Cseif5a2 gene and its encoded protein in citrus somatic embryogenesis
Patent Information
- Application Number
- CN202610803223.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2046-06-05
AI Technical Summary
然而,eIF5A在植物再生,特别是体细胞胚胎发生过程中的功能尚不清楚
[0020]1. 本发明基于拟南芥eIF5A蛋白序列在甜橙中鉴定出同源蛋白CseIF5A2,通过构建CseIF5A2的RNA干扰(RNAi)载体,并将其转化具有体胚发生能力的“伏令夏”胚性愈伤组织中,特异性干扰CseIF5A2基因的表达,能够显著增强其体细胞胚胎发生能力,说明CseIF5A2参与到了柑橘的体细胞胚胎发生的负向调控过程中。
Smart Images

Figure CN122326668B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant biotechnology, specifically relating to the application of a CseIF5A2 gene and its encoded protein in citrus somatic embryogenesis. Background Technology
[0002] Citrus (Citrus L.) is a perennial evergreen fruit tree with significant economic value, ranking among the top-producing fruits (Deng Xiuxin and Peng Shuang, 2013). However, as one of the world's most important fruit crops, its characteristics such as polyembryonic nucellus, long juvenile period, and male and female sterility severely hinder conventional breeding processes (Cai et al 2009, Xu et al 2021). Furthermore, the embryogenic potential of citrus callus tissue decreases or is even completely lost during long-term subculture. Therefore, using biotechnology for genetic improvement of citrus has become an effective breeding approach.
[0003] Somatic embryogenesis (SE) refers to the phenomenon where somatic cells, under specific induction conditions, produce somatic embryos through a series of biological processes (Zimmerman 1993). Plant somatic embryogenesis has advantages such as widespread occurrence, genetic stability, low mutation rate, and high propagation coefficient. Since its first report in carrots in the 1950s (Reinert 1958, Steward et al 1958), somatic embryogenesis has become an important tool in plant biotechnology for propagation, asexual reproduction, and germplasm resource preservation (Williams and Maheswaran 1986). Simultaneously, somatic embryogenesis is also a key regenerative step in genetic improvement through biotechnological means such as screening for somatic clone variations, somatic cell hybridization, and genetic transformation (Duan et al 2007, Guo et al 2013).
[0004] Numerous studies have reported on the molecular regulatory mechanisms of somatic embryogenesis. Research has shown that key embryonic development transcription factors such as LEC1 (LEAFYCOTYLEDON1), LEC2, and FUS3 play a central role in somatic embryo induction (Lotanet et al 1998, Stone et al 2001, Gazzarrini et al 2004). In citrus, genes such as LEC1, FUS3, and L1L have been confirmed to participate in the regulation of somatic embryogenesis, with significantly higher expression levels in embryogenic callus than in non-embryogenic callus (Ge et al 2012, Liu et al 2018). Furthermore, the miR156-SPL module (Long et al 2018), the miR171-SCL module (Feng et al 2023), and the autophagy pathway (Gao et al 2024) have also been found to participate in the regulatory network of citrus somatic embryogenesis.
