A method for cultivating broccoli enriched with folic acid

CN122303481APending Publication Date: 2026-06-30BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Filing Date
2026-06-02
Publication Date
2026-06-30

Smart Images

  • Figure CN122303481A_ABST
    Figure CN122303481A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology and provides SNP sites related to cauliflower folate content, including SNP1 and SNP2. It also provides primer sets for amplifying these SNP sites, and primer sets and kits for assisting in the identification of cauliflower varieties with high folate content. Furthermore, it provides a method for assisting in the identification of cauliflower varieties with high folate content. Utilizing the SNP sites related to cauliflower folate content provided by this invention, the selection efficiency of high-folate-content cauliflower seedlings can be improved efficiently and accurately, promoting the breeding of new high-folate cauliflower varieties and enhancing the nutritional value and quality of cauliflower.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to SNP molecular markers and their applications related to the folic acid content of cauliflower. Background Technology

[0002] Folic acid (PGA), also known as pteroylglutamic acid, is a water-soluble B vitamin and a collective term for tetrahydrofolate (THF) and its derivatives. Folic acid plays a vital role in plant growth and development, participating extensively in various metabolic reactions within the plant. 5-Methyltetrahydrofolate (5-MTHF) participates in the methionine cycle, thereby contributing to the methylation of proteins, DNA, and various metabolites. Folic acid not only plays a crucial role in plant growth, development, and endogenous metabolic regulation but also in human nutrition and health. The human body cannot synthesize folic acid itself and must rely on exogenous intake. Normal adults need at least 200-400 μg of folic acid daily to meet the body's normal physiological metabolic needs, while pregnant women require 600 μg daily. Although various folic acid supplements are currently available on the market, they are primarily synthesized artificially, resulting in relatively high costs. Furthermore, high doses of synthetic folic acid can hinder the effective diagnosis of vitamin B12 deficiency-related anemia and neurological disorders. Therefore, high-quality breeding to cultivate crops with high folic acid content is not only a sustainable way to promote folic acid fortification but also an effective method for healthy folic acid supplementation.

[0003] Folic acid in vegetables mainly exists in the form of 5-methyltetrahydrofolate, which is the primary source of folic acid for humans. Cauliflower is a common, highly nutritious vegetable, rich in vitamin K, fiber, sulforaphane, and other nutrients. Some varieties have particularly high folic acid content, but the overall folic acid content of cauliflower varieties is far lower than that of spinach and cabbage of the same weight, indicating significant room for improvement. Currently, high-folic acid breeding of cauliflower is largely unreliable, relying heavily on breeders' experience and lacking reliable molecular techniques to support the breeding process. Furthermore, the late maturity of the flower heads makes it impossible to remove low-folic acid materials early in planting, increasing the workload in the field. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, the first aspect of this invention provides SNP sites related to the folic acid content of cauliflower, including SNP1 and SNP2; wherein:

[0005] The SNP1 site is located at position 32937784 on chromosome 7 of the cauliflower reference genome, and the nucleotide base at this site is either A or G.

[0006] The SNP2 site is located at position 19576868 on chromosome 1 of the cauliflower reference genome, and the nucleotide base at this site is either T or A.

[0007] The second aspect of the present invention provides a primer set for amplifying the SNP sites related to cauliflower folic acid content as described in the first aspect of the present invention, comprising: a primer set for amplifying the SNP1 site and a primer set for amplifying the SNP2 site.

[0008] The third aspect of the present invention provides a primer set for assisting in the identification of cauliflower varieties with high folic acid content, the primer set including the primer set provided in the second aspect of the present invention for amplifying the SNP sites related to cauliflower folic acid content as described in the first aspect of the present invention.

[0009] The fourth aspect of the present invention provides a kit for assisting in the identification of cauliflower varieties with high folic acid content, the kit comprising the primer set for assisting in the identification of cauliflower varieties with high folic acid content provided in the third aspect of the present invention.

[0010] The fifth aspect of the present invention provides a method for assisting in the identification of cauliflower varieties with high folic acid content, the method comprising: using the genomic DNA of the sample to be tested as a template, and performing PCR amplification using the primer set provided in the third aspect of the present invention, or the kit provided in the fourth aspect of the present invention.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] This invention utilizes molecular biology techniques to rapidly identify cauliflower varieties with high folic acid content at an early stage. Folic acid content in cauliflower heads is a quantitative trait controlled by multiple genes; using molecular markers to detect corresponding genotypes can increase the probability of breeding high-folic acid content varieties. This invention can use molecular biology techniques to screen and eliminate other genotypes at the seedling stage, enabling rapid early identification of cauliflower varieties with high folic acid content.

[0013] In this invention, after determining the genotypes of the SNP1 and SNP2 sites of each test sample, only the test samples with the GGAA genotype can be retained as suspected cauliflower plants with high folic acid content. Then, the folic acid content is measured within the range of the test samples with the GGAA genotype. Therefore, it is not necessary to measure the folic acid content of all test samples. This operation can significantly save the workload of staff and improve the detection efficiency.

[0014] The method provided by this invention has the advantages of accuracy, low cost, simple operation, and saving manpower and material resources, and has a very broad application prospect.

