A method for virus-induced gene silencing in cauliflower

Abstract

The application belongs to the field of molecular biology, and provides a virus-induced gene silencing method for cauliflower, comprising the following steps: vacuum infection treatment is performed on bud stage seedlings of the cauliflower by using a transformation bacterial liquid, and then first dark culture is performed; then light culture is performed on the seedlings after the first dark culture; then injection treatment is performed on the seedlings after the light culture by using the transformation bacterial liquid, and then second dark culture is performed on the seedlings after the injection treatment; wherein the transformation bacterial liquid comprises: agrobacterium bacterial liquid into which a PCVA-PDS recombinant silencing vector is transferred, and agrobacterium bacterial liquid into which a PCVB auxiliary vector is transferred. The application successfully realizes effective silencing of the PDS gene of the cauliflower, the silencing efficiency is more than 60%, and the technical problem of invalid VIGS silencing of the cauliflower is completely solved; the method is convenient to operate, short in cycle, strong in adaptability, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to a method for virus-induced gene silencing in cauliflower. Background Technology

[0002] Cauliflower (Brassica oleracea var. botrytis L.) is an important vegetable belonging to the Brassicaceae family and the Brassica genus. Rich in vitamins, dietary fiber, and various bioactive substances, it possesses extremely high nutritional and economic value. With the successive publication of high-quality reference genomes and pan-genomes of cauliflower, cauliflower research has entered the post-genomic era. The discovery and analysis of important agronomic traits (such as yield, quality, and disease resistance) have become the core direction of current molecular biology research on cauliflower.

[0003] Gene function verification is a key step in agronomic trait analysis. Currently, commonly used verification methods include genetic transformation and gene editing. However, cauliflower faces challenges such as difficulty in establishing genetic transformation systems and low gene editing efficiency. Furthermore, its long growth cycle (approximately 8-9 months) has severely hampered the progress of functional gene verification in cauliflower and hindered the research process in the post-genomic era of cauliflower.

[0004] Virus-induced gene silencing (VIGS) is a highly efficient and rapid reverse genetics tool with advantages such as no need to establish a genetic transformation system, simple operation, and short cycle. It has been successfully applied in various plants and has become an important means to solve the problem of verifying plant functional genes. In the existing technology, a VIGS system for cabbage has been disclosed, which uses PCVA / PCVB vectors to achieve effective silencing of cabbage genes. However, when this method is applied to cauliflower, it cannot achieve silencing of the cauliflower albino gene homolog (PDS gene), and no obvious albino phenotype is observed, indicating that the existing VIGS method for cabbage is not suitable for cauliflower.

[0005] Therefore, in view of the technical pain points of the existing technology, such as the lag in the verification of functional genes in cauliflower and the inability of the existing VIGS method to adapt to cauliflower, there is an urgent need to develop an efficient, stable VIGS method that can be adapted to different cauliflower cultivars, so as to provide technical support for the verification of functional genes in cauliflower and promote the development of molecular biology research in cauliflower. Summary of the Invention

[0006] To address the aforementioned problems in the prior art, this invention provides a method for virus-induced gene silencing in cauliflower.

[0007] This invention provides a method for virus-induced gene silencing in cauliflower, the method comprising: vacuum infection of cauliflower bud seedlings with transformation bacterial solution followed by a first dark culture; then light culture of the seedlings after the first dark culture; then injection treatment of the seedlings after the light culture with transformation bacterial solution; and then a second dark culture of the seedlings after the injection treatment.

[0008] The bacterial culture used for transformation includes Agrobacterium tumefaciens transformed with PCVA-PDS recombinant silencing vector and Agrobacterium tumefaciens transformed with PCVB helper vector.

[0009] This invention also provides the application of the above-mentioned virus-induced gene silencing method for cauliflower in the verification of functional genes and the mining of agronomic traits in cauliflower.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] 1. The method of the present invention solves the core pain point of the prior art: The present invention addresses the problem that the existing VIGS method for cabbage cannot be adapted to cauliflower. It innovatively adopts a combination of "vacuuming during the bud stage + injecting the cotyledons 2-3 times at intervals after transplanting", which successfully achieves effective silencing of the PDS gene in cauliflower. The plant leaves show obvious whitening phenotype, and the silencing efficiency reaches more than 60%, which completely solves the technical problem of ineffective VIGS silencing in cauliflower.

