGTA), and probe 1 with nucleotide sequence as shown in SEQ ID NO.6 (TTACCACGCTCTTTCGTCTGGCATT). The 5' end of probe 1 is labeled with FAM, and the 3' end is labeled with the quencher group BHQ1. The primer / probe set used for detecting Shigella is as follows: primer 5 with nucleotide sequence as shown in SEQ ID NO.18 (CCTCTGCGGAGCTTCGAC), primer 6 with nucleotide sequence as shown in SEQ ID NO.19 (CCGGAGATTGTTCCATGTGAG), and probe 3 with nucleotide sequence as shown in SEQ ID NO.20 (CGCGACACGGTCCTCACAGC); probe 3 is labeled with Cy5 at the 5' end and with the quencher group BHQ2 at the 3' end.

[0041] Example 3 A kit for the simultaneous detection of Shigella and Salmonella.

[0042] The primer / probe composition for simultaneous detection of Shigella and Salmonella contained in Example 1 was prepared by mixing primers 1, 2, 3 and 4 of the same concentration in equal volumes to obtain a primer mixture; and probes 1 and 2 of the same concentration were mixed in equal volumes to obtain a probe mixture.

[0043] Example 4 A kit for the simultaneous detection of Shigella and Salmonella.

[0044] The primer / probe composition for simultaneous detection of Shigella and Salmonella contained in Example 2 was prepared by mixing primers 1, 2, 5 and 6 of the same concentration in equal volumes to obtain a primer mixture; and probes 1 and 3 of the same concentration were mixed in equal volumes to obtain a probe mixture.

[0045] Example 5 A method for simultaneously detecting Shigella and Salmonella for non-diagnostic purposes.

[0046] TaqMan real-time PCR amplification was performed using the kits provided in Example 3 or Example 4.

[0047] The TaqMan real-time PCR amplification system consisted of: 5 μL 2×Master Mix, 0.8 μL primer mixture (working concentration 1.4 μM), 0.4 μL probe mixture (working concentration 0.7 μM), 1 μL DNA template, and ddH2O to make up to 10 μL.

[0048] The TaqMan real-time PCR amplification program was as follows: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 20 s, for 40 cycles; signals were acquired in the FAM and Cy5 channels.

[0049] Example 6 Optimization of the detection method in Example 5.

[0050] 1. Detection effects of different primers.

[0051] Primer pairs for amplifying the Salmonella invA fragment and the Shigella ipaH fragment were designed using Primer-BLAST. The primers for amplifying the Salmonella invA fragment are shown in SEQ ID NO.10 and SEQ ID NO.11, with a fragment length of 422 bp; the primers for amplifying the Shigella ipaH fragment are shown in SEQ ID NO.21 and SEQ ID NO.22, with a fragment length of 368 bp. The PCR amplification system was 25 μL, including 12.5 μL of 2×PCR Master Mix, 1.0 μL of upstream primer, 1.0 μL of downstream primer, 1.0 μL of template DNA, and nuclease-free water to a final volume of 25 μL. The PCR amplification program was: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 60℃ for 20 s, 72℃ for 30 s, for a total of 35 cycles; extension at 72℃ for 5 min.

[0052] After identification by agarose gel electrophoresis, the target band was purified by gel extraction. The purified DNA fragment can be used directly as a purified DNA standard or ligated into a cloning vector to prepare recombinant plasmid standards. In this embodiment, the amplified fragment and the pUC57-Amp vector were digested with EcoRI and HindIII, respectively, and then ligated to obtain a recombinant vector. After transformation, screening, and sequencing confirmation, the recombinant plasmid was extracted, the plasmid concentration was measured, and the copy number was calculated to prepare plasmid standards with different concentration gradients.

[0053] The dual TaqMan PCR primer and probe sequences are shown in Tables 1 and 2.