[0015] This invention explores gene loci related to folic acid content in cauliflower and develops molecular markers closely linked to folic acid content. These molecular markers can be used to efficiently and accurately improve the selection efficiency of cauliflower seedlings with high folic acid content, promote the breeding of new cauliflower varieties with high folic acid content, and enhance the nutritional value and quality of cauliflower. Attached Figure Description

[0016] Figure 1 : Figure 1 Photo A is a photograph of the parent organism in Example 1. Figure 1 B is a bar chart showing the folic acid content of the parental lines in Example 1. Figure 1 C is a bar chart showing the folic acid content of the F2 population.

[0017] Figure 2 The following is a map showing the BSA localization of folic acid content in Example 1; wherein, Figure 2 A represents the BSA analysis localization map of folate content on chromosome C01. Figure 2 B represents the BSA analysis localization map of folic acid content on chromosome C07; the red arrows indicate key candidate regions.

[0018] Figure 3 : Figure 3 A is a schematic diagram of the SNP genotyping results of the SNP1 (BoS026) locus in Example 1. Figure 3 B is a schematic diagram of the SNP typing results of the SNP2 (BoS039) site in Example 1.

[0019] Figure 4 This is a bar chart showing the average folic acid content of the test samples for each genotype in Example 2. Detailed Implementation

[0020] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0021] In a first aspect, the present invention provides two SNP sites related to the folic acid content of cauliflower, including SNP1 (BoS026) and SNP2 (BoS039).

[0022] The SNP1 (BoS026) site is located at position 32937784 on chromosome 7 of the cauliflower reference genome (captitata_v1.0), and the nucleotide base at this site is either A or G.

[0023] The SNP2 (BoS039) site is located at position 19576868 on chromosome 1 of the cauliflower reference genome (captitata_v1.0), and the nucleotide base of this site is either T or A.

[0024] The SNP1 (BoS026) site and its upstream and downstream nucleotide sequences are shown in SEQ ID NO:1 of the sequence listing; the SNP2 (BoS039) site and its upstream and downstream nucleotide sequences are shown in SEQ ID NO:2 of the sequence listing.

[0025] When the nucleotide base at the SNP1 site mutates from A to G, and the nucleotide base at the SNP2 site mutates from T to A, the cauliflower is a suspected high-folate variety.

[0026] "High folic acid content" means that the folic acid content of the cauliflower head is greater than 30 μg / 100gFW; in this invention, unless otherwise specified, "high folic acid content" is defined in the same way.

[0027] Secondly, the present invention provides primer sets for amplifying two SNP sites related to cauliflower folic acid content provided in the first aspect of the present invention, including: a primer set for amplifying the SNP1 site and a primer set for amplifying the SNP2 site; wherein:

[0028] The primer set used to amplify the SNP1 site includes:

[0029] First forward primer (SEQ ID NO:3):

[0030] 5'-GAGAGGAGATTTGAAAGAAGCGAAG-3';

[0031] Second forward primer (SEQ ID NO:4):

[0032] 5'-TAGAGAGGAGATTTGAAGAAGCGAAA-3';

[0033] First reverse primer (SEQ ID NO:5):

[0034] 5'-TAAATGATAACGAAATTTCTAACACCTTCATTC-3'.

[0035] Preferably, the 5' end of the first forward primer may also carry a FAM adapter sequence (GAAGGTGACCAAGTTCATGCT); the nucleotide sequence composition of the first forward primer with the FAM adapter sequence is shown in SEQ ID NO:9 of the sequence listing:

[0036] SEQ ID NO:9:

[0037] 5'-GAAGGTGACCAAGTTCATGCTGAGAGGAGATTTGAAGAAGCGAAG-3';

[0038] Preferably, the 5' end of the second forward primer may also carry a HEX adapter sequence (GAAGGTCGGAGTCAACGGATT); the nucleotide sequence composition of the second forward primer with the HEX adapter sequence is shown in SEQ ID NO:10 of the sequence listing:

[0039] SEQ ID NO:10:

[0040] 5'-GAAGGTCGGAGTCAACGGATTTAGAGAGGAGATTTGAAGAAGCGAAA -3'.

[0041] The primer set used to amplify the SNP2 site includes:

[0042] Third forward primer (SEQ ID NO:6):

[0043] 5'-GTCAGCTTCTCTGTGACACAAATATA-3';

[0044] Fourth forward primer (SEQ ID NO:7):

[0045] 5'-GTCAGCTTCTCTGTGACACAAATATT-3';

[0046] Second reverse primer (SEQ ID NO:8):

[0047] 5'-CGCTTTGTACTGCTTATATTACTTTCTAATTTG-3'.

[0048] Preferably, the 5' end of the third forward primer may also carry a FAM adapter sequence (GAAGGTGACCAAGTTCATGCT); the nucleotide sequence composition of the third forward primer with the FAM adapter sequence is shown in SEQ ID NO:11 of the sequence listing:

[0049] SEQ ID NO:11:

[0050] 5'-GAAGGTGACCAAGTTCATGCTGTCAGCTTCTCTGTGACACAAATATA-3';

[0051] Preferably, the 5' end of the fourth forward primer may also carry a HEX adapter sequence (GAAGGTCGGAGTCAACGGATT); the nucleotide sequence composition of the fourth forward primer with the HEX adapter sequence is shown in SEQ ID NO:12 of the sequence listing:

[0052] SEQ ID NO:12:

[0053] 5'-GAAGGTCGGAGTCAACGGATTGTCAGCTTCTCTGTGACACAAATATT-3'.