[0012] 2. High silencing efficiency and good stability: This invention uses vacuum treatment during the bud stage to allow the bacterial solution for transformation to fully penetrate the cauliflower seedling tissue. Combined with multiple cotyledon injections after transplanting, the infection time is extended and the infection efficiency is improved, ensuring a stable silencing effect. Validated on five cauliflower cultivars with different backgrounds, this method can achieve effective silencing and has strong adaptability, providing a unified technical solution for gene function verification of different cauliflower germplasms.

[0013] 3. Simple operation and short cycle: This invention does not require the establishment of a complex genetic transformation system. The operation steps are simple and the required equipment is conventional. It only takes 3 to 4 weeks from seed treatment to the appearance of a silent phenotype. Compared with the traditional genetic transformation method (about 4 months), it significantly shortens the cycle of cauliflower functional gene verification and improves research efficiency.

[0014] 4. Highly practical and with broad application prospects: This invention can be widely applied to the rapid verification of various functional genes in cauliflower (such as agronomic trait-related genes, disease resistance genes, etc.), providing an efficient technical tool for the mining of agronomic traits and molecular breeding in the post-genomic era of cauliflower, which is of great significance for promoting the high-quality development of the cauliflower industry.

[0015] 5. This invention is simple to operate, efficient, and easy to promote and use in various regions. Attached Figure Description

[0016] Figure 1 Photographs (A) and bar charts (B) showing the relative expression levels of the PDS gene in the control and treatment groups in Example 1.

[0017] Figure 2 Photographs (A) and bar charts (B) showing the relative expression levels of the PDS gene in the control and treatment groups of the four varieties in Example 2.

[0018] Figure 3 Photographs (A) and bar charts (B) showing the phenotypes of plants in the control and treatment groups in the comparative example.

[0019] Figure 4 This is a map of the PCVA plasmid.

[0020] Figure 5 This is a map of the PCVB plasmid. Detailed Implementation

[0021] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0022] In this invention, gene silencing efficiency is defined as follows:

[0023] The gene silencing efficiency in a virus-induced gene silencing (VIGS) system refers to the degree to which the expression level of the target gene is suppressed by the viral vector system. It quantitatively reflects the downregulation effect of this technology on the target gene. Typically, this efficiency is quantified by comparing the relative expression levels of the target gene in the control group (unsilenced) and the treatment group (VIGS treated). The specific calculation formula is as follows:

[0024] Gene silencing efficiency = (1 - relative expression level of target gene in treatment group / relative expression level of target gene in control group) × 100%.

[0025] For example, if the relative expression level of the target gene in the control group is set to 1, while the relative expression level in the VIGS treatment group drops to 0.2, then the gene silencing efficiency is (1-0.2 / 1)×100%=80%. This means that the expression of the gene was successfully suppressed by 80%.

[0026] This invention provides a method for virus-induced gene silencing in cauliflower, the method comprising:

[0027] Cauliflower seedlings were vacuum-infected with a transformation bacterial solution and then cultured in the dark for the first time. The seedlings after the first dark culture were then cultured in the light. The seedlings after the light culture were then injected with the transformation bacterial solution and then cultured in the dark for the second time.

[0028] The bacterial culture used for transformation includes: Agrobacterium culture transformed with PCVA-PDS recombinant silencing vector, and Agrobacterium culture transformed with PCVB auxiliary vector.

[0029] According to the present invention, the recombinant silencing vector is constructed using either of the following two methods:

[0030] Method 1: Recombinantly ligate the homologous fragment of the PDS gene from cauliflower with the PCVA vector to obtain the recombinant silencing vector PCVA-PDS.

[0031] The length of the above-mentioned PDS gene homologous fragment is 316 bp, as shown in SEQ ID NO:1 in the sequence listing.