[0054] Primer synthesis was completed by the Kunming branch of Shanghai Sangon Biotech Co., Ltd. Primers and probes for Taqman quantitative PCR were designed in-house (Table 1) and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0055] Table 1 Primers used for amplifying Salmonella

[0056] Table 2 Primers used for amplifying Shigella

[0057] The screening criteria for optimizing the detection method in this invention are as follows: First, the Ct value and its stability, that is, both target templates can be stably amplified, and the difference is small in multiple repetitions; Second, the balance of dual-channel signals, that is, both targets invA and ipaH can be clearly amplified in the same reaction system, with a small difference in Ct values, and no obvious inhibition of one channel; Third, the shape of the amplification curve, that is, the baseline is stable, the exponential phase is clear, and the plateau phase is complete; Fourth, the fluorescence signal intensity and background noise, that is, the positive signal is significantly higher than the background, and the negative control has no abnormal increase.

[0058] The amplification efficiency and specificity of candidate primers and probes designed for Salmonella invA and Shigella ipaH genes were initially evaluated, and singlet probe qPCR was performed. The reaction system (10 µL) contained: 1.0 µL template (5 × 10⁻⁶ m³ / s). 3 5.0 µL of 2×GUeasy probe qPCR Master Mix (copies / µL of positive recombinant plasmid or negative control), 0.8 µL each of forward and reverse primers (10 µM), 0.4 µL of TaqMan probe (10 µM), and RNase-free water to a final volume of 10 µL. The reaction was performed on a Roche LightCycler® 480II system with the following program: 95℃ pre-denaturation for 30 s; followed by 40 cycles of amplification (95℃ for 10 s, 60℃ for 30 s, with single-point fluorescence acquisition during the 60℃ annealing / extension phase). Salmonella probes (T1, T2, T3) were detected in the FAM channel, and Shigella probes (T1, T2, T3) were detected in the Cy5 channel. Each probe-primer combination was run in triplicate. Ct values ​​were recorded and amplification curve morphology was observed. Candidate probes with typical amplification curves, low Ct values, and strong fluorescence signals were selected for subsequent dual-system construction. Results are shown below. Figures 1-3 As shown in Table 3.

[0059] The results showed that the Salmonella T2 probe (invA-T2) had the highest amplification efficiency (average Ct=28.21) and the strongest fluorescence signal. Figure 1 and Figure 3 The amplification efficiency of both Shigella T2 and T3 probes (ipaH-T2 / T3) was good, while the T1 probe had the weakest signal intensity. Figure 2 and Figure 3 Therefore, the Salmonella T2 probe, as well as the Shigella T2 and T3 probes, were selected for the subsequent construction of the dual system.

[0060] Table 3 Detection Results

[0061] Note: " / " indicates no amplification.

[0062] 2. Optimal primer-probe combination and concentration screening.

[0063] Based on preliminary test results, the optimal Salmonella probe selected was combined with candidate Shigella probes to construct a dual detection system.

[0064] Two combinations were tested: Group 1 (Salmonella T2 + Shigella T2) and Group 2 (Salmonella T2 + Shigella T3).

[0065] To determine the optimal reaction concentration, six primer final concentration gradients (1.6, 1.4, 1.2, 1.0, 0.8, 0.6 µM) and corresponding probe final concentration gradients (0.8, 0.7, 0.6, 0.5, 0.4, 0.3 µM) were set for each combination, as shown in Table 4. The Ct values, amplification curves, and fluorescence signal intensities of the two target templates were compared under different combinations and concentrations to determine the optimal primer-probe combination and its working concentration that provides high amplification efficiency, balanced dual-channel signals, and no mutual inhibition. The results are shown below. Figure 4 , Figure 5 As shown in Tables 5 and 6.

[0066] Table 4 Primer and probe concentrations

[0067] Table 5. Concentration screening results for Group 1

[0068] Note: " / " indicates no amplification.

[0069] Table 6. Concentration screening results for Group 2

[0070] Note: " / " indicates no amplification.