[0005] Eukaryotic translation initiation factor 5A (eIF5A) is a highly conserved protein in cells and the only protein in eukaryotic cells modified with hydroxyputrescine (Dever et al 2014). Initially considered a translation initiation factor, subsequent studies have shown that it primarily functions in the elongation and termination phases of protein translation (Saini et al 2009, Schuller et al 2017). In addition to its fundamental functions in protein synthesis, eIF5A also plays a role in various physiological processes such as cell proliferation, apoptosis, and autophagy (Lubas et al 2018, Zhang et al 2019). While research on eIF5A in plants is relatively limited, its importance has been demonstrated. In Arabidopsis thaliana (L.) Heynh., three eIF5A genes (AteIF5A1, AteIF5A2, and AteIF5A3) exhibit distinct expression patterns and functions (Thompson et al 2004). AteIF5A1 is primarily expressed in senescent tissues and is involved in the formation of secondary xylem (Liu et al 2008). AteIF5A2 is involved in programmed cell death and stress responses (Feng et al 2007, Hopkins et al 2008), while AteIF5A3 affects plant growth and osmotic stress responses (Ma et al 2010). In crops such as rice and tomato, eIF5A has also been found to participate in developmental regulation and stress responses (Chou et al 2004, Wang et al 2005). However, the function of eIF5A in plant regeneration, particularly in somatic embryogenesis, remains unclear. Therefore, exploring the role of eIF5A in citrus somatic embryogenesis can provide a theoretical basis for improving citrus regeneration efficiency and promote its production application in citrus biotechnology breeding. Summary of the Invention
[0006] Technical Problem to be Solved: Addressing the low efficiency of somatic embryogenesis in citrus and the decline in embryogenic potential after long-term subculturing in existing technologies, this invention aims to explore the application of the CseIF5A2 gene and its encoded protein in citrus somatic embryogenesis. By constructing an RNA interference expression vector for the citrus CseIF5A2 gene and transforming it into embryogenic callus tissue of the 'Folengxia' variety capable of somatic embryogenesis, this invention investigates the role of CseIF5A in citrus somatic embryogenesis and provides target genes, regulatory molecules, and their applications for enhancing citrus somatic embryogenesis. This invention delves into the relationship between the CseIF5A2 gene and the regulatory mechanism of somatic embryogenesis, providing new insights into understanding citrus somatic embryogenesis and holding significant importance for improving citrus yield and quality.
[0007] Technical solution: An application of the CseIF5A2 gene and its encoded protein in citrus somatic embryogenesis, which improves the efficiency of citrus somatic embryogenesis by reducing or inhibiting the expression level of the CseIF5A2 gene in citrus tissues, or by reducing the activity, losing the function, or producing defects in the protein encoded by the CseIF5A2 gene in citrus tissues.
[0008] The CDS sequence of the CseIF5A2 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the CseIF5A2 gene is shown in SEQ ID NO.2.
[0009] The specific methods for improving the efficiency of somatic embryogenesis in citrus include the following steps:
[0010] S1. Clone the CseIF5A2 gene into a vector, construct a CseIF5A2 recombinant expression vector, transform the CseIF5A2 recombinant expression vector into Agrobacterium, and obtain recombinant Agrobacterium;
[0011] S2. Citrus embryogenic callus was cultured in MT medium, and callus with vigorous growth was selected and cultured in MT liquid suspension medium.
[0012] S3. After activating the recombinant Agrobacterium, add it to MT suspension medium containing acetylsuccinone and culture to obtain Agrobacterium liquid;
[0013] S4. Drain the water from the suspended callus tissue, add Agrobacterium tumefaciens solution for infection, and after infection, blot dry with filter paper. Then transfer the callus tissue to MT solid medium containing acetylsuccinone for dark culture.
[0014] S5. The callus tissue after dark culture was transferred to MT medium supplemented with cephalosporin and herbicide for dark culture screening. Subculture was performed once a month. White and tender granules were picked from the newly grown resistant callus and transferred to a new screening medium for repeated purification to obtain transgenic positive callus lines.
[0015] Preferably, the vector in step S1 is an RNA interference vector; the CseIF5A2 recombinant expression vector can inhibit or interfere with the expression of the CseIF5A2 gene.
[0016] Preferably, in step S2, the callus is cultured in MT medium at a temperature of 25-26°C for 20-22 days; the callus is cultured in MT liquid suspension medium at a temperature of 25-26°C, a rotation speed of 110-130 r / min, and a culture time of 4-5 days.
[0017] Preferably, in step S3, the concentration of acetylsuccinone in the MT suspension medium is 50 mg / L; the culture temperature is 28℃; and the OD of the Agrobacterium tumefaciens solution is... 600 It ranges from 0.6 to 0.8.
[0018] Preferably, in step S4, the time for Agrobacterium tumefaciens infection is 20-25 min; the temperature for dark incubation is 22-23℃; and the time for dark incubation is 3-4 days.