[0032] SEQ ID NO:1:

[0033] GGAATGGATATCACGGACCGACTCTGACATTATAGATGCAACCATGAAAGAGCTCGAGAAACTCTTCCCTGACGAAATCGCTGCTGACCAAAGCAAAGCTAAAATTCTCAAGTACCATGTCGTCAAAACTCCAAGGTCTGTGTACAAGACCATCCCAG ACTGTGAACCATGTCGTCCTCTACAGAGATCTCCTATTCAAGGCTTTACTTAGCTGGAGACTACACTAAACAGAAGTACTTAGCTTCCATGGAAGGCGCCGTTCTCTCTGGCAAATTCTGCTCACAGTCTATTGTGCAGGATTATGAGCTATTGGCT.

[0034] Method 2: Total RNA extracted from cauliflower leaves is reverse transcribed into cDNA, and then the cDNA is used as a template; or the coding region (CDS) of the homologous sequence of the cauliflower PDS gene shown in SEQ ID NO:2 in the sequence listing is used as a template, and PCR amplification is performed using the following specific primers to obtain PCR amplification products; then the PCR amplification products are ligated to the PCVA vector.

[0035] Upstream primer (SEQ ID NO:3): 5'-GGAATGGATATCACGGACCGAC-3';

[0036] Downstream primer (SEQ ID NO:4): 5'-AGCCAATAGCTCATAATCCTGCAC-3'.

[0037] The coding region (CDS) of the homologous sequence of the cauliflower PDS gene described above is shown in SEQ ID NO:2 in the sequence listing. The specific primers described above are designed based on the conserved sequence of the cauliflower PDS gene to ensure the specificity of silencing.

[0038] SEQ ID NO:2:

[0039]

[0040] According to the present invention, the OD of the Agrobacterium tumefaciens culture transformed with the PCVA-PDS recombinant silencing vector is... 600 =0.8;

[0041] The OD of the Agrobacterium tumefaciens culture solution transferred into the PCVB auxiliary carrier 600 =0.8;

[0042] The volume ratio of Agrobacterium tumefaciens culture transformed with PCVA-PDS recombinant silencing vector to Agrobacterium tumefaciens culture transformed with PCVB auxiliary vector is 1:1.

[0043] The Agrobacterium tumefaciens culture transformed with the PCVA-PDS recombinant silencing vector and the Agrobacterium tumefaciens culture with the PCVB helper vector were obtained by means of the following operations:

[0044] The PCVA-PDS recombinant silencing vector and the PCVB helper vector were transformed into Agrobacterium competent cells, and positive Agrobacterium strains were screened. These positive Agrobacterium strains were then inoculated into LB medium containing the corresponding antibiotics and cultured with shaking until OD (Occurrence Limit). 600 The value was 1.2; the cells were then collected by centrifugation, resuspended in infection buffer, and the OD was adjusted. 600 The value was increased to 0.8, and Agrobacterium tumefaciens culture transformed with PCVA-PDS recombinant silencing vector and Agrobacterium tumefaciens culture transformed with PCVB auxiliary vector were obtained respectively.

[0045] The above-mentioned infection buffer is a sterile buffer of 5~20 mmol / L MgCl2, 5~20 mmol / L MES (2-Morpholinoethanesulfonic acid) and 100~300 μmol / L eugenol (AS), with a pH of 5.6-5.8.

[0046] Preferably, the above-mentioned infection buffer solution is: 10 mmol / L MgCl2, 10 mmol / L MES, 200 μmol / L AS, with a pH value of 5.6-5.8.

[0047] According to the present invention, the method for obtaining cauliflower seedlings includes: disinfecting plump cauliflower seeds and then culturing them at 22~28℃ (preferably 25℃) under light for 14h / d until the sprout length reaches 0.5~1cm (preferably 0.8cm).

[0048] According to the present invention, in the vacuum impregnation process, the pressure is 0.5~1.0 kPa and the time is 10~40 min.

[0049] Preferably, in the vacuum impregnation process, the pressure is 0.8 kPa and the time is 30 min.

