Single-domain antibodies targeting gprc5d and related materials and applications
Patent Information
- Application Number
- CN202610803584.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-08-21
- Estimated Expiration
- 2046-06-05
AI Technical Summary
但该技术在低己糖激酶-2表达肿瘤中敏感性不足,假阴性率高达11%–33%,且炎症摄取导致特异性降低
(1)本申请的单域抗体为首个针对GPRC5D的特异性单域抗体,具有高选择性、分子量小(约15 kDa)、生物安全性高、免疫原性低、肿瘤渗透性强及优良的药代动力学特性。单域抗体易于设计和修饰,适合作为多功能靶向材料,应用前景广阔。
Smart Images

Figure CN122325612B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of pharmaceutical technology, and in particular relates to single-domain antibodies targeting GPRC5D and their related materials and applications. Background Technology
[0002] Multiple myeloma (MM) is a malignant hematologic malignancy caused by the abnormal proliferation of monoclonal plasma cells, accounting for approximately 15%–20% of all hematopoietic system malignancies, with a 5-year survival rate of about 60%. Although BCMA (B-cell maturation antigen)-targeted immunotherapies (such as CAR-T, bispecific antibodies, and antibody-drug conjugates) have significantly improved the prognosis of MM patients, most patients still experience relapse and drug resistance. With increasing lines of treatment, diminishing returns, cumulative toxicities, and complex drug resistance mechanisms make it difficult for current treatments to maintain long-term remission. Therefore, exploring novel targets independent of BCMA has become an important direction for precision treatment of multiple myeloma.
[0003] G protein-coupled receptor class C group 5member D (GPRC5D) is a novel tumor-associated antigen identified in recent years. The GPRC5D gene is located on the short arm of human chromosome 12 (12p13) and encodes an orphan receptor with a seven-transmembrane structure. Its extracellular domain is short, and its antigenic epitope is close to the cell membrane, promoting the formation of tighter immune synapses between T cells and target cells, thereby enhancing cytotoxic effects. GPRC5D is less prone to antigen shedding, maintaining stable target accessibility. Unlike BCMA, GPRC5D is almost not expressed in normal immune cells, only present in limited quantities in keratinized tissues such as hair follicles, eccrine sweat glands, and lingual papillae, and is mainly highly expressed in myeloma plasma cells. This characteristic endows it with good tissue specificity and safety. Multiple studies have shown that high expression of GPRC5D is closely related to disease burden, elevated β2-microglobulin, ISS stage, and poor prognosis. It maintains high expression levels in BCMA-negative or relapsed patients, and can serve as an important alternative target for overcoming BCMA resistance. In addition, GPRC5D and BCMA have complementary expression patterns in CD138+ plasma cells, and combined targeting can address the heterogeneity and antigen escape of MM cells.
[0004] In summary, GPRC5D possesses advantages such as high tumor specificity, stable antigen expression, and a favorable safety margin, making it an important new target for immunotherapy of multiple myeloma. Single-domain antibodies, bispecific antibodies, and CAR-T cell therapies based on this target are rapidly developing and have shown promising efficacy in relapsed / refractory MM.
[0005] In the field of molecular imaging, positron emission tomography / computed tomography (PET / CT) has become an important molecular imaging technique for hematologic malignancies. 18F-deoxyglucose (18F-FDG) PET / CT is the standard imaging method recommended by the International Myeloma Working Group, providing information on metabolic activity and prognosis. However, this technique has insufficient sensitivity in tumors with low hexokinase-2 expression, with a false negative rate as high as 11%–33%, and its specificity is reduced due to inflammatory uptake. Furthermore, because FDG reflects glucose metabolism rather than myeloma-specific molecular characteristics, its guiding role in treatment decisions is limited.
[0006] In contrast, immunoPET combines the targeted recognition capabilities of antibodies with the high sensitivity of PET, representing a novel imaging modality capable of precisely identifying tumor-specific targets at the molecular level. It holds the potential to integrate molecular diagnosis, efficacy prediction, and treatment assessment in multiple myeloma. Nanobody antibodies, derived from the variable region of heavy chain antibodies, are minimal functional antigen-binding fragments with a molecular weight of approximately 15 kDa and a diameter of less than 4 nm. They possess excellent tissue penetration, affinity, and low immunogenicity, making them ideal for conjugation with short-lived radionuclides (such as 18F and 68Ga) for rapid imaging. Compared to whole-antibody imaging agents, nanobody antibodies exhibit faster in vivo distribution and clearance, significantly reducing background signal, improving tumor contrast, and enabling rapid imaging. Furthermore, their small molecular structure facilitates thermotherapy, allowing for both molecular imaging and precise treatment by combining with radionuclides or cytotoxic drugs.
[0007] Therefore, developing single-domain antibodies targeting GPRC5D can not only achieve highly specific molecular imaging detection of multiple myeloma, but also provide a new approach for its precise radiotherapy and efficacy monitoring, which has significant clinical and translational application value. Summary of the Invention
[0008] The technical problem this application aims to solve is: how to achieve sensitive and efficient detection and / or precise targeted therapy of GPRC5D. To solve this technical problem, this application provides the following technical solution.
[0009] This application provides a single-domain antibody or its antigen-binding fragment thereof, wherein the single-domain antibody or its antigen-binding fragment comprises three complementarity-determining regions named CDR1, CDR2 and CDR3, respectively; the amino acid sequences of CDR1, CDR2 and CDR3 include positions 31-35, 50-66 and 99-105 of SEQ ID NO:1, respectively.
[0010] In this application, the amino acid sequences of CDR1, CDR2 and CDR3 of the above-mentioned single-domain antibody or its antigen-binding fragment are positions 31-35, 50-66 and 99-105 of SEQ ID NO:1, respectively.
[0011] In some specific embodiments of this application, the amino acid sequences of the single-domain antibody or its antigen-binding fragment CDR1, CDR2 and CDR3 are positions 31-35, 50-66 and 99-105 of SEQ ID NO:1, respectively.
[0012] The single-domain antibody may also include four frame regions named FR1, FR2, FR3, and FR4, respectively. The FR1 may include at least one of the amino acid sequences shown in (A11) or (A12): (A11) The first to 30th bits of SEQ ID NO:1 (A12) and (A11) have an amino acid sequence that is more than 70% identical. The FR2 may include at least one of the amino acid sequences shown in (A21) or (A22): (A21) Positions 36 to 49 of SEQ ID NO:1 (A22) and (A21) have an amino acid sequence that is more than 70% identical; The FR3 may include at least one of the amino acid sequences shown in (A31) or (A32): (A31) Positions 67 to 98 of SEQ ID NO:1 (A32) and (A31) have an amino acid sequence that is more than 70% identical; The FR4 may include at least one of the amino acid sequences shown in (A41) or (A42): (A41) Positions 106 to 116 of SEQ ID NO:1 (A42) and (A41) have more than 70% identical amino acid sequences.
[0013] In this application, the amino acid sequence of FR1 may be at least one of (A11) or (A12) shown above.
[0014] In this application, the amino acid sequence of FR2 may be at least one of (A21) or (A22) shown above.
[0015] In this application, the amino acid sequence of FR3 may be at least one of (A31) or (A32) shown above.
[0016] In this application, the amino acid sequence of FR4 may be at least one of (A41) or (A42) shown above.
[0017] In one specific embodiment of this application, the amino acid sequences of FR1, FR2, FR3 and FR4 of the single-domain antibody or its antigen-binding fragment are positions 1 to 30, 36 to 49, 67 to 98 and 106 to 116 of SEQ ID NO:1, respectively.
[0018] In this application, the single-domain antibody comprises three CDRs and a "frame region" separated by the three CDRs. The frame region is used to align the CDRs that specifically bind to the antigen epitope. The CDRs include the amino acid residues in the antibody that are primarily responsible for antigen binding. The single-domain antibody includes the following frame regions (FRs) and CDR regions from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
[0019] In this application, the amino acid sequence of the single-domain antibody may include SEQ ID NO:1 or SEQ ID NO:3 or have at least 70% similarity to SEQ ID NO:1 or SEQ ID NO:3.
[0020] In this application, the amino acid sequence of the single-domain antibody may be SEQ ID NO:1.
[0021] In this application, the amino acid sequence of the single-domain antibody may also have at least 70% similarity to SEQ ID NO:1.
[0022] In this document, "70% or more consistency" or "at least 70% consistency" can specifically mean at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.
[0023] In this application, the single-domain antibody or its antigen-binding fragment may be a single-domain antibody or its antigen-binding fragment that binds to GPRC5D.
[0024] In this application, the binding may be a specific binding.
[0025] This application also provides an immunoconjugate comprising (I) and (II): (I) Antibody, wherein the antibody comprises the above-described single-domain antibody or its antigen-binding fragment; (II) Coupling part: The coupling part may be selected from radionuclides, drugs, toxins, nucleic acids, therapeutic isotopes or combinations thereof.
[0026] In one specific embodiment of this application, the antibody in the immunoconjugate is the aforementioned single-domain antibody or its antigen-binding fragment.
[0027] In this application, the radionuclides include, but are not limited to, the following (i) and / or (ii): (i) Diagnostic isotopes, wherein the diagnostic isotopes are selected from the group consisting of Ga-68 (i.e., Ga-68). 68 Ga), F-18, I-123, Ga-67, Cu-64, Zr-89, C-11, Re-188, or combinations thereof; and / or (ii) A therapeutic isotope selected from the group consisting of I-131, I-124, I-125, Lu-177, Tc-99m, In-111, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-165, Er-169, Fm-255, Au-198. Ho-166, Ir-192, Fe-59, Pb-212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra223, Ru-106, Na24, Sr89, Tb-149, Th-227, Xe-133, Yb-169, Yb-177, Lu-177, or combinations thereof.