[0054] Thirdly, the present invention provides a primer set for assisting in the identification of cauliflower varieties with high folic acid content, the primer set comprising: a primer set for amplifying the SNP1 site and a primer set for amplifying the SNP2 site; wherein:

[0055] The primer set used to amplify the SNP1 site includes:

[0056] First forward primer (SEQ ID NO:3):

[0057] 5'-GAGAGGAGATTTGAAAGAAGCGAAG-3';

[0058] Second forward primer (SEQ ID NO:4):

[0059] 5'-TAGAGAGGAGATTTGAAGAAGCGAAA-3';

[0060] First reverse primer (SEQ ID NO:5):

[0061] 5'-TAAATGATAACGAAATTTCTAACACCTTCATTC-3'.

[0062] Preferably, the 5' end of the first forward primer may also carry a FAM adapter sequence (GAAGGTGACCAAGTTCATGCT); the nucleotide sequence composition of the first forward primer with the FAM adapter sequence is shown in SEQ ID NO:9 of the sequence listing:

[0063] SEQ ID NO:9:

[0064] 5'-GAAGGTGACCAAGTTCATGCTGAGAGGAGATTTGAAGAAGCGAAG-3';

[0065] Preferably, the 5' end of the second forward primer may also carry a HEX adapter sequence (GAAGGTCGGAGTCAACGGATT); the nucleotide sequence composition of the second forward primer with the HEX adapter sequence is shown in SEQ ID NO:10 of the sequence listing:

[0066] SEQ ID NO:10:

[0067] 5'-GAAGGTCGGAGTCAACGGATTTAGAGAGGAGATTTGAAGAAGCGAAA -3'.

[0068] The primer set used to amplify the SNP2 site includes:

[0069] Third forward primer (SEQ ID NO:6):

[0070] 5'-GTCAGCTTCTCTGTGACACAAATATA-3';

[0071] Fourth forward primer (SEQ ID NO:7):

[0072] 5'-GTCAGCTTCTCTGTGACACAAATATT-3';

[0073] Second reverse primer (SEQ ID NO:8):

[0074] 5'-CGCTTTGTACTGCTTATATTACTTTCTAATTTG-3'.

[0075] Preferably, the 5' end of the third forward primer may also carry a FAM adapter sequence (GAAGGTGACCAAGTTCATGCT); the nucleotide sequence composition of the third forward primer with the FAM adapter sequence is shown in SEQ ID NO:11 of the sequence listing:

[0076] SEQ ID NO:11:

[0077] 5'-GAAGGTGACCAAGTTCATGCTGTCAGCTTCTCTGTGACACAAATATA-3';

[0078] Preferably, the 5' end of the fourth forward primer may also carry a HEX adapter sequence (GAAGGTCGGAGTCAACGGATT); the nucleotide sequence composition of the fourth forward primer with the HEX adapter sequence is shown in SEQ ID NO:12 of the sequence listing:

[0079] SEQ ID NO:12:

[0080] 5'-GAAGGTCGGAGTCAACGGATTGTCAGCTTCTCTGTGACACAAATATT-3'.

[0081] Fourthly, the present invention provides a kit for assisting in the identification of cauliflower varieties with high folic acid content, the kit comprising the primer set provided in the third aspect of the present invention.

[0082] Preferably, the kit further includes at least one of the following: PCR amplification buffer, dNTPs, enzymes, and DNA chromogenic dyes.

[0083] Fifthly, the present invention provides a method for assisting in the identification of cauliflower varieties with high folic acid content, the method comprising: using the genomic DNA of the sample to be tested as a template, and performing PCR amplification using the primer set provided in the third aspect of the present invention, or the kit provided in the fourth aspect of the present invention.

[0084] In a preferred embodiment, the method includes the following steps:

[0085] Steps for extracting genomic DNA:

[0086] Leaf samples were used as experimental materials, and genomic DNA was preferably extracted using the CTAB method.

[0087] PCR amplification steps:

[0088] Using the genomic DNA of the sample to be tested as a template, PCR amplification reaction is performed using the primer set provided in the third aspect of the present invention or the kit provided in the fourth aspect of the present invention to obtain PCR amplification products.

[0089] The following PCR amplification reaction procedure is preferred:

[0090] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, followed by annealing at 61–55℃ for 60 s, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; denaturation at 94℃ for 20 s, followed by annealing at 55℃ for 60 s, and continued to expand to 26 cycles.

[0091] Detection and judgment steps:

[0092] The PCR amplification products of each sample were analyzed to determine the genotype of the SNP1 and SNP2 sites in the sample.

[0093] The detection methods mentioned above can be selected from: fluorescence signal detection, direct sequencing, and restriction endonuclease digestion.

[0094] The methods for making the above judgments include:

[0095] If the genotype of the SNP1 locus is GG and the genotype of the SNP2 locus is AA, then the sample to be tested is or is suspected to be a cauliflower variety with high folic acid content.