[0050] According to the present invention, the conditions for light cultivation include: temperature 22~28℃, light duration 12~16h / d, light intensity 2000~3000lx, and air humidity 60~70%; after the light cultivation, seedlings with two cotyledons unfolded are obtained.

[0051] Preferably, the conditions for light cultivation include: temperature 22~28℃ (preferably 25℃), light duration 12~16h / d, light intensity 2000~3000Lx (preferably 2500lx), and air humidity 60~70% (preferably 65%).

[0052] The conditions for the first and second dark incubations include: a temperature of 22-28°C and an air humidity of 60-70%; the duration of both the first and second dark incubations is 12-36 hours.

[0053] Preferably, the conditions for the first and second dark cultures include: a temperature of 25°C, an air humidity of 65%, and dark conditions; the duration of both the first and second dark cultures is 24 hours.

[0054] According to the present invention, in the injection treatment, the transformation bacterial solution is injected into the cotyledons of the seedlings after the light culture, with 0.1 to 0.2 mL injected into each cotyledon; the injection is repeated once every 3 to 5 days, for a total of 2 to 3 injections.

[0055] The effects of the two dark culture treatments mentioned above, the first dark culture and the second dark culture, include:

[0056] 1. It can provide a familiar and comfortable breeding ground for Agrobacterium, allowing Agrobacterium to rapidly multiply in the plant and reach the optimal state of infection.

[0057] 2. Under light-free conditions, plant cells are more likely to return to an undifferentiated, actively dividing state. Cells in this state have the highest acceptance of foreign genes, thereby significantly increasing subsequent protein expression or viral silencing efficiency.

[0058] 3. Viral vectors carrying the target gene need to replicate extensively within plant cells and then migrate with the plant's vascular system to new leaves to achieve "systemic silencing." Dark treatment not only protects the viral vector from photo-oxidative damage but also buys time for this lengthy transport and colonization process.

[0059] According to the present invention, the method may further include the following detection step:

[0060] After the second dark culture, the seedlings were cultured under light for 20-40 days, and the plant phenotype was observed. The relative expression level of the PDS gene in the plants was detected, and the silencing efficiency was calculated. The silencing efficiency can reach more than 60%.

[0061] Preferably, the conditions for the above-mentioned light culture include: temperature 22~28℃, preferably 25℃, light duration 12~16h / d, light intensity 2000~3000lx, preferably 2500lx, and air humidity 60~70%, preferably 65%.

[0062] The application of the virus-induced gene silencing method for cauliflower provided by the present invention in the verification of functional genes and the discovery of agronomic traits in cauliflower is also within the scope of protection of the present invention.

[0063] Unless otherwise specified, all reagents and materials used in the following examples are products that can be obtained from commercial channels; unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.

[0064] The cauliflower cultivars used in the following examples—Korso, Gaoshanbao DH9 (early maturing), Qingxiu DH (early maturing), Xiaomisong (early maturing), and Xueli (late maturing)—are all currently preserved in the germplasm resource bank of the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences (contact number: 010-81127153). For the purpose of implementing the technical solution of this invention, during the validity period of this invention, anyone may contact the inventor to obtain the above-mentioned plant varieties.

[0065] Example 1

[0066] This embodiment illustrates a method for silencing the PDS gene in Korso cauliflower using the method provided by this invention.

[0067] 1. Test materials:

[0068] The cauliflower cultivar "Korso".

[0069] The CaLCuV vector (PCVA / PCVB) was kindly provided by Professor Lü Honghao of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. This plasmid vector is also available for purchase, for example: the non-profit plasmid library Addgene (addgene.org / , pCVA ID 32470, pCVB ID 32471); or the Miaoling Plasmid Platform (https: / / www.miaolingbio.com / ).

[0070] The maps of PCVA and PCVB plasmids are as follows: Figure 4 , Figure 5As shown.

[0071] Agrobacterium GV3101 competent cells; Product name: GV3101(pSoup) Chemically Competent Cell, Lot No.-112636200, purchased from Beijing Coollab Technology Co., Ltd.