[0019] Beneficial effects:
[0020] 1. This invention identifies the homologous protein CseIF5A2 in sweet orange based on the Arabidopsis eIF5A protein sequence. By constructing an RNA interference (RNAi) vector for CseIF5A2 and transforming it into embryogenic callus of *Vol. 'Fol. '*, which has somatic embryogenesis capability, the expression of the CseIF5A2 gene is specifically interfered with, significantly enhancing its somatic embryogenesis capability. This indicates that CseIF5A2 participates in the negative regulation of somatic embryogenesis in citrus.
[0021] 2. This invention clarifies that interfering with CseIF5A2 expression primarily affects the translational level rather than the transcriptional level. Following somatic embryogenesis induction, the mRNA levels of key somatic embryogenesis genes such as LEC1, AGL15, and HB1 in the translational state were significantly higher in callus tissue with interfered CseIF5A2 expression compared to the wild type. This indicates that CseIF5A2 inhibits somatic embryogenesis by negatively regulating the translation efficiency of these genes, deepening our understanding of the role of translational regulatory mechanisms in plant development.
[0022] 3. This invention further suggests that CseIF5A2 may participate in the regulation of somatic embryogenesis by modulating the autophagy-mediated starch metabolism pathway, providing a new perspective for revealing the multi-level regulatory network of citrus somatic embryogenesis.
[0023] 4. This invention systematically reveals the relationship between the CseIF5A2 gene and the regulatory mechanism of somatic embryogenesis, providing new insights into understanding somatic embryogenesis in citrus and offering potential application strategies for improving the yield and quality of citrus. Attached Figure Description
[0024] Figure 1 The results of hydrophilicity / hydrophobicity analysis of eIF5A protein are shown; A~E in the figure: AteIF5A1, AteIF5A2, AteIF5A3, CseIF5A1, and CseIF5A2 proteins, respectively.
[0025] Figure 2 The figures show the predicted transmembrane structure of the eIF5A protein; A to E in the figure represent AteIF5A1, AteIF5A2, AteIF5A3, CseIF5A1, and CseIF5A2 proteins, respectively.
[0026] Figure 3 The results show the predicted signal peptide of the eIF5A protein; A~E in the figure: AteIF5A1, AteIF5A2, AteIF5A3, CseIF5A1, and CseIF5A2 proteins, respectively.
[0027] Figure 4 The results show the predicted phosphorylation sites of the eIF5A protein; A~E in the figure: AteIF5A1, AteIF5A2, AteIF5A3, CseIF5A1, and CseIF5A2 proteins, respectively.
[0028] Figure 5 The figures show the predicted secondary and tertiary structures of the eIF5A protein; A~E: secondary structures of AteIF5A1, AteIF5A2, AteIF5A3, CseIF5A1, and CseIF5A2 proteins, respectively; F~J: tertiary structures of AteIF5A1, AteIF5A2, AteIF5A3, CseIF5A1, and CseIF5A2 proteins, respectively.
[0029] Figure 6 Analysis of conserved domains and conserved motifs of AteIF5A and CseIF5A; A: conserved domain, B: conserved motif in the figure;
[0030] Figure 7 Analysis of cis-components for the eIF5A promoter;
[0031] Figure 8 Sequence analysis of the CseIF5A protein;
[0032] Figure 9Phylogenetic tree of eIF5A protein;
[0033] Figure 10 Positive detection of CseIF5A transgenic callus lines; M in the figure: DL2000 molecular weight standard, lanes 1 and 22: wild-type "Volsley" callus control, lanes 2-17: "Volsley" callus lines transfected with CseIF5A1 interference vector, lanes 18-21, 23-33: "Volsley" callus lines transfected with CseIF5A2 interference vector;
[0034] Figure 11 The figure shows the expression level of the target gene in the CseIF5A transgenic callus line; A: expression level of CseIF5A1 gene in the "Fulingxia" callus line transgenic with CseIF5A1 interference vector; B: expression level of CseIF5A2 gene in the "Fulingxia" callus line transgenic with CseIF5A2 interference vector; the numbers represent different transgenic lines; Actin was used as an internal reference gene, and t-test was used for statistical analysis. Different * represent significant differences relative to the wild-type control group (*P < 0.05, **P < 0.01, ***P < 0.001), and the error bar is based on the standard deviation of four replicates;
[0035] Figure 12 Phenotypic observation of embryogenesis ability of wild-type and CseIF5A-interfered callus lines of *Volstigmata*. WT represents wild-type *Volstigmata* callus, amir-CseIF5A1 represents *Volstigmata* callus with CseIF5A1 interference, and amir-CseIF5A2 represents *Volstigmata* callus with CseIF5A2 interference. 0 d, 30 d, 60 d, and 90 d refer to the number of days of induction on glycerol-induced medium. The scale bar is 2.5 mm.