[0096] In a sixth aspect, the present invention provides the SNP sites provided in the first aspect of the present invention, the primer set provided in the second aspect for amplifying the two SNP sites related to the cauliflower folate content provided in the first aspect of the present invention, the primer set provided in the third aspect for assisting in the identification of cauliflower varieties with high folate content, the reagent kit provided in the fourth aspect, and the method provided in the fifth aspect, and their application in assisting in the identification of cauliflower varieties with high folate content.

[0097] In a seventh aspect, the present invention provides the SNP sites provided in the first aspect of the present invention, the primer set provided in the second aspect for amplifying the two SNP sites related to the cauliflower folate content provided in the first aspect of the present invention, the primer set provided in the third aspect for assisting in the identification of cauliflower varieties with high folate content, the reagent kit provided in the fourth aspect, and the method provided in the fifth aspect, and their application in cultivating cauliflower varieties with high folate content.

[0098] Unless otherwise specified, all reagents and materials used in the following examples are commercially available products. Unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the art and can be obtained from textbooks, reference books, or academic journals. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0099] Example 1

[0100] This embodiment illustrates the QTL mapping of cauliflower isolates with different folic acid contents and the development of molecular markers related to cauliflower folic acid content.

[0101] The cauliflower materials CF2301 and CF2302 used in the following embodiments are stored at the Beijing Crop Germplasm Resource Bank (Vegetables). Anyone may freely obtain the relevant materials from that bank within the patent term from the date of application of this invention in order to achieve the purpose of this invention. The contact address is: Vegetable Research Institute, Beijing Academy of Agricultural and Forestry Sciences, Xijiao Banjing, Haidian District, Beijing, 100097, China; Contact person: Zhang Quan; Telephone: 010-81127222.

[0102] 1. Determination of folic acid content in cauliflower heads.

[0103] This invention utilizes cauliflower materials CF2301 (high folate content material) and CF2302 (low folate content material) with significant differences in folate content in the flower heads. In this invention, "low folate content" refers to a folate content below 10 μg / 100g FW (e.g., ...). Figure 1 A) Hybridization was performed to construct an F2 segregating population containing 120 individual plants. The folic acid content in the head tissue of each individual plant from the CF2301, CF2302, and F2 segregating populations was determined using the following methods:

[0104] (1) The flower head sample to be tested was dried using a vacuum freeze dryer, then weighed and crushed to obtain 0.2 g of freeze-dried sample. The freeze-dried sample was then placed in a 15 mL centrifuge tube, and 4 mL of extraction solution (pH=6.5, formula below) was added. After shaking well, the sample was quickly heated in boiling water for 5 minutes to inactivate the enzyme, followed by an ice bath for 5 minutes to obtain the cooled sample. 400 μL of α-amylase and 150 μL of protease were added to the cooled sample in sequence, and the sample was cultured in a shaking incubator at 37℃ for 1 h to obtain the enzymatically hydrolyzed sample. The enzymatically hydrolyzed sample was then treated in a boiling water bath for 5 minutes and an ice bath for 5 minutes. 150 μL of rat serum was added to the sample, and the sample was cultured in a shaking incubator at 37℃ for 4 h, followed by a boiling water bath for 5 minutes and an ice bath for 5 minutes to obtain the cultured sample. The cultured sample was then centrifuged at 3000 rpm for 5 minutes, and the supernatant was collected in a 1.5 mL centrifuge tube and centrifuged at 12000 rpm for 30 minutes at 4℃ to obtain the supernatant. The supernatant was then filtered through a 0.22 μm filter membrane to remove impurities, yielding the test solution. This test solution was stored at -80°C for later use. The entire extraction process was conducted under light-protected conditions.

[0105] The preparation method of the above extract includes: extracting 5-M-THF with 0.05 mol / L phosphate buffer, weighing 5.7055 g of dipotassium hydrogen phosphate trihydrate and 3.4023 g of potassium dihydrogen phosphate and dissolving them in 0.5 L of water, and storing at room temperature. Before use, add 1% L-ascorbic acid and 0.1% DTT, and adjust the pH to 6.5 with 1 mol / L KOH.

[0106] (2) The test solution obtained in step (1) was analyzed by HPLC. The HPLC conditions were as follows: ZORBAX Polaris C18-A column (250 mm × 4.6 mm, 5 μm), column temperature 40℃; injection volume 10 μL; flow rate 1.0 mL / min; mobile phase A was 50 mmol / L pH 3.18 potassium dihydrogen phosphate solution; mobile phase B was acetonitrile, with a ratio of 94:6. The excitation wavelength was 290 nm and the emission wavelength was 360 nm.

[0107] like Figure 1 As shown in B, the folic acid content of parent CF2301 is 61.18 μg / 100gFW, and the folic acid content of CF2302 is 3.85 μg / 100gFW.

[0108] like Figure 1As shown in C, the folate content of each individual plant in the F2 population ranged from 0.93 to 56.83 μg / 100gFW; among them, the folate content of 31 individual plants was between 0 and 10 μg / 100gFW, the folate content of 44 individual plants was between 10 and 20 μg / 100gFW, the folate content of 26 individual plants was between 20 and 30 μg / 100gFW, the folate content of 9 individual plants was between 30 and 40 μg / 100gFW, the folate content of 6 individual plants was between 40 and 50 μg / 100gFW, and the folate content of 4 individual plants was between 50 and 60 μg / 100gFW.