[0028] In some embodiments of this application, the radionuclide is Ga-68.
[0029] In this application, "Ga-68" and " 68 "Ga" has the same meaning.
[0030] In this application, the radionuclide can be a detectable marker, or it can be replaced by fluorescein, enzyme, or colloidal gold.
[0031] This application also provides a probe molecule containing the above-described single-domain antibody or its antigen-binding fragment.
[0032] In this application, the probe molecule may be a radioactive probe.
[0033] In this application, the radioactive probe may include the single-domain antibody or its antigen-binding fragment and a radionuclide coupled to the single-domain antibody or its antigen-binding fragment.
[0034] In some embodiments of this application, the probe is 68Ga-NOTA-PFBC01 single-domain antibody-labeled probe.
[0035] This application also provides reagents or kits comprising the above-described single-domain antibodies or their antigen-binding fragments, immunoconjugates, and / or probe molecules.
[0036] In this application, the reagent or kit has at least one of the following uses: (B1) Recognizes or assists in recognizing the GPRC5D protein; (B2) Binds to or assists in binding to GPRC5D protein; (B3) Detection or auxiliary detection of whether the sample to be tested contains GPRC5D protein; (B4) Detection or auxiliary detection of GPRC5D protein content in the sample to be tested; (B5) Identify or assist in the identification of GPRC5D protein-positive diseases; (B6) Targets GPRC5D protein; (B7) Diagnosis of diseases related to GPRC5D protein.
[0037] In this application, the reagents or kits may also include a detection-acceptable carrier.
[0038] In this application, the chemically acceptable carrier may be a non-toxic, inert aqueous carrier medium.
[0039] In this application, the detection-acceptable carrier is one or more reagents selected from the group consisting of isotope tracers, contrast agents, flow cytometry reagents, cell immunofluorescence reagents, magnetic nanoparticles, and imaging agents.
[0040] In some specific embodiments of this application, the detection reagent may be a contrast agent. Furthermore, the contrast agent may also include other formulations used for contrast imaging.
[0041] In some specific embodiments of this application, the contrast agent is a contrast agent used for MRI (magnetic resonance imaging) or CT (computed tomography).
[0042] In some specific embodiments of this application, the imaging agent simultaneously chelates two or more signals, such as Ga-68 and Gd, for use in both PET / CT and MRI; or Tc-99m and a fluorescent agent, for use in both SPECT / CT and fluorescence detection.
[0043] In some specific embodiments of this application, the detection reagent can be used for in vivo detection.
[0044] In some specific embodiments of this application, the dosage form of the detection reagent is liquid or powder (such as aqueous solution, injection, lyophilized powder, tablet, lozenge, inhaler).
[0045] This application also provides polypeptides comprising the above-described single-domain antibody or its antigen-binding fragment.
[0046] In this application, the polypeptide may be the above-mentioned single-domain antibody or its antigen-binding fragment.
[0047] In some specific embodiments of this application, the polypeptide is a recombinant single-domain antibody with a 6×His tag. The amino acid sequence of the recombinant single-domain antibody is SEQ ID NO:3. In SEQ ID NO:3, positions 2 to 117 are the same as in SEQ ID NO:1.
[0048] This application also provides a pharmaceutical composition, which may include the above-described single-domain antibody or its antigen-binding fragment, the immunoconjugate, the probe molecule, and / or the polypeptide.
[0049] In this application, the pharmaceutical composition may also include a pharmaceutically acceptable carrier.
[0050] In this application, the pharmaceutical composition also contains other drugs for treating tumors.
[0051] This application also provides the use of the above-described single-domain antibody or its antigen-binding fragment, the immunoconjugate, the probe molecule, or the polypeptide in at least one of the following (C1) to (C7). (C1) Prepare detection reagents, detection kits, detection plates or developing agents for recognizing or assisting in the recognition of GPRC5D protein; (C2) Prepare detection reagents, detection kits, detection plates or contrast agents that bind to or assist in binding to GPRC5D protein; (C3) Prepare detection reagents, kits, plates or contrast agents for detecting or assisting in the detection of GPRC5D expression levels in cells; (C4) Prepare diagnostic reagents, test kits, test plates or contrast agents for the diagnosis or auxiliary diagnosis of GPRC5D positive diseases; (C5) Prepare diagnostic reagents, test kits, test plates or contrast agents for the diagnosis or auxiliary diagnosis of GPRC5D positive disease staging; (C6) Prepare detection reagents, test kits, test plates or contrast agents for monitoring or assisting in monitoring the treatment effect of GPRC5D positive diseases; (C7) Prepare a pharmaceutical composition for the treatment and / or prevention of GPRC5D positive diseases.
[0052] This application also provides the use of the above-described single-domain antibodies or their antigen-binding fragments, immunoconjugates, probe molecules, reagents or kits, peptides or / and pharmaceutical compositions in any of the following applications. (D1) Recognizes or assists in recognizing the GPRC5D protein; (D2) binds to or assists in the binding of GPRC5D protein; (D3) Detection or auxiliary detection of GPRC5D expression level in cells; (D4) Diagnosis or auxiliary diagnosis of GPRC5D positive disease; (D5) Diagnosis or auxiliary diagnosis of GPRC5D positive disease staging; (D6) Monitor or assist in monitoring the treatment effect of GPRC5D positive diseases; (D7) Treatment and / or prevention of GPRC5D positive disease.
[0053] The use of the aforementioned single-domain antibody or its antigen-binding fragment, or a composition including the aforementioned single-domain antibody or its antigen-binding fragment, as a imaging agent is also within the scope of protection of this application.
[0054] This application also provides the above-mentioned single-domain antibody or its antigen-binding fragment as a reagent for binding GPRC5D protein.
[0055] This application also provides a method for detecting GPRC5D protein, the method comprising the steps of detecting GPRC5D protein using the above-described single-domain antibody or its antigen-binding fragment, immunoconjugate, probe molecule, reagent or kit.
[0056] This application also provides a method for diagnosing GPRC5D positive disease, including the step of administering an effective dose of the above-mentioned immunoconjugate or probe molecule to a subject to diagnose GPRC5D positive disease.
[0057] This application also provides a method for staging or assisting staging of GPRC5D positive disease, including the step of administering an effective dose of the above-mentioned immunoconjugate or probe molecule to a subject for staging or assisting staging of GPRC5D positive disease.
[0058] The use of the aforementioned single-domain antibody or its antigen-binding fragment, or a composition including the aforementioned single-domain antibody or its antigen-binding fragment, as a drug is also within the scope of protection of this application.
[0059] In some specific embodiments of this application, the drug may be a drug for treating GPRC5D positive diseases or a drug for diagnosing GPRC5D positive diseases.
[0060] This application also provides the use of the above-mentioned single-domain antibody or its antigen-binding fragment, peptide, drug or pharmaceutical composition for the prevention and / or treatment of GPRC5D positive diseases.
[0061] This application also provides a method for treating or / and preventing GPRC5D positive disease, the method comprising administering to a subject an effective dose of the above-described single-domain antibody or its antigen-binding fragment, peptide, drug, or drug composition to treat or / and prevent GPRC5D positive disease.
[0062] In this application, the subject is GPRC5D positive.
[0063] The drug or drug composition may also contain an agent capable of killing tumor cells.
[0064] In this application, the preparation capable of killing tumor cells is at least one of the following: chemical drugs, biological drugs, nanomedicines, radiopharmaceuticals, photothermal therapy or photodynamic therapy drugs capable of killing tumor cells; or, at least one of the following: alkylating agents, antimetabolites, antitumor natural drugs, antitumor antibiotics, hormones, metal complexes or tumor radiotargeting markers.
[0065] In this application, the application, use, or method may be for the purpose of diagnosing and treating diseases.
[0066] In this application, the application, use or method may not be for the purpose of diagnosing and treating diseases, but its direct purpose is only to obtain intermediate results.
[0067] This application also provides biological materials, which may be any of the following: (E1) A nucleic acid molecule that encodes the above-mentioned single-domain antibody or its antigen-binding fragment. (E2) An expression cassette containing the nucleic acid molecule described in (E1), (E3) A recombinant vector containing the nucleic acid molecule described in (E1) and / or the expression cassette described in (E2). (E4) Recombinant cells containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) and / or the recombinant vector described in (E3).
[0068] In the above-mentioned biological materials, the nucleic acid molecule (E1) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0069] In this application, the nucleic acid described in (E1) is divided into RNA that can be a DNA molecule or transcribed from a DNA molecule as described in (F1) or (F2) below: (F1) The nucleotide sequence of the coding strand is the DNA molecule shown in SEQ ID NO: 2; (F2) has more than 70% similarity to (F1) and encodes the DNA molecule of the above-mentioned single-domain antibody or its antigen-binding fragment.
[0070] In this application, the expression cassette (E2) refers to DNA capable of expressing the single-domain antibody or its antigen-binding fragment in a host cell. This DNA may include not only a promoter that initiates transcription of the gene encoding the single-domain antibody or its antigen-binding fragment, but also a terminator that terminates transcription of the gene encoding the single-domain antibody or its antigen-binding fragment.