[0072] Cauliflower PDS gene-specific primers include:

[0073] Upstream primer (SEQ ID NO:3): 5'-GGAATGGATATCACGGACCGAC-3';

[0074] Downstream primer (SEQ ID NO:4): 5'-AGCCAATAGCTCATAATCCTGCAC-3'.

[0075] LB medium;

[0076] Infection buffer, comprising: 10 mmol / L MgCl2, 10 mmol / L MES, 200 μmol / L AS, pH=5.7.

[0077] 2. Treatment group and control group

[0078] Treatment group: Seedlings obtained after injection according to the procedure described in "3. Method of this embodiment". The procedure was repeated three times; each time, 52, 52, and 50 seedlings were transformed in step S3, respectively.

[0079] Control group (EV): In the following "3. Method of this embodiment", step S1 is omitted; in step S2, empty vector PCVA and helper vector PCVB are transformed into Agrobacterium GV3101 competent cells, respectively, to obtain transformation solutions for PCVA and PCVB; before vacuum infection and injection treatment in step S3, transformation solutions for PCVA and PCVB are prepared at a volume ratio of 1:1 to obtain transformation solution. The remaining operations are the same as those for the treatment group. Three replicates are performed; each time, 15 budding seedlings are transformed in step S3.

[0080] 3. The method of this embodiment includes the following steps:

[0081] S1. Construction of recombinant vector:

[0082] (1) Total RNA was extracted from the leaves of cauliflower Korso and then reverse transcribed into cDNA using a reverse transcription kit.

[0083] (2) Using the above cDNA as a template, PCR amplification was performed using the above specific primers to obtain the PCR amplification product. The amplification product includes a PDS gene homologous fragment with endonuclease Xba1 and KpnI adapter (i.e., SEQ ID NO:1+ endonuclease adapter).

[0084] PCR reaction conditions: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 30 seconds, for a total of 35 cycles; 72℃ final extension for 5 minutes.

[0085] The PCR reaction system includes: 1 μL cDNA, 1 μL each of upstream and downstream primers, 10 μL high-fidelity enzyme and buffer, and 7 μL ddH2O.

[0086] (3) The above PCR amplification products were subjected to agarose gel electrophoresis, and the PDS gene homologous fragment with an endonuclease linker of about 300 bp was recovered; the PCVA vector was then digested with Xba1 and KpnI endonucleases to obtain the PCVA linearized vector; the above PDS gene homologous fragment with an endonuclease linker was then ligated with the PCVA linearized vector to obtain the recombinant silencing vector PCVA-PDS.

[0087] (4) Transform the above recombinant silencing vector PCVA-PDS into Escherichia coli DH5α competent cells to screen for positive clones, and then verify by sequencing to ensure that the vector is constructed correctly.

[0088] S2. Bacterial culture preparation steps:

[0089] (1) The above recombinant silencing vector PCVA-PDS and the helper vector PCVB were transformed into Agrobacterium GV3101 competent cells, and then plated on LB medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin, respectively. They were cultured at 28°C for 2-3 days to screen out positive Agrobacterium.

[0090] (2) Select positive Agrobacterium colonies and inoculate them into LB liquid medium containing the same antibiotic. Incubate at 28°C and 190 r / min with shaking until OD. 600 =1.2.

[0091] (3) Collect bacterial cells by centrifugation (5000 r / min, 10 min), resuspend the bacterial cells in infection buffer, and adjust OD. 600 =0.8, and after standing at room temperature in the dark for 2 hours, we obtained bacterial culture for transformation containing PCVA-PDS (i.e., Agrobacterium culture transformed with PCVA-PDS recombinant silencing vector) and bacterial culture for transformation containing PCVB (i.e., Agrobacterium culture transformed with PCVB auxiliary vector).

[0092] Before subsequent vacuum contamination and injection treatment, the above-mentioned transformation bacterial solution containing PCVA-PDS and transformation bacterial solution containing PCVB were mixed at a volume ratio of 1:1 to obtain the transformation bacterial solution.