[0109] 2. QTL positioning of folic acid content in cauliflower head.

[0110] DNA was extracted from the parental materials CF2301 and CF2302 using the CTAB method. Based on the folate content of each plant in the F2 population, the 20 plants with the highest and 20 plants with the lowest folate content were selected, and their DNA was extracted separately using the CTAB method. The DNA from the 20 high-folate-content plants was uniformly mixed and denoted as F2_High; the DNA from the 20 low-folate-content plants was uniformly mixed and denoted as F2_Low. Resequencing was performed on the four samples (CF2301, CF2302, F2_High, and F2_Low) at a sequencing depth of 30×. SNP-index association analysis revealed the presence of closely related regions Fa1, Fa7.1, and Fa7.2 on chromosomes C01 and C07 (e.g., ...). Figure 2 (As shown).

[0111] 3. Develop KASP markers related to the folic acid content of cauliflower heads within the QTL range.

[0112] Based on parental resequencing data, KASP markers were developed in candidate regions Fa1, Fa7.1, and Fa7.2. The specific criteria were that the SNP loci must be different between the parents, and the bases before and after the locus must be completely identical for at least 100 bases. Using high-folate-content parent CF2301, low-folate-content parent CF2302, and their F1 hybrids, KASP markers were developed and screened for validation. KASP markers BoS026 and BoS039, showing good genotyping results between the parents and F1 generation, were found in the Fa7.2 candidate region (C07 chromosome 32194941~33095942) and the Fa1 candidate region (C01 chromosome 19253093~23032784), respectively. Figure 3 As shown in Figure A, the red dots represent the low-folate parental AA genotype detected by the BoS026 marker, the green dots represent the heterozygous AG genotype, and the blue dots represent the high-folate parental GG genotype; (e.g., ...) Figure 3As shown in Figure B, the red dots represent the low-folate parental TT genotype detected by the BoS039 marker, the green dots represent the heterozygous AT genotype, and the blue dots represent the high-folate parental AA genotype. Figure 3 B).

[0113] (1) The specific sequence containing the above SNP1 marker (BoS026) and its amplification primer set are as follows:

[0114] The above-mentioned SNP1 site and its upstream and downstream nucleotide sequences are shown in SEQ ID NO:1:

[0115] 5'-GCAAAGGAACACATGGCGACCGTACGGAGCAACGGAGCCGGCGAGGGTGCCGGTGTACATCTCCTGACGTTTGAATCCGTAGAGCTCGTCGTCCGAGACCGGTGCAGCGTTAACGTTGTTCTCTACTTCCGCCATCGAAGAGTACTTCACTCCGAAAGCTAGGGATTCGCTCAAGTAGAGAGGAGATTTGAAGAAGCGAA[G / A]GGATCGAAATGAAGGTGTTAGAAATTTCGTTATCATTTACTTTTATATTTTCCGAAAAATAAAAGTAAAGTCTCGTTTATATTCGTGTAATCTTAACAACCGTCGCTTCCATGCCCACGCAGATTGGGCCTGAAATTAAAATGACTGGTTGGTGATACAAGCATTGTACCTACCACATTTCACCGTCTTTCCATTCCTAA-3'.

[0116] The first forward primer (with a FAM adapter) used to amplify the above-mentioned SNP1 marker (BoS026) is shown in SEQ ID NO:9:

[0117] 5'- GAAGGTGACCAAGTTCATGCT GAGAGGAGATTTGAAAGAAGCGAAG-3';

[0118] The underlined part is the general connector sequence for marking FAM, and the ununderlined part is the specific sequence.

[0119] The second forward primer (with a HEX adapter) used to amplify the above-mentioned SNP1 marker (BoS026) is shown in SEQ ID NO:10:

[0120] 5'- GAAGGTCGGAGTCAACGGATT TAGAGAGGAGATTTGAAGAAGCGAAA -3';

[0121] The underlined part is the general connector sequence that marks HEX, and the part without underline is the specific sequence.

[0122] The first reverse primer used to amplify the above-mentioned SNP1 marker (BoS026) is shown in SEQ ID NO:5:

[0123] 5'-TAAATGATAACGAAATTTCTAACACCTTCATTC-3'.

[0124] (2) The specific sequence containing the above SNP2 marker (BoS039) and its amplification primer set are as follows:

[0125] The above-mentioned SNP2 site and its upstream and downstream nucleotide sequences are shown in SEQ ID NO:2:

[0126] 5'-CTCTACAAAGTACTGAAATAAAAGCAAGCGAAATTAGAATCCAAGTTCAAAACTGAGTAGAGAGAAACTTATTGTTCTTCGATCTTACTTTAAGTGCCATGTCATCAATTCCCTTCGTGGTTAGAATAACATTGGCCCCAGCTTTAAGAAGTTTCTCTATCCGCTCTTTTGTCATGTCAGCTTCTCTGTGACACAAATAT[A / T]AAGTAACAAATTAGAAAGTAATATAAGCAGTACAAGCGTACAAGAGAGCCAATAGGCTTAGGCTTTCTCTATCCCGTAAAACCCGCAAGGATCAAGAGAGCAAAGCGATTGCATTTGTAGAACAAAAAGGTAAGTACTCTGAATGTAAATAGATTCAGTGAAAATTACCTTTGACGGATTTTTTCCAATTCTCGTGGATC-3'.