[0071] In this application, the vector may be a plasmid, a granule, a bacteriophage, or a viral vector.
[0072] In some embodiments of this application, the recombinant vector may be a recombinant vector obtained by introducing the nucleic acid molecule (E1) into pET21b(+). Specifically, the structure of the recombinant vector may be such that the fragment between the NdeI and XhoI recognition sites of the pET21b(+) restriction endonuclease is replaced by a DNA molecule with the nucleotide sequence shown in SEQ ID NO:2, while keeping the other nucleotide sequences of pET21b(+) unchanged.
[0073] In this application, the microorganism may be bacteria (such as Escherichia coli), yeast, algae, or fungi.
[0074] In this application, the bacteria may be Escherichia coli.
[0075] In the above-mentioned biological materials, the cells described in (E4) can be either prokaryotic cells or eukaryotic cells.
[0076] In the above-mentioned biological materials, the cells may be derived from animals, plants or microorganisms.
[0077] In some specific embodiments of this application, the cells derived from animals may be isolated animal cells. In one specific embodiment of this application, the isolated animal cells include, but are not limited to: ExpiCHO-S™ cells, Chinese hamster ovary cells (CHO), 293F cells, 293E cells, 293-6E cells, etc.
[0078] In some embodiments of this application, the recombinant cells are recombinant Escherichia coli cells.
[0079] This application also provides a method for preparing the above-mentioned single-domain antibody or its antigen-binding fragment, the method including the step of expressing the coding gene of the above-mentioned single-domain antibody or its antigen-binding fragment in cells to obtain the single-domain antibody or its antigen-binding fragment.
[0080] In the above method, the cells can be isolated cells or non-human animal cells.
[0081] In some embodiments of this application, the cells are recombinant Escherichia coli cells.
[0082] The single-domain antibody provided in this application possesses high affinity and can be used to detect GPRC5D expression levels, diagnose GPRC5D-related tumors, predict treatment efficacy, and conduct targeted therapy. In particular, the GPRC5D-specific molecular imaging probe prepared from this single-domain antibody significantly improves affinity, reduces non-specific uptake by normal tissues, and enhances imaging quality, thereby achieving non-invasive, accurate, and efficient detection of human GPRC5D expression, suitable for the diagnosis and efficacy prediction of GPRC5D-related tumors. After conjugation with an appropriate radionuclide, this probe can also be used for the precision treatment of GPRC5D-related tumors.
[0083] Compared with the prior art, this application has the following advantages: (1) The single-domain antibody of this application is the first specific single-domain antibody against GPRC5D, which has high selectivity, small molecular weight (about 15 kDa), high biosafety, low immunogenicity, strong tumor penetration and excellent pharmacokinetic properties. Single-domain antibodies are easy to design and modify, and are suitable as multifunctional targeting materials with broad application prospects.
[0084] (2) The single-domain antibody of this application can be combined with imaging agents for clinical translation, and can be used as a molecular probe to detect the expression of GPRC5D in tumor cells in real time, monitor the efficacy of immunotherapy, and can be used for prediction and companion diagnosis of GPRC5D immunotherapy. In addition, as a homing peptide, it can be combined with anticancer drugs to form single-domain antibody-drug conjugates for targeted and combination therapy of various tumors; (3) The single-domain antibody of this application can be developed into a targeted imaging agent, immunotherapy drug (vaccine) or single-domain antibody-drug conjugate for multiple myeloma by binding with radionuclides, anticancer agents or contrast agents, and can be used for early diagnosis, immune monitoring and targeted therapy of tumors. Attached Figure Description
[0085] Figure 1 Electrophoresis images of the first round of PCR amplification of the VHH gene from the common antibody heavy chain and the heavy chain antibody.
[0086] Figure 2 This is an SDS-PAGE electrophoresis image of the GPRC5D phage PCR amplification product.
[0087] Figure 3 The image shows the SDS-PAGE electrophoresis result of the recombinant single-domain antibody PFGC00S obtained from the supernatant collected by centrifugation.
[0088] Figure 4The recombinant single-domain antibody PFGC00SDS in this application was obtained by separation using Ni+ ion affinity chromatography magnetic beads. PAGE electrophoresis image.
[0089] Figure 5 This is a binding activity curve of the recombinant single-domain antibody PFGC00 in this application.
[0090] Figure 6 To compare the affinity of the recombinant single-domain antibody PFGC00 for H929 cells and other hematologic malignancies using flow cytometry; PE represents control cells with only PE-NHS added and no antibody incubation, and CK represents control cells without any antibody incubation.
[0091] Figure 7 This is the BLI result for the recombinant single-domain antibody PFGC00 in this application.
[0092] Figure 8 In H929 tumor-bearing mice, the single-domain antibody probe of this application was injected. 68 Maximum intensity projection (MIP) images of PET / CT taken 1 to 2 hours after Ga-NOTA-PFGC00.
[0093] Figure 9 In H929 tumor-bearing mice, the single-domain antibody probe of this application was injected. 68 ROI uptake value and tumor to non-tumor ratio 1 to 2 hours after Ga-NOTA-PFGC00; Figure 9 In the table, 'a' represents the ROI uptake value, and 'b' represents the ratio of tumor to non-tumor cells.
[0094] Figure 10 In H929 tumor-bearing mice, the single-domain antibody probe of this application was injected. 68 PET / CT maximum intensity projection (MIP) images and ROI uptake values of Ga-NOTA-PFGC00 and the blocking group at 1 hour; Figure 10 In the image, a is the PET / CT maximum intensity projection (MIP) map, and b is the ROI uptake value.
[0095] Figure 11 In GPRC5D-positive H929 and GPRC5D-negative K562 tumor-bearing mice, the single-domain antibody probe of this application was injected. 68 Ga-NOTA-PFGC00 PET / CT maximum intensity projection (MIP) map and ROI uptake value at 1 hour; Figure 11 In the image, a is the PET / CT maximum intensity projection (MIP) map, and b is the ROI uptake value.
[0096] Figure 12 H929 tumor-bearing mice and K562 negative control mice were injected with the single-domain antibody probe of this application. 68Biological distribution map of radioactive uptake in tumors and various organs after 1 hour of Ga-NOTA-PFGC00.
[0097] Figure 13 This application contains the amino acid sequence of the single-domain antibody PFGC00, the encoding gene, the corresponding amino acid sequence of the recombinant single-domain antibody PFGC00, and the CDR sequence of the single-domain antibody PFGC00. Detailed Implementation
[0098] I. Terms used in this application: Unless otherwise defined, the technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art. Generally, terms relating to cell and tissue culture, molecular biology, immunology, microbiology, genetics, transgenic cell production, protein chemistry and nucleic acid chemistry, and hybridization techniques described herein are well-known in the art and commonly used in the field. The methods and techniques provided herein are generally performed in accordance with standard practice.
[0099] Unless otherwise stated, methods known in the art and as described in the various general and more specific references cited and discussed herein.
[0100] Any references cited in this article, including, for example, all patents, published patent applications and non-patent publications, are incorporated in their entirety by reference.
[0101] For ease of understanding of this disclosure, several terms and abbreviations used herein are defined as follows: In this application, "identity" refers to the similarity of amino acid or nucleotide sequences. The similarity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the similarity of a pair of amino acid sequences, the similarity value (%) can be obtained.
[0102] Specifically, the consistency of 70% or more can be 75% or more. Specifically, the consistency of 75% or more can be 80% or more. Specifically, the consistency of 80% or more can be 85% or more. Specifically, the consistency of 85% or more can be 90% or more. Specifically, the consistency of 90% or more can be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more. More specifically, the consistency of 70% or more can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% consistency.
[0103] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.
[0104] The term "single-domain antibody" refers to a variable domain antibody (VHH), which is a protein composed of the variable domain of the antibody heavy chain.
[0105] The terms "single-domain antibody," "nanobody," "VHH," or "sdAb" all have the same meaning: a single-antigen-binding polypeptide with three complementarity-determining regions (CDRs). A basic single-domain antibody has the following structure from the N-terminus to the C-terminus: FR1 CDR1FR2 CDR2 FR3 CDR3 FR4, where FR1 to FR4 refer to framework regions 1 to 4, and CDR1 to CDR3 refer to complementarity-determining regions 1 to 3.
[0106] The complementarity-determining region (CDR) is the antigen-binding site in an antibody. CDRs can be defined using various terms: (i) a complementarity-determining region (CDR) based on sequence variability; and (ii) a "hypervariant region," "HVR," or "HV" refers to a region of the antibody's variable domain that is structurally highly variable, as defined by Chothia and Lesk. The international ImMunoGeneTics (IMGT) database (http: / / www_imgt_org) provides standardized numbering and definitions of antigen-binding sites. As used herein, the terms "CDR," "CDR1," "CDR2," and "CDR3" include CDRs defined by any of the methods described above, Kabat, Chothia, or IMGT, unless otherwise explicitly stated in the specification. Frame regions (FWs) are adjacent to and located between CDRs.
[0107] As used herein, the term "fragment" refers to a polypeptide that substantially retains the same biological function or activity as the antibody of this application. The polypeptide fragment of this application may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) a polypeptide having substituent groups in one or more amino acid residues; or (iii) a polypeptide formed by fusing a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, e.g., polyethylene glycol); or (iv) a polypeptide formed by fusing an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretion sequence, or a sequence used to purify this polypeptide, or a proteogenic sequence, or a fusion protein formed with a 6×His tag).