[0071] Based on the above results ( Figure 4 , Figure 5As shown in Tables 5 and 6, no negative control amplification was observed under any concentration conditions for either dual probe combination, indicating that the system has good specificity. In Group 1, the average Ct values ​​of Salmonella invA and Shigella ipaH were generally similar, but the amplification efficiency of the dual targets fluctuated relatively greatly under different concentrations. In Group 2, both invA and ipaH could achieve stable amplification. Under the conditions of a final primer concentration of 1.4 μM and a final probe concentration of 0.7 μM, the average Ct value of invA was 27.89 and the average Ct value of ipaH was 28.99. The difference in Ct values ​​between the two targets was small, the amplification curve morphology was relatively stable, the fluorescence signal had good distinction from the background, and no obvious inter-channel competition or amplification inhibition was observed. Although the Ct value under this concentration condition is not significantly different from that of adjacent concentrations, considering the amplification uniformity of dual targets, curve stability, fluorescence signal intensity, and reagent usage, group 2 (invA-T2 / ipaH-T3) was ultimately selected as the best dual detection combination, and the final primer concentration of 1.4 μM and the final probe concentration of 0.7 μM were determined as the working concentrations for subsequent experiments.

[0072] 3. Selection of optimal annealing temperature and time.

[0073] 3.1 Using the kit from Example 4 and the amplification system from Example 5, five annealing temperature gradients were set: 58℃, 59℃, 60℃, 61℃, and 62℃. The reaction program was: 95℃ for 30 s; followed by 40 cycles (95℃ for 10 s, then different annealing temperatures for 30 s). At each temperature, positive plasmid templates for Salmonella and Shigella were used for detection, with two repeated tests and three replicates each time. Ct values ​​were recorded and amplification curves were compared. The annealing temperature with high amplification efficiency, lowest Ct value, and good specificity for both target bacteria was selected. The results are shown in Tables 7 and 8. Figure 6 and Figure 7 As shown.

[0074] Table 7. Average Ct values ​​of Salmonella at different annealing temperatures.

[0075] Note: " / " indicates no amplification.

[0076] Table 8. Average Ct values ​​of Shigella at different annealing temperatures.

[0077] Note: " / " indicates no amplification.

[0078] According to Table 7, Table 8, Figure 6 and Figure 7 The results show that the optimized annealing temperature resulted in the lowest Ct value and the highest fluorescence intensity for both target bacteria at 60℃.

[0079] 3.2 At the selected optimal annealing temperature (60℃), five annealing / extension time gradients were set: 10 s, 20 s, 30 s, 40 s, and 50 s. The reaction program was adjusted accordingly (95℃ for 30 s; 40 cycles of 95℃ for 10 s, [optimal temperature] at different times). Two positive plasmid templates were used for detection to evaluate the effects of different times on amplification efficiency, signal intensity, and non-specific amplification (such as amplification in the negative control), determining the optimal time that ensures both amplification efficiency and good specificity.

[0080] The results are as follows Figure 8 , Figure 9 As shown in Tables 9 and 10, optimizing the extension time at 60℃ revealed high amplification efficiency and no nonspecific amplification at 20 s, while nonspecific signals appeared at ≥30 s. Therefore, the optimal annealing temperature was determined to be 60℃ and the optimal extension time to be 20 s.

[0081] Table 9. Average Ct values ​​of Salmonella under different annealing extension times.

[0082] Table 10. Average Ct values ​​of Shigella under different annealing extension times.

[0083] Example 7 Example 4: Performance verification of the kit.

[0084] The detection was performed using the method provided in Example 5.

[0085] 1. Sensitivity.

[0086] 1.1 Sensitivity test of the present invention: Salmonella (invA) and Shigella (ipaH) positive plasmid standards were serially diluted 10-fold with TE buffer to prepare a concentration of 1×10⁻⁶. 6 Up to 1×10 0 Template gradients were performed at 7 dilutions per µL (with a template-free control). Triple replicates were performed for each dilution. Reactions were conducted on a Roche LightCycler® 480II system. The system software automatically generated amplification and standard curves. Linear regression analysis was performed with the logarithm of template copy number on the x-axis and the mean Ct value on the y-axis to calculate the slope, intercept, and correlation coefficient (R²). 2 The detection limit of this method is defined as the lowest template concentration that produces a reproducible specific amplification curve (Ct value ≤ 36) and amplification efficiency.