[0093] S3. Conversion Steps:

[0094] (1) Select plump cauliflower "Korso" seeds, soak them in 75% ethanol for 30 seconds, then soak them in 0.1% mercuric chloride solution for 12 minutes, rinse them 4 times with sterile water, disinfect them and place them in a sterile petri dish lined with moist filter paper. Cultivate them at 25℃ and 14 h / d light until the seeds show white and the sprouts grow to 0.8 cm, thus obtaining seedlings in the germination stage.

[0095] (2) Vacuum infection: Carefully remove the above-mentioned seedlings at the bud stage and place them in a culture dish containing the bacterial solution for transformation; place the culture dish in a vacuum desiccator and evacuate it to 0.8 kPa for 30 minutes. During this period, gently shake the culture dish once every 10 minutes to ensure that the bacterial solution is in full contact with the seedlings. Finally, the seedlings after vacuum infection are obtained.

[0096] (3) First dark culture after infection: The seedlings after vacuum infection were transplanted into sterile substrate (vermiculite: nutrient soil mass ratio 2:1) and placed in a greenhouse for the first dark culture for 24 hours. The culture conditions were 25℃ and 65% air humidity to obtain the seedlings after the first dark culture.

[0097] (4) Light culture: After the first dark culture, the seedlings were cultured under light until the seedlings with two cotyledons unfolded were obtained. Culture conditions: temperature 25℃, light time 12~16h / d, light intensity 2500lx, air humidity 65%.

[0098] (5) Injection treatment: Take two seedlings with unfolded cotyledons, and inject the above-mentioned transformation bacterial solution into the cotyledons using a 1mL sterile syringe. Inject 0.15mL into each cotyledon, and inject once every 3 days for a total of 3 injections to obtain seedlings after injection.

[0099] (6) Second dark culture after injection: The seedlings after injection were subjected to a second dark culture for 24 hours at 25℃ and 65% humidity to obtain seedlings after the second dark culture.

[0100] S4. Detection steps:

[0101] (1) After the second dark culture, the plants were cultured under light (temperature 25℃, light time 12~16h / d, light intensity 2500lx, air humidity 65%) for 30 days. The plant phenotypes were observed. It was found that the leaves of the plants in the treatment group showed obvious whitening phenotypes, while the leaves of the plants in the control group (transferred to empty carrier) did not show whitening.

[0102] The treatment group was replicated three times. In each step S3, 52, 52, and 50 seedlings were transformed; in step S4, the total number of plants with different degrees of albino phenotype were 43, 40, and 40, respectively. Therefore, the transformation efficiencies for each step were 43 / 52 = 82.6%, 40 / 52 = 76.9%, and 40 / 50 = 80%, respectively. It is evident that the transformation efficiency of this embodiment is relatively high.

[0103] (2) Three plants (n=3) were randomly selected from the plants exhibiting obvious albino phenotype, and three plants were also randomly selected from the control group. The relative expression levels of the PDS gene in the treatment group and the control group were detected by qRT-PCR. The results showed that in the three replicates of the treatment group, the expression level of the PDS gene decreased by at least 80% compared with the control group, that is, the silencing efficiency reached more than 80%, indicating that the PDS gene silencing in the treatment was successful.

[0104] Table 1: Figure 1 The silencing efficiency of the control group and the treatment group in B.

[0105]

[0106] like Figure 1 As shown in Figure A, the leaves of the control group (EV) show no whitening, while the leaves of the treatment group (BobPDS) in Figure B show obvious whitening. Figure B (in conjunction with Table 1) shows that, compared to the control group, the PDS gene expression level in the treatment group is significantly reduced.

[0107] Example 2

[0108] This embodiment illustrates virus-induced gene silencing methods for other varieties of cauliflower.

[0109] 1. Treatment Group: Four cauliflower cultivars with different backgrounds were selected (Gaoshanbao DH, early-maturing; Qingxiu DH, early-maturing; Xiaomisong, early-maturing; Xueli, late-maturing), and VIGS operation was performed according to the method in Example 1. Three replicates were set up for each cultivar. Gaoshanbao DH, Qingxiu DH, and Xueli. Ten seedlings were transformed in each replicate, and twelve seedlings were transformed in each replicate of Xiaomisong.