[0108] As used herein, the terms “specific binding,” “specific recognition,” or “specific to” refer to measurable and reproducible interactions, such as the binding between a target and a single-domain antibody, which determines the presence of the target in the presence of a heterogeneous population of molecules, including biomolecules.
[0109] The term "specificity" refers to the selective recognition of a specific epitope of an antigen by a single-domain antibody.
[0110] The specific binding refers to the affinity of one molecule for binding to another molecule that is significantly higher than its affinity for binding to any cross-reactive antigen or off-target antigen (collectively referred to as non-target antigen). This affinity is determined using experimental techniques such as surface plasmon resonance (SPR), fluorescence activated cell sorting (FACS) analysis, kinetic exclusion assay (KinExA), isothermal titration calorimetry (ITC), radioimmunoassay (RIA), and enzyme-linked immunosorbent assay (ELISA).
[0111] The term "antigen-binding fragment" refers to an antigen-binding fragment comprising the single-domain antibody described in this application, which typically includes at least a portion of the antigen-binding region or variable region (e.g., one or more CDRs) of the parent antibody. The antigen-binding fragment retains at least some of the binding specificity of the parent antibody. Typically, when activity is expressed on a molar basis, the antigen-binding fragment retains at least 10% of the parent antibody's binding activity. Specifically, the antigen-binding fragment retains at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% or more of the parent antibody's binding affinity to the target.
[0112] In this application, "antigen-binding fragment" encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intracellular antibodies, peptide antibodies, chimeric antibodies, fully human antibodies, humanized antibodies, heteroconjugated antibodies, multispecific antibodies (e.g., bispecific, trispecific, and tetraspecific antibodies), recombinant single-domain antibodies, bivalent antibodies, multivalent antibodies, Fab, Fab' fragments, F(ab')2 fragments, minimum recognition unit (MRU), Fv antibodies, single-chain antibodies, or heavy-chain antibodies.
[0113] Unless otherwise stated, “antigen-binding fragment” also includes full-length or complete antibodies, including antibodies of any class or subclass, including IgG and its subclasses, IgM, IgE, IgA and IgD.
[0114] The terms "bivalent single-domain antibody" or "multivalent single-domain antibody" refer to a fusion polypeptide formed by linking two or more said single-domain antibodies. The single-domain antibodies in a "bivalent single-domain antibody" or "multivalent single-domain antibody" are formed by covalent or non-covalent linking of linker molecules, or by non-covalent linking of the antibody with a polymer.
[0115] The term "multispecific single-domain antibody" refers to an antibody with multispecificity formed by linking the single-domain antibody with other antigen-specific antigen-binding fragments.
[0116] The term "multispecific" means that an antigen-binding protein (the antigen-binding fragment of the single-domain antibody) has two or more different antigen-binding specificities.
[0117] The term "Fab" stands for antigen-binding fragment, which consists of a complete antibody light chain and the VH (variable region of the heavy chain) and CH1 (constant region 1) domains of the heavy chain. In other words, it is a heterodimer formed by the antibody's heavy chain Fd and the complete light chain linked by disulfide bonds.
[0118] The term "Fab' fragment" contains a portion of a complete antibody light chain and an antibody heavy chain containing the VH domain, the CH1 domain, and the region between the CH1 and CH2 domains. This allows interchain disulfide bonds to form between the two heavy chains of two Fab' fragments to form the F(ab')2 molecule.
[0119] The term "F(ab')2 segment" consists of two Fab' segments held together by disulfide bonds between two heavy chains.
[0120] The term "minimum recognition unit (MRU)" refers to a single CDR structure containing only the variable region, with a molecular weight of only about 1% of that of a complete antibody, which can bind to the corresponding antigen.
[0121] The term "Fv antibody" refers to a protein composed solely of the heavy chain variable region and the light chain variable region of the antibody. The heavy chain variable region and the light chain variable region are linked by non-covalent bonds.
[0122] The term "single-chain antibody" (ScFv) refers to a protein composed of short peptides that link the heavy chain variable region and the light chain variable region of an antibody.
[0123] The term "biomaterial" refers to any material that carries genetic information and is capable of self-replication or replication within a biological system, such as genes, plasmids, microorganisms, animals, and plants.
[0124] The term “protein” or “peptide” as used herein encompasses all kinds of naturally occurring and synthetic proteins, including protein fragments of all lengths, fusion proteins, and modified proteins, including but not limited to glycoproteins and all other types of modified proteins (e.g., proteins produced by phosphorylation, acetylation, myristylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, PEGylation, biotinylation, etc.).
[0125] Unless otherwise stated, the terms “nucleic acid,” “nucleotide,” and “polynucleotide” cover both DNA and RNA.
[0126] As used herein, the term "expression cassette" refers to DNA capable of expressing the antibody or its antigen-binding fragment in a host cell. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all regulatory sequences necessary for expressing the nucleic acid molecule containing the antibody or its antigen-binding fragment. The regulatory sequences, under compatible conditions, direct the expression of the coding sequence in a suitable host cell. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequence to the coding region of the nucleic acid sequence encoding the protein, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively attached to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this application. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively attached to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this application. The regulatory sequence can also be a signal peptide coding region encoding an amino acid sequence attached to the amino terminus of the antibody or its antigen-binding fragment, capable of guiding the antibody or its antigen-binding fragment into the cellular secretory pathway. Signal peptide coding regions that can guide the expressed antibody or its antigen-binding fragment into the secretory pathway of the host cell can be used in this application. Adding a regulatory sequence that can regulate the expression of the antibody or its antigen-binding fragment according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are systems that can respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby opening or closing gene expression. Other examples of regulatory sequences are those that enable gene amplification. In these cases, the nucleic acid sequence encoding the antibody or its antigen-binding fragment should be operatively linked to the regulatory sequence. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SDs), transcription factor binding sites (TFBSs), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences.The components in the expression box can be directly connected or indirectly connected through connectors.
[0127] In this application, the recombinant vector can be a cloning vector or an expression vector. When preparing the expression vector, the nucleic acid molecule encoding the aforementioned protein can be located within the vector so that it can be operatively linked to an appropriate expression regulatory sequence. The recombinant expression vector can be any vector (e.g., plasmid or virus) that facilitates recombinant DNA manipulation and expression of nucleic acid sequences. The choice of vector generally depends on the compatibility of the vector with the host cell into which it will be introduced. The vector can be a linear or closed circular plasmid. The vector can be a self-replicating vector (i.e., a complete structure existing outside the chromosome that can replicate independently of the chromosome), such as plasmids, extrachromosomal elements, microchromosomes, or artificial chromosomes. The vector can contain any mechanism that ensures self-replication. Alternatively, the vector is a vector that, when introduced into a host cell, integrates into the chromosome and replicates along with the integrated chromosome. The vector contains one or more selection markers that facilitate the selection of transformed cells. A selection marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or confers protrophic phenotypes, etc. Examples of bacterial selection markers include the dal gene of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. The vector contains elements that enable stable integration into the host cell genome or ensure autonomous replication of the vector independently of the cell genome. In the case of autonomous replication, the vector may also contain an origin of replication, enabling autonomous replication in the target host cell. The origin of replication may carry a mutation that makes it temperature-sensitive in the host cell. The yield of the gene product can be increased by inserting more than one copy of the nucleic acid molecule encoding the aforementioned protein into the host cell. This copy number increase can be achieved by inserting at least one additional copy of the nucleic acid molecule into the host cell genome, or by inserting an amplifiable selection marker along with the nucleic acid molecule, and by culturing cells in the presence of a suitable selection reagent to select cells containing the amplified copy of the selective marker gene, thereby containing the additional copy of the nucleic acid molecule. The operations used to connect the above elements to construct the recombinant expression vector described in this application are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning Laboratory Manual, 2nd edition, 1989).
[0128] The term "microorganism" typically includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasma, chlamydia, spirochetes, algae, etc. For example, the bacteria mentioned can originate from the genera *Corynebacterium* (e.g., *Corynebacterium glutamicum*, *Corynebacterium pekinensis*, *Corynebacterium obliterans*, etc.), *Brevibacterium* (e.g., *Brevibacterium lactis*, *Brevibacterium flavum*, *Brevibacterium phagenum*, etc.), *Escherichia* (e.g., *Escherichia coli*), *Erwinia*, *Agrobacterium* (e.g., *Agrobacterium tumefaciens*), *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus* (e.g., *Bacillus*). The viruses may include rotaviruses, baculoviruses, retroviruses (such as lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, influenza viruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus). The fungi may originate from genera such as *Saccharomyces p.* (e.g., *Saccharomyces cerevisiae*, *Candida albicans*, *Methanolaxyl*, *Pichia pastoris*), *Fusarium* sp., *Rhizoctonia* sp., *Verticillium* sp., *Penicillium* sp., *Aspergillus* sp., and *Cephalosporium* sp. The actinomycetes may originate from genera such as *Streptomyces* sp. (e.g., *Streptomyces*). The algae mentioned can come from the phylum Cyanophyta (such as cyanobacteria), the genera Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., and Boekelovia sp., etc.