[0127] The third forward primer (with a FAM adapter) used to amplify the above-mentioned SNP2 marker (BoS039) is shown in SEQ ID NO:6:

[0128] 5'- GAAGGTGACCAAGTTCATGCT GTCAGCTTCTCTGTGACACAAATATA-3';

[0129] The underlined part is the general connector sequence for marking FAM, and the ununderlined part is the specific sequence.

[0130] The fourth forward primer (with a HEX adapter) used to amplify the above-mentioned SNP2 marker (BoS039) is shown in SEQ ID NO:7:

[0131] 5'- GAAGGTCGGAGTCAACGGATT GTCAGCTTCTCTGTGACACAAATATT -3';

[0132] The underlined part is the general connector sequence that marks HEX, and the part without underline is the specific sequence.

[0133] The second reverse primer used to amplify the above-mentioned SNP2 marker (BoS039) is shown in SEQ ID NO:8:

[0134] 5'-CGCTTTGTACTGCTTATATTACTTTCTAATTTG-3'.

[0135] In the primer set mentioned above, the FAM of the first and third forward primers, and the HEX of the second and fourth forward primers have base differences at the 3' end, which can competitively bind to the target site and display the corresponding FAM or HEX fluorescence. After signal amplification, the genotype of the target site can be determined.

[0136] Example 2

[0137] This embodiment describes the validation of markers BoS026 (SNP1) and BoS039 (SNP2) associated with cauliflower folic acid content in a segregating population.

[0138] S1. Extraction and purification of DNA from the isolated population to be tested.

[0139] The F2 generation segregating population was constructed again using the high-folic acid material CF2301 and the low-folic acid material CF2302. Then, 120 individual plants were randomly selected from the F2 generation segregating population, and genomic DNA was extracted from the leaves of each individual plant using the CTAB method.

[0140] The specific procedure includes: taking approximately 2 g of young cauliflower leaves and placing them in a 2 mL centrifuge tube containing steel balls, then grinding them using a tissue homogenizer (60 Hz, 30 s). Next, add 600 μL of CTAB solution to the homogenized sample, mix thoroughly, and incubate at 65°C for 30 min. After cooling to room temperature, add 400 μL of DNA extraction buffer, vortex at 80 rpm for 10 min, then centrifuge at 12000 rpm for 10 min. Transfer 400 μL of the supernatant to a 1.5 mL centrifuge tube. Add 400 μL of pre-chilled isopropanol to the supernatant and freeze at -20°C for 2 h. Then centrifuge at 12000 rpm for 10 min, discard the supernatant, wash the precipitate with 75% ethanol and air dry, then dissolve the DNA in water to obtain the genomic DNA of each individual plant, which is then stored at -20°C.

[0141] S2. Genotyping of the segregating population was performed using SNP molecular markers (SNP1_BoS026 and SNP2_BoS039).

[0142] The quality of the genomic DNA was determined, and the quality requirements included: an A260 / A280 ratio of approximately 1.8, an A260 / A230 ratio greater than 1.8, and a DNA concentration of 50 ng / μL.

[0143] Using the genomic DNA mentioned above as a template, a specific KASP Primer mix (i.e., KASP primer mixture) and a universal KASP Master mix (JasonGen HiGeno 2×Probe Mix C) were added to perform a PCR amplification reaction to obtain the amplification product.

[0144] The KASP primer mixture was prepared as follows: the first forward primer stock solution, the second forward primer stock solution (or the third forward primer stock solution, the fourth forward primer stock solution) and the first reverse primer stock solution (or the second reverse primer stock solution) with a concentration of 20 μM were mixed at a volume ratio of 2:2:5 to obtain the above KASP primer mixture.

[0145] The PCR reaction system includes:

[0146] 3 μL of KASP primer mixture, 3 μL of 50 ng / μL DNA template, and 3 μL of 1× universal KASP Master mix.

[0147] The preparation method of this PCR reaction system includes: drying the KASP primer mixture and DNA template into dry powder, then adding 3 μL of 1× concentration KASP Master Mix, and then performing the detection.

[0148] The PCR amplification reaction procedure for KASP detection includes:

[0149] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, followed by annealing and extension at 61–55℃ for 60 s (annealing temperature decreased by 0.6℃ per cycle), for a total of 10 cycles; denaturation at 94℃ for 20 s, followed by annealing and extension at 55℃ for 60 s, for a further expansion of 26 cycles.

[0150] S3. Analysis of test results.

[0151] (1) When the temperature of each PCR amplification product drops below 40℃, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent tag sequence is read at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the HEX fluorescent tag sequence is read at an excitation wavelength of 528 nm and an emission wavelength of 560 nm). The genotype of the tested cauliflower material based on each SNP site is determined according to the fluorescence signal color.

[0152] The PCR amplification products were analyzed.