[0036] Figure 13 To compare the callus embryogenesis ability of wild-type and CseIF5A-interfered *Volentina*, a t-test was used for statistical analysis. Different values represented by * indicate significant differences compared to the wild-type control group (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). The error bar is based on the standard deviation of five replicates.
[0037] Figure 14Cellular observation of *Volentina 'Volentina' callus with CseIF5A2 interference from wild-type callus; Figure A: Paraffin sections of wild-type and CseIF5A2 interference callus induced for 90 days on glycerol-induced medium, scale bar is 100 μm; B: Cell area statistics of paraffin sections. Statistical analysis was performed using t-test. Different * represent significant differences compared to the wild-type control group (*P < 0.05, **P < 0.01, ***P < 0.001). Error bar is based on the standard deviation of 100 cells.
[0038] Figure 15 The figures show the expression levels of genes related to somatic embryogenesis during somatic embryogenesis induction; WT: wild-type *Volentina var. *fermentans* callus, amir-CseIF5A2: *Volentina var. *fermentans* callus with CseIF5A2 interference expression; 0 d, 7 d, 14 d, 21 d, and 28 d represent the number of days of induction on glycerol-induced medium; Actin was used as an internal reference gene, and one-way ANOVA was used for statistical analysis. Different * represent significant differences relative to the wild-type control group (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001), and the error bar is based on the standard deviation of four replicates.
[0039] Figure 16 This image shows the polyribosome analysis and global translation efficiency comparison between wild-type callus and *Volentina salina* callus with CseIF5A2 interference expression. Figures A, B, C, and D represent callus tissues grown on MT medium (0 days of induction), 4 days, 7 days, and 14 days of induction on glycerol-induced medium, respectively. Translational activity was quantified using the ratio of polymers to monomers. Statistical analysis was performed using a t-test. Different values * represent significant differences compared to the wild-type control group (*P < 0.05, **P < 0.01, ***P < 0.001). Error bars are based on the standard deviation of three replicates.
[0040] Figure 17 The mRNA content of genes related to somatic embryogenesis in the translational state during somatic embryogenesis induction is shown in the figure; WT: wild-type *Volentina* callus, amir-CseIF5A2: *Volentina* callus with interference of CseIF5A2 expression; 0 d, 4 d, 7 d, and 14 d refer to the number of days of induction on glycerol-induced medium; Actin is used as an internal reference gene, and one-way ANOVA was used for statistical analysis. Different * represent significant differences relative to the wild-type control group (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001), and the error bar is based on the standard deviation of four replicates;
[0041] Figure 18 Autophagosome observation of wild-type callus and *Volstalinia fraseri* callus with CseIF5A2 expression interference; WT: wild-type *Volstalinia fraseri* callus, amir-CseIF5A2: *Volstalinia fraseri* callus with CseIF5A2 expression interference; MT: callus tissue grown on MT medium; EIM: callus tissue induced for 4 days on glycerol-induced medium; scale bar is 10 μm;
[0042] Figure 19 Starch content was observed in wild-type callus and *Vol. truncatula* callus with CseIF5A2 expression interference. In the figure, WT represents wild-type callus, amir-CseIF5A2 represents *Vol. truncatula* callus with CseIF5A2 expression interference, MT represents callus tissue grown on MT medium, and EIM represents callus tissue induced for 8 days on glycerol-induced medium. The scale bar is 50 μm. Detailed Implementation
[0043] The present invention will be further described below with reference to embodiments. These embodiments are illustrative of the present invention, but the present invention is not limited to these embodiments:
[0044] Plant material: Embryogenic callus of "Valencia" sweet orange (Citrus sinensis 'Valencia') was obtained from the National Key Laboratory of Germplasm Innovation and Utilization of Fruit, Vegetable and Horticultural Crops, Huazhong Agricultural University, and propagated and preserved in our laboratory. The callus was cultured on MT solid medium, subcultured approximately every 20 days, and cultured in a culture room at 25℃ with 16 h light / 8 h dark.