[0129] In this application, the animal cells are non-reproductive materials. In some embodiments, the animal cells are ex vivo animal cells. In some embodiments, the animal cells are mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), Chinese hamster ovary cell subline (CHO-K1 cells), African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), young hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells, or NK cells, etc.), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., African clawed frog (Xenopus laevis) cells or giant salamander (Andrias davidianus) cells), fish cells (e.g., grass carp, carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells, Sf-9 cells, or Hi-5 cells), etc., but not limited to these. In some embodiments, the mammals include humans or mice. In some embodiments, the mammalian cells may not include animal germ cells, animal fertilized eggs, and animal embryonic stem cells, but may be somatic cells or cell lines. In some embodiments, the animal cells are mouse cell lines or somatic cells. In some embodiments, the animal cells of C13 include, but are not limited to: mouse hybridoma cells, ExpiCHO-S™ cells, Chinese hamster ovary cells (CHO), 293F cells, 293E cells, 293-6E cells, etc.
[0130] The host cell can be a prokaryotic cell, such as a bacterial cell, more specifically, such as an Escherichia coli cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces spp.; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; and animal cells of CHO, COS7, and 293.
[0131] The nucleic acid sequence encoding the single-domain antibody disclosed herein can be introduced into cells via “transfection,” “transformation,” or “transduction.” As used herein, “transfection,” “transformation,” or “transduction” refers to the introduction of one or more exogenous polynucleotides into a host cell using physical or chemical methods.
[0132] The term "transformation" refers to the introduction of one or more exogenous polynucleotides into bacterial cells that are already capable of transformation, for example, by using dimethyl sulfoxide, divalent cations (such as calcium), or polyethylene glycol. Many transformation techniques are known in the art and include heat shock and electroshock.
[0133] The term "expression" refers to the permission or inducing of the production of information from a gene or DNA sequence. For example, expression can take the form of producing a protein by activating cellular functions involved in the transcription and translation of the corresponding gene or DNA sequence. A DNA sequence is expressed in or through cells to form an "expression product" such as a protein. The expression product itself, such as the resulting protein, can also be referred to as being "expressed" by the cell. Expression products can be characterized as intracellular, extracellular, or transmembrane.
[0134] Single-domain antibodies can be prepared using recombinant methods. This typically involves cloning the single-domain antibody gene into a vector, transforming it into cells, and then isolating the relevant sequence from the proliferated host cells using conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in this application include biomolecules existing in isolated forms.
[0135] Currently, the DNA sequence encoding the protein (or a fragment thereof, or a derivative thereof) of this application can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. Furthermore, mutations can be introduced into the protein sequence of this application through chemical synthesis.
[0136] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0137] The single-domain antibodies or peptides described in this application may be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant proteins can be separated and purified using various separation methods utilizing their physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques, as well as combinations of these methods.
[0138] The terms “tumor” and “cancer” are used interchangeably in this article, including solid tumors and liquid tumors.
[0139] The terms “cancer” and “cancerous” refer to physiological diseases in mammals where cell growth is uncontrolled.
[0140] The term "tumor" refers to the growth and proliferation of all proliferative cells (whether malignant or benign) as well as all precancerous and cancerous cells and tissues. When used in this article, the terms "cancer," "cancerous," and "tumor" are not mutually exclusive.
[0141] As used herein, the term "label" refers to a compound or composition that is directly or indirectly conjugated or fused to a reagent (e.g., a single-domain antibody) and facilitates the detection of the reagent conjugated or fused thereto. The label itself may be detectable (e.g., radioisotope labeling or fluorescent labeling), or, in the case of enzyme labeling, the label may catalyze a chemical change in the substrate compound or composition to make it detectable. This term is intended to cover both direct labeling of probes or antibodies by conjugating (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of probes or antibodies by reacting with another directly labeled reagent. Examples of indirect labeling include using a fluorescently labeled secondary antibody to detect a primary antibody, and using biotin to end-label a DNA probe so that it can be detected using a fluorescently labeled streptavidin.
[0142] The term “treat” or “treatment” refers to therapeutic treatment in which the aim is to slow or alleviate undesirable physiological changes or disease, or to provide a beneficial or desired clinical outcome during treatment. Beneficial or desired clinical outcomes include symptom relief, reduction in disease severity, stabilization of the disease state (i.e., cessation of worsening), delay or slowing of disease progression, improvement or mitigation of the disease state, and / or remission (whether partial or complete, and whether detectable or undetectable). “Treatment” can also mean prolonged survival compared to the expected survival of a subject without treatment. Subjects requiring treatment include those who already have undesirable physiological changes or disease, and those who are predisposed to developing such changes or disease. Treatment may involve therapeutic agents, also referred to herein as “medicaments” or “medication,” which may be designed to help achieve the beneficial or desired clinical outcome of interest through their action. Therapeutic agents or medications can be administered to subjects via many routes, including at least intravenous and oral routes. The term “intravenous” in relation to the administration of a therapeutic agent or medication means administration of said therapeutic agent or medication into one or more veins. The term “oral” in relation to the administration of a therapeutic agent or drug means that the therapeutic agent or drug is administered via the oral cavity, such as through the mouth.
[0143] In this application, "subject" includes a person who is being treated or prevented as a patient. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, rodents such as mice and hamsters, and lagomorphs such as rabbits. Mammals can be carnivores, including felines (cats) and canines (dogs). Mammals can be artiodactyla, including bovines (cows) and suidae (pigs), or perissodactyla, including equines (horses). Mammals can be primates, ceboids, or simoids (monkeys) or hominids.
[0144] The term "effective" when applied to dosage or amount refers to an amount of compound or pharmaceutical composition sufficient to produce the desired activity when administered to a subject in need. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amount of each ingredient that would be effective if administered alone. The exact amount required will vary depending on the subject, including their species, age and general condition, the severity of the condition being treated, one or more specific medications being used, the mode of administration, etc.
[0145] In this application, the term "GPRC5D positive disease" refers to a disease accompanied by a significant increase in GPRC5D expression levels, which can be identified using GPRC5D as a biomarker. Existing research has found that GPRC5D positivity is usually closely associated with multiple myeloma (MM). It should be clarified that "GPRC5D positive disease" also includes other diseases that may be discovered in the future that are associated with GPRC5D positivity (significantly elevated expression levels).
[0146] The phrase “pharmaceutically acceptable” used in conjunction with the compositions described herein refers to the molecular entities and other components of such compositions that are physiologically tolerable and typically do not produce adverse effects when administered to mammals (e.g., humans). Preferably, the term “pharmaceutically acceptable” means listed in recognized pharmacopoeias for use in mammals, and more particularly for use in humans.
[0147] For example, the term "pharmaceutically acceptable carrier" includes, but is not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric-coated carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). These materials can be used to formulate various dosage forms, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, lyophilized powder injections, etc. These can be conventional formulations, sustained-release formulations, controlled-release formulations, and various microparticle delivery systems. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into tablets. Examples of carriers include diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, and aluminum silicate; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, and polyvinylpyrrolidone; and disintegrants. Examples of carriers include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium dodecyl sulfate, methylcellulose, and ethylcellulose; disintegration inhibitors include sucrose, tristearate, cocoa butter, and hydrogenated oil; absorption enhancers include quaternary ammonium salts and sodium dodecyl sulfate; and lubricants include talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into pills. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfonate, methylcellulose, and ethylcellulose. For preparing unit-dose dosage forms into suppositories, a wide variety of carriers known in the art can be used. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, and semi-synthetic glycerides. For preparing unit-dose dosage forms into injectable formulations such as solutions, emulsions, lyophilized powders for injection, and suspensions, all diluents commonly used in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, and polyoxyethylene sorbitan fatty acid esters.In addition, to prepare isotonic injection solutions, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injectable formulation. Furthermore, conventional solubilizers, buffers, pH adjusters, etc., can also be added. Additionally, if necessary, colorants, preservatives, flavorings, tasters, sweeteners, or other materials can be added to the pharmaceutical formulation.
[0148] II. Implementation Examples This application uses the GPRC5D protein as the targeting group of a radiopharmaceutical to explore... 68 The diagnostic efficacy of the Ga-GPRC5D probe in multiple myeloma aims to provide new methods and means for early diagnosis, accurate staging, recurrence assessment, treatment decisions, and prognosis of multiple myeloma, and to provide a scientific basis for precision treatment of related diseases.
[0149] This application constructed a single-domain antibody library specific to the anti-GPRC5D antigen based on alpaca immunization, RNA extraction, polymerase chain reaction (PCR), ligation and transformation, and initially obtained a series of anti-GPRC5D single-domain antibodies through plasmid expression, antibody expression and purification. Subsequently, high-affinity single-domain antibodies against GPRC5D were screened using enzyme-linked immunosorbent assay (ELISA).
[0150] After extensive experimental verification and screening, the single-domain antibody PFGC00 targeting GPRC5D, as described in this application, was finally obtained. This single-domain antibody can specifically bind to the GPRC5D protein and selectively bind to tumor cells that highly express GPRC5D. This application also provides products derived from this single-domain antibody that can specifically bind to GPRC5D, as well as the uses of the single-domain antibody and its derivatives in tumor treatment, diagnosis, and imaging.
[0151] The purified recombinant single-domain antibody PFGC00 (1 mg / mL) was reacted with a chelating agent (PE-NHS or Nota-NHS-ester) at a molar ratio of 1:5-1:10 in carbonate buffer at pH 9.2 for 2 hours (25°C). Subsequently, the free chelating agent was removed using a PD-10 desalting chromatography column, and the PE or Nota-labeled recombinant single-domain antibody PFGC00 was collected, aliquoted, and stored at 4°C. In the specific embodiments of this application, the molar ratio of recombinant single-domain antibody PFGC00 to the chelating agent was 1:10.