[0153] The specific analysis principles are as follows: If a tested cauliflower material shows a blue fluorescent signal based on a certain SNP site, then the genotype of the tested cauliflower material based on that SNP site is homozygous for the 3' end of the first base of the first forward primer (or third forward primer) amplifying that SNP site; if a tested cauliflower material shows a red fluorescent signal based on a certain SNP site, then the genotype of the tested cauliflower material based on that SNP site is homozygous for the 3' end of the second forward primer (or fourth forward primer) amplifying that SNP site; if a tested cauliflower material shows a green fluorescent signal based on a certain SNP site, then the genotype of the tested cauliflower material based on that SNP site is heterozygous.

[0154] The results are shown in Table 1.

[0155] As shown in Table 1, among the 120 individual plants, the genotypes of SNP1 (BoS026) and SNP2 (BoS039) loci are as follows: 4 plants have the genotype GGTT, 28 plants have the genotype GGAA, 18 plants have the genotype AATT, 37 plants have the genotype AGAA, 8 plants have the genotype AGTA, 10 plants have the genotype AAAA, 2 plants have the genotype GGTA, 10 plants have the genotype AGTT, and 3 plants have the genotype AATA.

[0156] Table 1: Genotypes and Folic Acid Content of 120 Individual Plants

[0157]

[0158] (2) Determine the folate content of the flower heads in the segregating population.

[0159] The folic acid content of flower heads at the heading stage of 120 individual plants in the segregating population was determined according to the method in Example 1. The folic acid content ranged from 1.61 to 57.33 μg / 100gFW (as shown in Table 1). The folic acid content phenotypes of individual plants with different genotypes were statistically analyzed.

[0160] like Figure 4 As shown, the average folate content of the flower heads for the GGAA genotype was 32.70 μg / 100gFW, for the GGTA genotype it was 21.18 μg / 100gFW, for the AGAA genotype it was 17.86 μg / 100gFW, for the AAAA genotype it was 17.30 μg / 100gFW, for the AATA genotype it was 15.87 μg / 100gFW, for the AGTA genotype it was 13.67 μg / 100gFW, for the GGTT genotype it was 13.45 μg / 100gFW, for the AGTT genotype it was 11.71 μg / 100gFW, and for the AATT genotype it was 9.80 μg / 100gFW. μg / 100gFW.

[0161] Phenotypic data showed that in the F2 population, all individual plants with folate content higher than 40 μg / 100g FW exhibited the GGAA genotype; of the 19 individual plants with folate content higher than 30 μg / 100g FW, 14 exhibited the GGAA genotype, accounting for 73.68%. Furthermore, the four individual plants with folate content immediately adjacent to 30 μg / 100g FW (the four individual plants numbered 20-23 in Table 1, with folate content between 28.93-29.77 μg / 100g FW) also all had the GGAA genotype.

[0162] Of the 28 individual plants with the GGAA genotype, 14 had a folic acid content higher than 30 μg / 100g FW, accounting for 50%. The remaining 5 individual plants with a folic acid content higher than 30 μg / 100g FW (numbered 11, 12, 14, 15, and 17 in Table 1) all had the AGAA genotype. However, there were a total of 37 individual plants with the AGAA genotype, and only 13.5% (5 / 37=13.5%) had a folic acid content higher than 30 μg / 100g FW, which was far lower than that of the individual plants with the GGAA genotype.

[0163] Given that folic acid content is a quantitative trait controlled by multiple genes, it has long been difficult to screen for varieties with high folic acid content using molecular marker technology. This invention has developed BoS026 and BoS039 markers for genotyping of cauliflower seedlings and for screening GGAA genotype materials to select high folic acid varieties. This can significantly improve the screening efficiency of high folic acid materials, while effectively reducing field planting costs and breeding difficulty, and greatly improving breeding efficiency.

[0164] Example 3

[0165] This embodiment describes the application of markers BoS026 (SNP1) and BoS039 (SNP2) related to cauliflower folic acid content in assisting the identification of folic acid content in other cauliflower heads.

[0166] In this embodiment, the following cauliflower varieties were used as test samples, including 5 purple cauliflower samples: 26CF46, 26CF122, 26CF132, 26CF145, and 26CF199, and 5 white cauliflower samples: 26CF12, 26CF15, 26CF40, 26CF52, and 26CF53.

[0167] The genotypes of the BoS026 and BoS039 loci were detected according to the methods in S1-S3 of Example 2, and the folic acid content in the cauliflower head was detected according to the method for determining the folic acid content of the cauliflower head in Example 1. The results are shown in Table 2.

[0168] Table 2. Folic acid content and genotype of cauliflower

[0169]

[0170] The results showed that among the 10 tested cauliflower varieties, 4 had folic acid content higher than 30 μg / 100g FW, all of which were white cauliflower varieties. Of the 10 tested cauliflower varieties, 4 had the GGAA genotype with an average folic acid content of 57.01 μg / 100g FW, 1 had the AGAA genotype with 48.34 μg / 100g FW, 3 had the AGTT genotype with an average folic acid content of 6.82 μg / 100g FW, 1 had the AAAA genotype with 4.30 μg / 100g FW, and 1 had the AATT genotype with 12.70 μg / 100g FW. It is evident that cauliflower materials with the genotype GGAA have a much higher probability of folic acid content exceeding 30 μg / 100gFW than other cauliflower materials, and their folic acid content is also much higher than that of other cauliflower varieties. Therefore, the markers provided by this invention can be used to help identify cauliflower varieties with high folic acid content.