[0110] Control group (EV): The four cauliflower varieties were prepared according to the method described in Example 1. Each variety was replicated three times. For each variety, 15 seedlings were transformed in step S3 in each replicate.

[0111] 2. After the injection treatment, the seedlings of the four varieties were cultured for another 30 days to observe the albino phenotype of each variety. Three plants with obvious albino phenotypes were randomly selected from each variety, and three plants were also randomly selected from the control group. The PDS gene silencing efficiency was detected by qRT-PCR reaction.

[0112] (1) Among the above four varieties, Gaoshanbao DH was replicated three times and a total of 27 albino plants were obtained, with a conversion efficiency of 27 / 30=90%; Qingxiu DH was replicated three times and a total of 28 albino plants were obtained, with a conversion efficiency of 28 / 30=93.3%; Xueli was replicated three times and a total of 25 albino plants were obtained, with a conversion efficiency of 25 / 30=83.3%; Xiaomisong was replicated three times and a total of 32 albino plants were obtained, with a conversion efficiency of 32 / 36=88.9%.

[0113] (2) Table 2: Figure 2 The silencing efficiency of the DH control group and the treatment group in B.

[0114]

[0115] Table 3: Figure 2 The silencing efficiency of the DH control group and the treatment group in B.

[0116]

[0117] Table 4: Figure 2 The silencing efficiency of the Shirley control group and the treatment group in B.

[0118]

[0119] Table 5: Figure 2 The silencing efficiency of the control and treatment groups of millet pine in B.

[0120]

[0121] like Figure 2 As shown in Tables 2-5, the silencing efficiency of Gaoshanbao DH is over 90%, Qingxiu DH is no less than 80%, Xueli is no less than 60%, and Xiaomisong is over 85%. All varieties showed obvious albino phenotypes, indicating that the method of this invention can be adapted to cauliflower cultivars with different backgrounds and has good stability.

[0122] Comparative Example

[0123] This comparative example illustrates the impact of different manipulation methods on gene silencing efficiency. The cauliflower variety used in this comparative example is Korso.

[0124] 1. Control group (15 seedlings in the bud stage): The procedure was the same as that of the control group in Example 1.

[0125] 2. Group I (20 seedlings in the bud stage): Operate according to "3. Method of this embodiment" in Example 1.

[0126] 3. Group II (20 seedlings in the bud stage): Only perform "(2) vacuum infection" in "S3, transformation step", "(3) first dark culture after infection" in "S3, transformation step", and "(4) light culture" in "S3, transformation step" step S3 (4) light culture. The test is performed after 30 days of light culture. Do not perform "(5) injection treatment" and "(6) second dark culture after injection" in "S3, transformation step". The rest of the operation is the same as the operation in "3, method of this embodiment" in Example 1.

[0127] 4. Group III (20 seedlings in the bud stage): Only “(5) Injection treatment” and “(6) Second dark culture after injection” of “S3, Transformation Step” were performed. After the second dark culture, the seedlings were cultured under light for 30 days and then tested. “(2) Vacuum infection”, “(3) First dark culture after infection” and “(4) Light culture” of “S3, Transformation Step” were not performed. The remaining operations were the same as those in “3, Method of this Example” in Example 1.

[0128] Table 6: Figure 3 The silencing efficiency of the control group (EV) and groups I-III in B.

[0129]

[0130] like Figure 3 As shown in Table 6, Group I had a silencing efficiency of over 80% and a distinct albino phenotype; Group II had a silencing efficiency of only 30% and a weak albino phenotype, with only a few leaf edges showing yellowing and whitening; Group III had no albino phenotype and a silencing efficiency of approximately 20%. This demonstrates that the combined method of "bud-stage immersion vacuum infection + cotyledon-interval injection infection" of this invention is key to achieving efficient silencing of cauliflower, significantly superior to single treatments and existing techniques.