[0152] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.
[0153] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0154] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0155] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is used. *, **, ***, and **** represent p<0.05 (significant), p<0.01 (very significant), p<0.001 (extremely significant), and p<0.0001 (highly significant), respectively.
[0156] Example 1. Construction of a single-domain antibody library specific to the anti-GPRC5D antigen 1. Immunizing alpacas with GPRC5D antigen Select healthy adult alpacas and inject GPRC5D antigen (KaiKa Biotechnology, GPR-HM05P; Recombinant Human GPRC5D Protein (ECD, hFc Tag)) at multiple subcutaneous sites on the neck and back, with a total dose of 2 mg. Add an equal volume of Freund's adjuvant to the antigen and immunize 5 times, with an interval of 14 days between immunizations. After the third immunization, collect serum and determine the antigen immunotiter using ELISA. When the titer reaches 10,000 times or more, collect 50 mL of whole blood, separate PBMC cells, add Trizol (RNA extraction reagent), mix thoroughly, and store at -80℃ for later use.
[0157] 2. RNA extraction Take 1 mL of isolated PBMC cells, add 0.2 mL of chloroform, and vortex to mix. Add 200 μL of chloroform, vortex for 15 s, and incubate at room temperature for 3 min; centrifuge at 12000 rpm at 4℃ for 15 min; carefully remove the centrifuge tube, aspirate the supernatant to a new 1.5 mL EP tube, add an equal volume of isopropanol, invert thoroughly to mix, and incubate at room temperature for 10 min; centrifuge at 12000 rpm at 4℃ for 10 min; carefully discard the supernatant with a pipette tip, add 75% ethanol along the tube wall, and carefully blow up the precipitate (or gently scoop the bottom of the tube by hand); centrifuge at 7500 rpm at 4℃ for 5 min; carefully discard the supernatant, centrifuge for another 1 min, and aspirate the supernatant; open the cap and incubate at room temperature for 10 to 15 min until the ethanol has completely evaporated; add 30 μL of RNase-free water to dissolve the RNA. The extracted RNA is easily degraded and needs to be reverse transcribed into cDNA promptly.
[0158] 3. Obtain the VHH gene fragment (single-domain antibody gene) of the variable region of the Anti-GPRC5D heavy chain antibody. Following the instructions of the cDNA synthesis kit (PrimeScript™ II 1st Strand cDNA Synthesis Kit, catalog number 6210A, TAKARA), the extracted RNA was reverse transcribed into cDNA. The following reaction mixture was prepared in a centrifuge tube: 1 μL Random 6 mers (50 μM), 1 μL dNTP Mixture (10 mM each), template RNA: less than 5 μg, and RNase-free ddH2O to a total volume of 10 μL. The mixture was incubated at 65°C for 5 min and then rapidly cooled on ice. The following reverse transcription reaction mixture was prepared in the same centrifuge tube, with a total volume of 20 μL: 10 μL of the denaturing reaction mixture, 4 μL of 5×PrimeScript II Buffer, 0.5 μL of RNase Inhibitor (40 U / μL), 1 μL of PrimeScript II RTase (200 U / μL), and RNase-free dH2O added to a total volume of 20 μL. The reverse transcription reaction was carried out under the following conditions: 30℃ for 10 min, 42℃ for 30 to 60 min, 95℃ for 5 min, and then cooled on ice.
[0159] Using cDNA as a template, two sets of primers were used to amplify the heavy chain VHH gene fragment by PCR. In the first PCR amplification, the fragment larger than 750 bp was a normal heavy chain gene fragment, while the fragment between 750 and 500 bp was a single-domain antibody gene fragment. The heavy chain antibody VHH gene fragment (single-domain antibody gene) was recovered by gel excision and amplified by PCR using VHH-specific primers to obtain the VHH target gene (up to 500 bp).
[0160] Table 1 PCR primer sequences
[0161] Note: In primer YT1BN, nucleotide symbols and definitions follow the ST.26 standard. S represents C or G, M represents A or C, K represents G or T; R represents A or G.
[0162] The first round of PCR was divided into two groups: the upstream primer for the common antibody heavy chain gene was YT-1, and the downstream primer was YT1BN; the upstream primer for the VHH gene was YT-2, and the downstream primer was YT1BN; the concentration of each primer was 10 pmol. The PCR amplification reaction system consisted of: 5 μL 10×PCR buffer, 5 μL dNTPs, 1.5 μL upstream primer, 1.5 μL downstream primer, 3.5 μL template (cDNA), 0.5 μL Blend Taq enzyme, and 33 μL ddH2O. The PCR conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 25 cycles; and 4℃ for 10 min.
[0163] The second-round PCR used YTV8 and YTV9 primers, with each primer concentration of 10 pmol. The second-round PCR amplification system consisted of: 5 μL 10×PCR buffer, 5 μL dNTPs, 1.5 μL upstream primer (YTV8), 1.5 μL downstream primer (YTV9), 3.5 μL template (recovered from the first round), 0.5 μL Blend Taq enzyme, and 33 μL ddH2O. The PCR conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min; 15 cycles at 4℃ for 10 min.
[0164] Electrophoresis images of the first round of PCR amplification of the common antibody heavy chain and the VHH gene of the heavy chain antibody are shown below. Figure 1 As shown. The marker bands from top to bottom are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 1 and 2 are the products obtained by PCR using different primer combinations. Lane 1 contains amplified fragments of the common antibody heavy chain gene (greater than 750bp) and heavy chain antibody gene (less than 750bp). Lane 2 contains only amplified fragments of the heavy chain antibody VHH gene (approximately 400bp).
[0165] 4. Connection Transformation The PCR product and pHEN6 vector were digested with restriction endonuclease SfiI overnight at 37°C. The recovered fragments were purified using a universal recovery kit. The recovered fragments and vector were mixed at a 3:1 ratio, T4 DNA ligase was added, and the mixture was briefly centrifuged and incubated overnight at 16°C. The ligation product was purified using a universal recovery kit. The VHH fragment and pHEN6 vector ligation product were electroporated into TG1 competent cells, plated, and the antibody insertion rate was verified by colony PCR. The electroporated bacterial culture was plated on LB / Amp plates and incubated at 37°C for 14 hours. The cells were counted and the library capacity was calculated the next day. Colonies were scraped from 2YT medium (2 mL / plate). All colonies were mixed thoroughly, glycerol was added, and the culture was stored as 20% glycerol culture. 1 mL / vial was stored at -80°C.
[0166] 5. Preparation of Anti-GPRC5D VHH phage library (single-domain antibody library) Add 1 mL of the seed bacterial library to 200 mL of 2YT medium (containing a final concentration of 50 μg / mL Amp + 1% glucose), and incubate at 37°C until the OD600 reaches 0.8-1. Then, add M13KO7 helper phage at a ratio of 1:20 for infection. After 1 hour of incubation, replace with fresh 2YT medium (containing a final concentration of 100 μg / mL Amp + 50 μg / mL Kana), and incubate overnight at 37°C with shaking. Collect the bacterial culture into a sterile centrifuge tube, centrifuge to collect the supernatant, add 1 / 5 volume of 20% PEG-2.5M NaCl, mix well, incubate on ice for 1 hour, centrifuge at 12000 rpm for 30 min, discard the supernatant, dissolve the precipitate in 3 mL of sterile 15% glycerol-PBS solution, and store the phage library at -80°C.
[0167] Example 2. Screening, expression, and purification of anti-GPRC5D single-domain antibodies 1. Screening for GPRC5D-specific single-domain antibodies GPRC5D protein was coated onto immunoassay tubes using coating buffer for the first round of screening. The coating buffer was discarded, and the tubes were completely blocked with blocking buffer. After 1 h at room temperature, phage solution was added, and the tubes were washed 20 times with PBST, followed by 5 washes with PBS. The tubes were then eluted with 500 μL of elution buffer and neutralized with neutralization buffer. 2 μL of the eluted phage was used for titer determination, and the remaining phage solution was used for scale-up culture.
[0168] Determining the titer facilitates the next round of screening. The screening results are detailed in Table 2. Using GPRC5D protein as the target, a solid-phase screening method was employed to perform three rounds of screening from the total phage antibody library. The titer of the phages eluted in each round was measured. As shown in Table 2, with the increase in the number of screening rounds, the coating concentration decreased progressively, but the titer of the eluted phages increased, indicating that GPRC5D-specific phages were enriched.
[0169] Table 2. Screening of Anti-GPRC5D specific single-domain antibodies
[0170] 2. Screening of Anti-GPRC5D single-domain antibody phage monoclonals GPRC5D antigen was coated for ELISA assay. The GPRC5D antigen protein concentration was 1 μg / mL, 100 μL / well, and incubated overnight at 4℃. After 2-3 rounds of solid-phase phage selection, single clones were randomly selected and cultured in deep-well plates. Helper phages were added for infection, followed by overnight culture. The supernatant from the overnight culture was used for ELISA detection, with Anti-M13-HRP as the secondary antibody, and incubated at 37℃ for 1 h. After washing, TMB was added for color development, and the reaction was terminated by adding 2M H2SO4. The OD value of the sample was measured at 450 nm using a microplate reader. Anti-GPRC5D positive wells were selected, and DNA sequencing was performed to identify the gene sequences of anti-GPRC5D single-domain antibody clones, obtaining a series of single-domain antibody gene sequences. Through analysis and genotyping of the encoded amino acids, single-domain antibodies of various genotypes were obtained for further expression and screening of highly specific and highly active single-domain antibodies.