[0045] Strains and vectors: The Agrobacterium strain used in this experiment was GV3101, purchased from Beijing Qingke Biotechnology Co., Ltd.; the autophagosome marker vector GFP-ATG8a used to infect callus tissue was kindly provided by Professor Wang Pengwei of Huazhong Agricultural University.
[0046] Culture medium and formulation:
[0047] (1) MT solid culture medium (1 L): Weigh 63 g of MT powder (purchased from Qingdao Haibo Biotechnology Co., Ltd.) into 1 L of ddH2O, heat to dissolve, and sterilize at 121℃ for 15 min.
[0048] (2) MT suspension medium (1 L): Measure 10 mL of VB, VC, inositol, trace elements, iron salt, glycine, 100 mL of macro-elements, weigh 40 g of sucrose, 0.5 g of malt extract, and 1.5 g of L-glutamine, add ddH2O to make up to 1 L, stir thoroughly to dissolve, adjust pH to 5.8~5.85, sterilize at 121℃ for 15 min.
[0049] (3) Glycerol-induced medium (1 L): Measure 10 mL of VB, VC, inositol, trace elements, iron salt, glycine, 100 mL of macro-elements, and 20 mL of glycerol, add ddH2O to make up to 1 L, stir to dissolve thoroughly, adjust pH to 5.8~5.85, add 8 g of agar, and sterilize at 121℃ for 15 min.
[0050] (4) LB medium (1 L): Weigh 10 g tryptone, 5 g yeast extract and 10 g sodium chloride into a beaker, add ddH2O to make up to 1 L, stir to dissolve (add 15 g agar powder to solid medium), sterilize at 121℃ for 15 min.
[0051] Example 1
[0052] This example describes the bioinformatics analysis of CseIF5A1 and CseIF5A2 proteins. The specific method includes the following steps:
[0053] The AteIF5A protein sequence was downloaded from the Arabidopsis database TAIR (https: / / www.Arabidopsis.org / ), and homologous proteins were found by BLAST alignment using the Arabidopsis eIF5A protein sequence in the Citrus Genome Database CPBD (http: / / Citrus.hzau.edu.cn / index.php). The physicochemical properties of AteIF5A and CseIF5A proteins, including molecular weight, amino acid composition, isoelectric point, and instability index, were analyzed using the Protparam online website (http: / / web.expasy.org / protparam / ). The hydrophilicity and hydrophobicity of the proteins were predicted using the ProtScale website (https: / / web.expasy.org / protscale / ). Transmembrane domains were predicted using the TMHMM2.0 online website (http: / / www.cbs.dtu.dk / services / TMHMM-2.0 / ). The signal peptide was predicted using the SignalP 5.0 online website (https: / / services.healthtech.dtu.dk / ). The phosphorylation sites of proteins were predicted using the NetPhos 3.1 website (http: / / www.cbs.dtu.dk / services / NetPhos / ). Subcellular localization of proteins was predicted using the WoLF PSORT website (https: / / wolfpsort.hgc.jp / ). Secondary and tertiary structures of AteIF5A and CseIF5A proteins were predicted using the online websites SOPMA and SWISS-MODEL (https: / / swissmodel.expasy.org / ). Conserved domains of proteins were analyzed online using the NCBI Conserved Domain Database (https: / / www.ncbi.nlm.nih.gov / cdd). Conserved motifs of proteins were predicted and analyzed using MEME (https: / / meme-suite.org / meme / tools / meme), with a motif count set to 10, and visualized using TBtools software. The DNA base sequence 2000 bp upstream of the start codon ATG of the AteIF5A and CseIF5A genes was used as the promoter sequence. Cis-regulatory elements in the promoter sequence were analyzed using the Plant CARE online software (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / htmL / ), and the cis-regulatory elements in the promoter region were plotted using TBtools.eIF5A sequences from 13 species, including Arabidopsis thaliana, citrus, rice, and maize, were selected and multiple sequence alignment analysis was performed using DNAMAN 9 software with default parameters. Phylogenetic trees were then constructed using the neighbor-joining method with MEGA 11 software and the Bootstrap test was performed 1000 times.