[0171] In summary, this invention utilizes the BoS026 and BoS039 markers for screening, selecting GGAA genotype materials at the seedling stage, thereby improving the screening efficiency for high-folate materials. Without these markers, obtaining high-folate materials in the population requires planting all materials in the field until flower heads emerge before measuring the folate content in the flower head tissue for screening. Furthermore, due to gene segregation, multiple generations of field screening are necessary, significantly increasing field workload and time, resulting in substantial cost increases. This invention uses SNP1 (BoS026) and SNP2 (BoS039) loci for screening, selecting only GGAA genotype materials from the seedling stage for further planting and then measuring the flower head folate content of these materials. This avoids the screening of a large number of non-high-folate materials, significantly improving the screening efficiency for high-folate materials, significantly reducing workload, and increasing economic benefits.

Claims

1. SNP sites associated with cauliflower folate content, including SNP1 and SNP2; among which: The SNP1 site is located at position 32937784 on chromosome 7 of the cauliflower reference genome, and the nucleotide base at this site is either A or G. The SNP2 site is located at position 19576868 on chromosome 1 of the cauliflower reference genome, and the nucleotide base at this site is either T or A.

2. The SNP site related to cauliflower folic acid content according to claim 1, characterized in that: The SNP1 site and its upstream and downstream nucleotide sequences are as shown in SEQ ID NO:1 in the sequence listing; The SNP2 site and its upstream and downstream nucleotide sequences are shown in SEQ ID NO:2 in the sequence listing.

3. A primer set for amplifying the SNP sites related to cauliflower folate content as described in claim 1 or 2, comprising: Primer sets for amplifying the SNP1 site and primer sets for amplifying the SNP2 site; wherein: The primer set used to amplify the SNP1 site includes: First forward primer (SEQ ID NO:3): 5'-GAGAGGAGATTTGAAAGAAGCGAAG-3'; Second forward primer (SEQ ID NO:4): 5'-TAGAGAGGAGATTTGAAGAAGCGAAA-3'; First reverse primer (SEQ ID NO:5): 5'-TAAATGATAACGAAATTTCTAACACCTTCATTTC-3'; The primer set used to amplify the SNP2 site includes: Third forward primer (SEQ ID NO:6): 5'-GTCAGCTTCTCTGTGACACAAATATA-3'; Fourth forward primer (SEQ ID NO:7): 5'-GTCAGCTTCTCTGTGACACAAATATT-3'; Second reverse primer (SEQ ID NO:8): 5'-CGCTTTGTACTGCTTATATTACTTTCTAATTTG-3'.

4. The primer set according to claim 3, characterized in that: The 5' end of the first forward primer also carries a FAM adapter sequence, and the nucleotide sequence composition of the first forward primer with the FAM adapter sequence is shown in SEQ ID NO:9 in the sequence listing; The 5' end of the second forward primer also carries a HEX adapter sequence, and the nucleotide sequence composition of the second forward primer with the HEX adapter sequence is shown in SEQ ID NO:10 in the sequence listing; The 5' end of the third forward primer also carries a FAM adapter sequence, and the nucleotide sequence composition of the third forward primer with the FAM adapter sequence is shown in SEQ ID NO:11 in the sequence listing; The 5' end of the fourth forward primer may also carry a HEX adapter sequence, and the nucleotide sequence composition of the fourth forward primer with the HEX adapter sequence is shown in SEQ ID NO:12 in the sequence listing.

5. A primer set for assisting in the identification of cauliflower varieties with high folic acid content, said primer set comprising the primer set described in claim 3 or 4.

6. A kit for assisting in the identification of cauliflower varieties with high folic acid content, the kit comprising the primer set as described in claim 5.

7. The reagent kit according to claim 6, characterized in that: The kit also includes at least one of the following: PCR amplification buffer, dNTPs, enzymes, and DNA chromogenic dyes.

8. A method for assisting in the identification of cauliflower varieties with high folic acid content, the method comprising: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primer set described in claim 5, or the kit described in claim 6 or 7.

9. The method according to claim 8, characterized in that: The method includes detecting PCR amplification products to determine the genotypes of SNP1 and SNP2 sites in the sample to be tested: if the genotype of the SNP1 site is GG and the genotype of the SNP2 site is AA, then the sample to be tested is or is suspected to be a cauliflower variety with high folic acid content. Preferably, the PCR amplification reaction procedure is as follows: Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, followed by annealing at 61–55℃ for 60 s, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; denaturation at 94℃ for 20 s, followed by annealing at 55℃ for 60 s, and continued to expand to 26 cycles.

10. The SNP site related to cauliflower folate content as described in claim 1 or 2, the primer set for amplifying the SNP site related to cauliflower folate content as described in claim 3 or 4, the primer set for assisting in the identification of cauliflower varieties with high folate content as described in claim 5, the kit for assisting in the identification of cauliflower varieties with high folate content as described in claim 6 or 7, and the method for assisting in the identification of cauliflower varieties with high folate content as described in claim 8 or 9, and their application in assisting in the identification of cauliflower varieties with high folate content, or in the cultivation of cauliflower varieties with high folate content.