[0171] 3. Construction of Anti-GPRC5D single-domain antibody expression plasmid Using 5-nano-NdeI and 3-nano-XhoI as primers, and phage-selected positive monoclonal products as templates, the specific Anti-GPRC5D single-domain antibody gene was obtained by PCR amplification. The PCR product and pET-21b(+) vector (UBO Biotechnology, VT1198) were treated with restriction endonucleases NdeI and XhoI, respectively. The fragments were ligated with T4 DNA ligase and transformed into BL21(DE3) competent cells to obtain plasmids that can efficiently express single-domain antibodies in Escherichia coli. Figure 2 This is an SDS-PAGE electrophoresis image of the GPRC5D phage PCR amplification product. Markers (2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp), PCR amplification product approximately 400bp.
[0172] The sequences (5' to 3') of primers 5-nano-NdeI and 3-nano-XhoI are as follows: 5-nano-NdeI:CATATGCAGGTTCAGCTGGTTGA (SEQ ID NO:9): 3-nano-XhoI: CTCGAGTGAGGAGACGGTGACCTGGGT (SEQ ID NO: 10).
[0173] 4. Expression and purification of Anti-GPRC5D single-domain antibody The bacterial strain containing the target gene was streaked onto a culture plate containing ampicillin sodium and incubated overnight at 37°C. A single clone was selected and inoculated into 3 mL of 2YT medium containing ampicillin sodium and incubated overnight. 1 mL of the overnight culture was then transferred to 100 mL of 2YT medium containing ampicillin sodium and incubated on a shaker at 37°C and 220 rpm until the OD value was reached. 600nm When the pH reaches 0.6 to 1.0, add 0.5 to 1 M IPTG, incubate overnight at 200 rpm on a shaker at 20°C. Centrifuge at 6500 rpm for 20 minutes to harvest the bacteria. Wash the cells twice with 0.05 M Tris buffer, add 20 mL of 0.05 M Tris buffer, place in an ultrasonic homogenizer, sonicate on ice for 15 min, and centrifuge to collect the supernatant. Separate the single-domain antibody protein with a purity of over 90% using Ni+ ion affinity chromatography magnetic beads (BeaverBeads™ His-tag Protein Purification, Suzhou Beaver Biomedical Engineering Co., Ltd.), and collect the protein for dialysis replacement buffer. Results are shown in SDS-PAGE electrophoresis. Figure 3 , Figure 4 The markers in the diagram are 180kDa, 135kDa, 100kDa, 75kDa, 63kDa, 48kDa, 35kDa, 25kDa, 17kDa, and 11kDa.
[0174] Finally, the single-domain antibody numbered PFGC00 was selected, along with its amino acid sequence, the corresponding His-tagged recombinant single-domain antibody encoding the gene, and the CDR sequence, as follows: Figure 13 As shown.
[0175] Given that the sequence is known, the preparation of single-domain antibodies is a routine procedure in the art. Taking the single-domain antibody PFGC00 (amino acid sequence SEQ ID NO:1) as an example, the following illustrative explanation is provided: The fragment between the NdeI and XhoI recognition sites of the pET-21b(+) plasmid is replaced with the DNA molecule shown in SEQ ID NO:2, while keeping the other nucleotide sequences of the plasmid unchanged, resulting in the recombinant plasmid pET-21b-PFGC00 expressing the recombinant single-domain antibody PFGC00. The recombinant plasmid pET-21b-PFGC00 is transformed into BL21(DE3) competent cells to obtain recombinant E. coli that efficiently expresses the recombinant single-domain antibody PFGC00. The amino acid sequence of the recombinant single-domain antibody PFGC00 expressed by this recombinant E. coli is SEQ ID NO:3. SEQ ID NO:3, positions 2 to 117 are the amino acid sequence of the PFGC00 single-domain antibody, positions 1 and 118 to 125 are the amino acid residues encoded by the pET-21b(+) plasmid backbone vector sequence, and positions 120 to 125 are 6×His tags.
[0176] Example 3. In vitro detection of the binding activity of PFGC00 single-domain antibody 1. The affinity between recombinant single-domain antibody PFGC00 and human GPRC5D protein was detected by enzyme-linked immunosorbent assay (ELISA). Dilute GPRC5D-His antigen (Kaikai Biotechnology, GPR-HM05P) to 1 µg / mL with 0.05 M NaHCO3 (pH 9.6) coating buffer, 100 μL / well, and coat overnight at 4°C. Block 96-well plates with PBST containing 4% skim milk powder and incubate at 37°C for 1 hour. Add diluted recombinant single-domain antibody PFGC00, starting at 50 μg / mL, serially diluted 5-fold in 7 steps, and incubate at 37°C for 1 hour. Wash the plate three times with 0.05% PBST. Add 1:10000 diluted Anti-VHH-antibody-HRP secondary antibody at 100 μL / well and incubate at 37°C for 1 hour. Wash the plate three times with 0.05% PBST. Add 100 μL of TMB and incubate at room temperature in the dark for 15 minutes for color development. Stop the reaction by adding 50 μL of 2 M H2SO4. The OD values of the samples at 450 nm were measured using an ELISA reader, and the results are shown in Table 3. A binding activity curve was plotted with the sample OD values at 450 nm as the ordinate and the logarithm of the antibody concentration as the abscissa. Figure 5 The results showed that the recombinant single-domain antibody PFGC00 had good specificity for GPRC5D protein.
[0177] Table 3. Results of ELISA detection of the affinity between PFGC00 single-domain antibody and human GPRC5D protein.
[0178] 2. Flow cytometry was used to identify the affinity between the PFGC00 single-domain antibody and the GPRC5D protein. In the experiment, human myeloma cells H929 (ATCC, CRL-3580) were selected as positive cells, and human hematologic malignancies Ramos, U266, and K562 cells were selected as controls. They were cultured in RPMI 1640 medium containing 10% FBS for later use.
[0179] The purified recombinant single-domain antibody PFGC00 (1 mg / mL) was reacted with PE-NHS (AAT Bioquest, 2613) at a molar ratio of 1:10 in carbonate buffer at pH 9.2 in the dark for 2 hours (25°C). Free dye was then removed using a PD-10 desalting chromatography column, and the PE-labeled recombinant single-domain antibody PFGC00 was collected, aliquoted, and stored at 4°C in the dark for later use.
[0180] The experimental procedure was as follows: 20 µg / mL of PE-labeled recombinant single-domain antibody PFGC00 was incubated with H929, Ramos, U266, and K562 cells on ice for 20 minutes, respectively. Cells were then washed three times with PBS and resuspended in 500 μL PBS. Fluorescence intensity was analyzed using a FACS Calibur analyzer (BD Biosciences) and FlowJo software (Tree Star). PE controls and blank controls (CK) were included.
[0181] The cell control group (CK) was operated in the same manner as the experimental group, except that only cells were added and the PE-labeled recombinant single-domain antibody PFGC00 was not added.
[0182] The procedure for the PE negative control group (PE) was the same as that for the experimental group, except that only PE dye was added.
[0183] The results are as follows Figure 6 As shown, the recombinant single-domain antibody PFGC00 exhibited significant translocation with H929 cells, while other cells showed virtually no translocation, all of which were lower than those of the recombinant single-domain antibody PFGC00. This indicates that the recombinant single-domain antibody PFGC00 has good binding affinity and specificity to H929 cells.
[0184] 3. Biomembrane Interference Technology (BLI) Analysis of Affinity between PFGC00 Single-Domain Antibody and GPRC5D Protein The affinity of the recombinant single-domain antibody PFGC00 for GPRC5D protein was determined using an Octet RED96 (Sartorius) biomembrane interferometer. After immersing the HIS1K biosensor in PBS for 10 min to capture the single-domain antibody, the sensor was immersed in wells containing 100, 50, 25, 12.5, 6.25, 3.125, and 1.563 nM of GPRC5D protein for 2 min, followed by dissociation in PBS. The data were then analyzed using Octet Analysis Studio 13.0 software. The results are shown below. Figure 7 The recombinant single-domain antibody PFGC00 has a high affinity for GPRC5D protein, with a KD value of 1.956E-12.
[0185] Example 4. In vivo efficacy evaluation of PFGC00 single-domain antibody 4.1. Preparation of tumor-bearing mice All animal experiments were conducted according to the approved protocols of the Animal Management and Use Committee of Peking University First Hospital. Twelve 4-6 week old female NCG immunodeficient mice (Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were used to construct a subcutaneous multiple myeloma tumor model. The preparation of tumor-bearing mice is a routine technique in the field, and an exemplary preparation method is provided as follows: H929 positive cells (ATCC, CRL-3580) were used at a concentration of 1×10⁻⁶. 7 One cell was subcutaneously injected with 100 μL of Matrigel suspension into the right axilla of a mouse. The tumor volume was monitored regularly. When the tumor grew to 1 cm³, the obtained H929 tumor-bearing mice were subjected to in vivo imaging and biodistribution experiments.
[0186] The negative control K562 tumor-bearing mice were prepared using the same method as the H929 tumor-bearing mice, with the only difference being the type of cells injected.