[0087] 1.2 Sensitivity test using conventional PCR method: Use the same plasmid standard to dilute the series (10) 6 Up to 10 0 The sample was amplified by conventional singlet PCR using a 20 µL reaction system. The reaction system contained: 2.0 µL template, 10.0 µL 2× PCR Taq Mix, and 1.0 µL each of Salmonella or Shigella-specific PCR primers (10 µM; Salmonella PCR primer nucleotide sequences are shown in SEQ ID NO.10 and SEQ ID NO.11; Shigella PCR primer nucleotide sequences are shown in SEQ ID NO.21 and SEQ ID NO.22), with the final volume made up to ddH2O. The reaction was performed on an ABI 2720 PCR instrument with the following program: 95℃ for 30 s; 40 cycles (95℃ for 10 s, 60℃ for 30 s, 72℃ for 30 s); extension at 72℃ for 5 min. 3 µL of the PCR product was electrophoresed on a 1.5% agarose gel (containing GelRed nucleic acid dye) at 120 V for 30 min, and observed and photographed using a gel imaging system. By comparing with the DL2000 DNA Marker, the presence or absence of the target bands (422 bp for Salmonella and 368 bp for Shigella) was confirmed, and the lowest template concentration at which a clear and specific band could be observed was defined as the detection limit of this conventional PCR method.

[0088] The results are as follows Figure 10 As shown in Table 11, the detection limit for both Salmonella and Shigella using the TaqMan probe method is 10. 1 Copy / µL. The standard curve showed good linearity, Salmonella R 2 = 0.989; Shigella R 2 = 0.997. The detection limit of conventional PCR methods is 10. 3 Copy / µL. This method is 100 times more sensitive than conventional PCR.

[0089] Table 11 Sensitivity Detection Results

[0090] Note: " / " indicates no amplification.

[0091] 2. Specific detection.

[0092] To verify the specificity of the established dual TaqMan qPCR method, genomic DNA from a series of non-target bacterial strains and potentially cross-reactive pathogens was selected as templates for testing. Test strains included: *Brucella sheep*, *Brucella bovis*, *Toxoplasma gondii*, *Plasmodium malariae*, *Campylobacter jejuni*, *Yersinia enterocolitica*, *Shigella flexneri*, *Shigella dysenteriae*, *Salmonella*, enterotoxigenic *Escherichia coli*, enteroaggregative *Escherichia coli*, enterohemorrhagic *Escherichia coli*, and enteropathogenic *Escherichia coli*. Positive plasmid controls (Salmonella and Shigella) and negative controls (water) for the target bacteria were also included.

[0093] TaqMan probe-based specificity assay: An optimized dual qPCR system and procedure were used to detect all test templates, with three replicates per sample. Amplification curves for the FAM and Cy5 channels were observed, and Ct values ​​were recorded. It was expected that only Salmonella and Shigella templates would show specific amplification in their respective channels, while DNA from other strains would not show amplification signals.

[0094] PCR specificity verification: The template described in section 1.2 was amplified using the standard PCR system and procedure, and the size of the amplified products was verified by agarose gel electrophoresis. Specific bands were expected to appear only in the target bacteria.

[0095] Sequencing Validation: The amplification products (or conventional PCR products) of the target bacteria that tested positive by TaqMan and PCR were purified and sent to Shanghai Jereh Biotechnology Co., Ltd. for Sanger sequencing. The sequencing results were compared with the reference sequences of the invA and ipaH genes in the NCBI database to confirm the specificity of the amplification products.

[0096] The results are as follows Figure 11 As shown in Table 12, dual qPCR detection revealed that only the target bacteria (Salmonella, Flexnerella, and Shigella dysenteriae) showed specific amplification in the corresponding channels. Figure 11 In the sample (A and C), no signal was detected for the remaining 14 non-target pathogens (such as Brucella, Yersinia, Escherichia coli, etc.) and the negative control. The results of routine PCR electrophoresis were consistent with those of qPCR. Figure 11 (B and D in the sample). Sequencing and alignment of the positive product confirmed that the sequence was >99.9% identical to the target gene.

[0097] Table 12 Specificity Detection Results

[0098] Note: " / " indicates no amplification.

[0099] 3. Repeatability and stability verification.