[0131] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for virus-induced gene silencing in cauliflower, characterized in that: The method includes: vacuum-infecting cauliflower bud seedlings with a transformation bacterial solution and then conducting a first dark culture; then conducting light culture on the seedlings after the first dark culture; then injecting the seedlings after the light culture with the transformation bacterial solution; and then conducting a second dark culture on the seedlings after the injection treatment. The transformation bacterial solution includes: Agrobacterium bacterial solution transformed with PCVA-PDS recombinant silencing vector, and Agrobacterium bacterial solution transformed with PCVB auxiliary vector; In the vacuum impregnation process, the pressure is 0.5~1.0 kPa and the time is 10~40 min; In the injection treatment, the transformation bacterial solution is injected into the cotyledons of the seedlings after the light culture, with 0.1-0.2 mL injected into each cotyledon; the injection is repeated every 3-5 days, for a total of 2-3 injections.

2. The method for virus-induced gene silencing in cauliflower according to claim 1, characterized in that: The recombinant silencing vector is obtained by constructing it using either of the following two methods: Method 1: Link the homologous fragment of the cauliflower PDS gene shown in SEQ ID NO:1 in the sequence listing to the PCVA vector; Method 2: Total RNA extracted from cauliflower leaves is reverse transcribed into cDNA, and then the cDNA is used as a template; or the sequence shown in SEQ ID NO:2 in the sequence listing is used as a template, and PCR amplification is performed using the following specific primers to obtain PCR amplification products; then the PCR amplification products are ligated to the PCVA vector. Upstream primer: 5'-GGAATGGATATCACGGACCGAC-3'; Downstream primer: 5'-AGCCAATAGCTCATAATCCTGCAC-3'.

3. The method for virus-induced gene silencing in cauliflower according to claim 2, characterized in that: The OD of the Agrobacterium tumefaciens culture transformed with the PCVA-PDS recombinant silencing vector 600 =0.8; The OD of the Agrobacterium tumefaciens culture solution transferred into the PCVB auxiliary carrier 600 =0.8; The volume ratio of Agrobacterium tumefaciens culture transformed with PCVA-PDS recombinant silencing vector to Agrobacterium tumefaciens culture transformed with PCVB auxiliary vector is 1:

1.

4. The method for virus-induced gene silencing in cauliflower according to claim 3, characterized in that: The method for obtaining cauliflower seedlings at the bud stage includes: disinfecting plump cauliflower seeds and culturing them at 22~28℃ and 14h / d light conditions until the buds reach a length of 0.5~1cm.

5. The method for virus-induced gene silencing in cauliflower according to claim 1, characterized in that: The conditions for photoculture include: temperature 22~28℃, light duration 12~16h / d, light intensity 2000~3000lx, and air humidity 60~70%; After the aforementioned light cultivation, seedlings with two cotyledons unfolded were obtained.

6. The method for virus-induced gene silencing in cauliflower according to claim 5, characterized in that: The conditions for the first and second dark incubations included: a temperature of 22-28°C and an air humidity of 60-70%. The duration of the first and second dark incubations was 12-36 hours.

7. The method for virus-induced gene silencing in cauliflower according to claim 6, characterized in that: The method for obtaining cauliflower seedlings includes: disinfecting plump cauliflower seeds and then culturing them at 25℃ under light for 14h / d until the sprout length reaches 0.8cm; In the vacuum impregnation process, the pressure is 0.8 kPa and the time is 30 min; The conditions for photoculture include: temperature 25℃, light duration 12~16h / d, light intensity 2500lx, and air humidity 65%; The conditions for the first and second dark incubations included: a temperature of 25°C, an air humidity of 65%, and dark conditions. The duration of both the first and second dark incubation periods was 24 hours.

8. The method for virus-induced gene silencing in cauliflower according to claim 7, characterized in that: The method further includes the following detection steps: After the second dark culture, the seedlings were cultured under light for 20-40 days, and the plant phenotype was observed. The relative expression level of the PDS gene in the plants was detected, and the silencing efficiency was calculated. The conditions for photoculture include: temperature 22~28℃, photo duration 12~16h / d, light intensity 2000~3000lx, and air humidity 60~70%.

Images