[0187] 4.2. PFGC00 single-domain antibody radioactive probe labeling The purified recombinant single-domain antibody PFGC00 (1 mg / mL) was reacted with NOA-NHS-ester (Macrocyclics, B-601) at a molar ratio of 1:10 in carbonate buffer at pH 9.2 for 2 hours (25°C). Free chelating agent was then removed using a PD-10 desalting column, and the NOA-labeled recombinant single-domain antibody PFGC00 was collected, aliquoted, and stored at 4°C.
[0188] Rinse with 0.05M high-purity hydrochloric acid 68 Ge- 68 GaG germanium generator (ITM Isotope Technologies, Germany), yielding 4 mL 68Take 1 mL of the GaCl3 eluent with the highest specific activity. 68 A GaCl3 solution was prepared, and 80 μL of 2 M sodium acetate was added to adjust the pH of the solution to 4-4.5. Then, recombinant single-domain antibody PFGC00, conjugated with NOA (a chelating agent), was added. The mixed solution was placed on a shaker at 37°C for 15 minutes. The solution was then filtered through a PD10 column to obtain the final product. 68 Ga-NOTA-PFGC00 single-domain antibody-labeled probe.
[0189] 4.3. PET Imaging and Biodistribution Analysis of PFGC00 Single-Domain Antibody Probe in Tumor-Bearing Mouse Models When the tumor volume reaches 100mm 3 At that time, 11.1 MBq of [a specific drug] was injected into the tail vein of four H929 tumor-bearing mice. 68 Ga-NOTA-PFGC00 was used, and the patients were anesthetized at 1 h and 2 h in an isoflurane atmosphere (2% isoflurane-30% oxygen / air) and then imaged using a micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.).
[0190] Imaging images such as Figure 8 As shown. The results show that in the GPRC5D positive H929 model, among which 68 One hour after Ga-NOTA-PFGC00 injection, the tumor showed a high concentration of radioactivity, and the uptake rate remained high even after two hours. The probe showed significant uptake in the kidneys, indicating that the probe is mainly excreted through the kidneys.
[0191] Regions of interest (ROIs) were plotted using NMSoft-AIWS software, and the radioactive uptake in the tumor and major organs at each time point was quantitatively analyzed. The results are as follows: Figure 9 As shown in Figure a, the radioactive uptake is expressed as the maximum %ID / cc. The tumor uptake of H929 was 2.32 ± 0.16 %ID / cc at 1 hour and 1.93 ± 0.34 %ID / cc at 2 hours. The ratios of tumor uptake to muscle and blood were calculated based on the ROI uptake values.
[0192] The results are as follows Figure 9 As shown in Figure b, the tumor-to-muscle ratio was 5.36 ± 0.80 at 1 hour, and even higher at 2 hours, reaching 7.67 ± 0.64; the tumor-to-blood ratio was 3.12 ± 0.95 at 1 hour, and again higher at 2 hours, reaching 4.22 ± 0.84. These results confirm that this probe exhibits excellent tumor targeting within 1-2 hours after injection, demonstrating not only high tumor uptake but also maintaining an ideal target-to-muscle ratio, indicating that the probe possesses excellent in vivo metabolic kinetics.
[0193] Blockade group: 11.1 MBq of [unspecified substance] was injected into the tail vein of four H929 tumor-bearing mice. 68 Simultaneously with Ga-NOTA-PFGC00, 1 mg of recombinant single-domain antibody PFGC00 was injected, followed by anesthesia in an isoflurane atmosphere (2% isoflurane-30% oxygen / air) at 1 h, and imaging was performed using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.).
[0194] Imaging images such as Figure 10 As shown in Figure a. The results show that in the GPRC5D positive H929 model ( Figure 10 In H929, 68 One hour after Ga-NOTA-PFGC00 injection, the tumor showed a higher concentration of radioactivity, while the blocking group ( Figure 10 The H929-blocking group maintained a low uptake rate. Regions of interest (ROIs) were plotted using software, and the radioactive uptake in the tumor and major organs at each time point was quantitatively analyzed. The results are as follows: Figure 10 As shown in Figure b, the tumor uptake of H929 in the non-blocking group was 2.32 ± 0.16 %ID / cc at 1 hour, while the uptake of H929 in the blocking group was only 1.06 ± 0.21 %ID / cc. P The result (<0.05) demonstrates that this probe can specifically bind to GPRC5D.
[0195] Four negative control K562 tumor-bearing mice were injected intravenously with 11.1 MBq of [a specific drug / method / propagation]. 68 Ga-NOTA-PFBC01 was administered, followed by anesthesia at 1 hour in an isoflurane atmosphere (2% isoflurane - 30% oxygen / air) and imaging using a micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.).
[0196] Imaging images such as Figure 11 As shown in Figure a, it can be observed that... 68 Ga-NOTA-PFGC00 uptake in H929 tumors was significantly higher than that in K562 tumors. Regions of interest (ROIs) were plotted using software, and the radioactive uptake in tumors and major organs at each time point was quantitatively analyzed. The results are as follows: Figure 11 As shown in Figure b, H929 uptake at 1 hour post-injection was 2.32 ± 0.16 %ID / cc (maximum value), while the control group K562 uptake was only 0.61 ± 0.17 %ID / cc (maximum value). P The result (<0.05) further confirms the specific targeting ability of this probe for GPRC5D.
[0197] H929 and K562 tumor-bearing mice were euthanized one hour after probe injection for biodistribution analysis. Organs including blood, heart, lungs, liver, kidneys, spleen, pancreas, bladder, stomach, bones, muscles, small intestine, brain, and tumors were collected and weighed, and counted using a gamma counter (Hidex). Radioactive uptake results are expressed as a percentage per gram of tissue (%ID / g, mean ± standard deviation).
[0198] In vivo biodistribution analysis results as follows Figure 12 As shown, consistent with PET imaging results, it displays... 68 Ga-NOTA-PFGC00 uptake in H929 tumors was significantly higher than in the K562 group. P <0.05). These results demonstrate that the PFGC00 single-domain antibody probe of this application possesses the ability to rapidly target GPRC5D and achieve high-sensitivity imaging of small tumors.
[0199] In summary, the GPRC5D-specific single-domain antibody PFGC00 of this application not only exhibits excellent GPRC5D targeting ability in vivo, but also has good tumor penetration, making it suitable for binding with anticancer drugs or imaging agents to support targeted therapy and imaging applications for tumors.
[0200] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A single-domain antibody, characterized in that, The single-domain antibody includes three complementarity-determining regions named CDR1, CDR2, and CDR3, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 are positions 31-35, 50-66, and 99-105 of SEQ ID NO:1, respectively.
2. The single-domain antibody according to claim 1, characterized in that, The single-domain antibody also includes four frame regions named FR1, FR2, FR3, and FR4. The amino acid sequence of FR1 is positions 1 to 30 of SEQ ID NO:1, the amino acid sequence of FR2 is positions 36 to 49 of SEQ ID NO:1, the amino acid sequence of FR3 is positions 67 to 98 of SEQ ID NO:1, and the amino acid sequence of FR4 is positions 106 to 116 of SEQ ID NO:
1.
3. The single-domain antibody according to claim 2, characterized in that, The single-domain antibody binds to GPRC5D.
4. A single-domain antibody, characterized in that, The amino acid sequence of the single-domain antibody is SEQ ID NO:
1.
5. An immunoconjugate, characterized in that, The immunoconjugates include (I) and (II): (I) The antibody portion, wherein the antibody portion is a single-domain antibody according to any one of claims 1 to 4; (II) Coupling Part: The coupling part is 68 Ga.
6. A reagent or kit, characterized in that, It includes single-domain antibodies as described in any one of claims 1 to 4 and / or immunoconjugates as described in claim 5.
7. The single-domain antibody according to any one of claims 1 to 4 and / or the immunoconjugate according to claim 5, used in at least one of (C1) to (C4) below, (C1) Prepare detection reagents, detection kits, detection plates or developing agents for recognizing or assisting in the recognition of GPRC5D protein; (C2) Prepare detection reagents, detection kits, detection plates or contrast agents that bind to or assist in binding to GPRC5D protein; (C3) Prepare detection reagents, kits, plates or contrast agents for detecting or assisting in the detection of GPRC5D expression levels in cells; (C4) Prepare diagnostic reagents, test kits, test plates or contrast agents for the diagnosis or auxiliary diagnosis of multiple myeloma.
8. A biomaterial, characterized in that, The biomaterial is any one of the following: (E1) A nucleic acid molecule encoding a single-domain antibody as described in any one of claims 1 to 4. (E2) An expression cassette containing the nucleic acid molecule described in (E1), (E3) A recombinant vector containing the nucleic acid molecule described in (E1) and / or the expression cassette described in (E2). (E4) Recombinant cells containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) and / or the recombinant vector described in (E3).
9. The biomaterial according to claim 8, characterized in that, (E1) The nucleic acid molecule is shown in SEQ ID NO:
2.
10. The biomaterial according to claim 8 or 9, characterized in that, The cells described in (E4) are cells derived from animals or microorganisms.
11. A method for preparing single-domain antibodies, characterized in that, The single-domain antibody is any one of claims 1 to 4, and the method includes the step of expressing the encoding gene of the single-domain antibody in cells to obtain the single-domain antibody.
Citation Information
Patent Citations
GPRC5D single domain and humanized antibody thereof
CN119462925A
GPRC5D-targeted single-domain antibody, chimeric antigen receptor and application of GPRC5D-targeted single-domain antibody and chimeric antigen receptor
CN120005019A