[0100] To evaluate the repeatability (precision) of the method and the stability of the reagents, the following experiments were conducted: 3.1 Repeatability test: Take the high (10) values ​​respectively 5 (copy / µL), in (10) 4 (copy / µL), low (10) 3 Three concentrations (copies / µL) of mixed positive plasmid templates for Salmonella and Shigella were used for detection within the same batch using the same optimized reaction system, with six replicates for each concentration. The mean, standard deviation, and coefficient of variation of the Ct values ​​for each group were calculated, and the results are shown in Table 13.

[0101] Table 13 Results of repeatability tests (Ct values, n=6)

[0102] According to the results in Table 13, the coefficient of variation (CV) of intra-batch Ct values ​​for high, medium and low concentration templates in the repeatability test was all <2%, indicating that the present invention has good repeatability.

[0103] 3.2 Stability Test (Reagent Shelf Life): The prepared qPCR reaction premix (containing Master Mix, primers, and probes) was aliquoted and stored at 4°C. On days 0, 7, and 14 of storage, tests were performed using the above-mentioned high, medium, and low concentration mixed templates, with three replicates for each time point and each concentration. The changes in Ct values ​​and amplification curve morphology of the same template concentration were compared at different storage times to assess the short-term stability of the reagents at 4°C.

[0104] Table 14 Stability test results (Ct values, n=6)

[0105] The results are shown in Table 14. Figure 12 and Figure 13 As shown, stability tests revealed no significant differences in Ct values ​​for the same template concentration when the premixed solution stored at 4℃ was tested at 0, 7, and 14 days. P >0.05)( Figure 6 This indicates that the reagent can be stably stored at 4°C for at least 14 days.

[0106] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer / probe composition for the simultaneous detection of Shigella and Salmonella, characterized in that, This includes primer / probe sets for detecting Shigella and primer / probe sets for detecting Salmonella; The primer / probe set used for detecting Salmonella consists of: primer 1 with the nucleotide sequence shown in SEQ ID NO.4, primer 2 with the nucleotide sequence shown in SEQ ID NO.5, and probe 1 with the nucleotide sequence shown in SEQ ID NO.6; The primer / probe set for detecting Shigella includes combination 1 and combination 2; combination 1 consists of primer 3 with nucleotide sequence as shown in SEQ ID NO.15, primer 4 with nucleotide sequence as shown in SEQ ID NO.16, and probe 2 with nucleotide sequence as shown in SEQ ID NO.17; combination 2 consists of primer 5 with nucleotide sequence as shown in SEQ ID NO.18, primer 6 with nucleotide sequence as shown in SEQ ID NO.19, and probe 3 with nucleotide sequence as shown in SEQ ID NO.

20.

2. A reagent for simultaneously detecting Shigella and Salmonella, characterized in that, The reagent comprises the primer / probe composition of claim 1.

3. A kit for the simultaneous detection of Shigella and Salmonella, characterized in that, The kit comprises the primer / probe composition of claim 1 or the reagent of claim 2.

4. The use of the primer / probe composition of claim 1, the reagent of claim 2, or the kit of claim 3 for the detection of Shigella and Salmonella for non-diagnostic purposes.

5. A method for simultaneously detecting Shigella and Salmonella for non-diagnostic purposes, characterized in that, Using the primer / probe composition of claim 1, the reagent of claim 2, or the kit of claim 3, the analyte was amplified by TaqMan real-time PCR.

6. The method according to claim 5, characterized in that, The TaqMan real-time PCR amplification system consisted of: 5 μL 2×Master Mix, 0.8 μL primer mixture, 0.4 μL probe mixture, 1 μL DNA template, and ddH2O to a final volume of 10 μL.

7. The method according to claim 6, characterized in that, The working concentration of the primer mixture was 1.4 μM.

8. The method according to claim 6, characterized in that, The working concentration of the probe mixture is 0.7 μM.

9. The method according to claim 5, characterized in that, The TaqMan real-time PCR amplification program was as follows: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 20 s, 40 cycles; signals were acquired in the FAM and Cy5 channels.

10. The use of the primer / probe composition of claim 1, the reagent of claim 2, the kit of claim 3, or the method of any one of claims 5 to 9 in the preparation of products for simultaneous monitoring and / or control of Shigella and Salmonella.

Images