[0054] This invention identifies two homologous proteins, CseIF5A1 and CseIF5A2, in sweet orange based on the Arabidopsis eIF5A protein sequence. For example... Figures 1-4 As shown, both CseIF5A1 and CseIF5A2 are stable acidic hydrophilic proteins. Figure 1 ), without transmembrane structure ( Figure 2 ) and signal peptides ( Figure 3 ), has multiple phosphorylation sites ( Figure 4 Subcellularly, both are located in the nucleus and cytoplasm. Protein structure prediction shows that both contain a conserved PLN03107 domain. Figure 5 ) and 5 conserved motifs ( Figure 6 Promoter analysis revealed that the CseIF5A gene contains multiple cis-regulatory elements, including those for light response, hormone response, and stress response. Figure 7 Phylogenetic analysis showed that eIF5A is highly conserved in plants. Figure 9 ).
[0055] Example 2
[0056] This embodiment describes the construction of CseIF5A2 transgenic callus material, and the specific method includes the following steps:
[0057] S1. Constructing the RNA interference vector amir-CseIF5A2 for CseIF5A2: (1) Using the online tool Web MicroRNA Designer (WMD2, http: / / wmd2.weigelworld.org), a specific artificial miRNA was designed with the coding region (CDS) of the CseIF5A2 gene as the target sequence to replace the mature miRNA and its complementary sequence in the endogenous miR319a precursor; the four oligonucleotide sequences are shown below:
[0058] CseIF5A2-miRNA-Ⅰ: gaTAACAAAGTGGCACTTAGCCTtctctcttttgtattcc (SEQ IDNO.4);
[0059] CseIF5A2-miRNA-Ⅱ: gaAGGCTAAGTGCCACTTTGTTAtcaaagagaatcaatga (SEQ IDNO.5);
[0060] CseIF5A2-miRNA-Ⅲ: gaAGACTAAGTGCCAGTTTGTTTtcacaggtcgtgatatg (SEQ IDNO.6);
[0061] CseIF5A2-miRNA-IV: gaAAACAAACTGGCACTTAGTCTtctacatatatattcct (SEQ IDNO.7);
[0062] (2) Using plasmid pRS300 (containing the miR319a precursor cloned from the SmaI site of the pBSK vector) as a PCR template, and using two universal primer sequences located outside the multiple cloning site (primer A (SEQ ID NO.8): 5'-CTGCAAGGCGATTAAGTTGGGTAAC-3', primer B (SEQ ID NO.9): 5'-GCGGATAACAATTTCACACAGGAAACAG-3'), a two-round overlapping PCR strategy was employed to introduce the designed amiRNA sequence into the miR319a precursor backbone; the first round of PCR reaction established three 50 µL PCR reaction systems, each containing: 5 µL 10×PCR buffer (containing Mg 2+), 5 µL dNTPs (2 mM), 2 µL each of upstream and downstream primers (10 µM), 2 µL 1:100 diluted pRS300 plasmid DNA, 0.5 µL Pfu DNA polymerase, 33.5 µL ddH2O; The PCR reaction program is: 95℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 24 cycles; and finally 72℃ extension for 7 min; The primer combinations and templates for the three reactions are shown in Table 1. After the PCR products are separated by 2% agarose gel electrophoresis, the target fragments are cut and recovered, and eluted in 20 µL ddH2O; (3) For the second round of PCR reaction, 0.5 µL each of the first round PCR products (a), (b), and (c) are taken as templates, and primers A and B are used as upstream and downstream primers, and the reaction is carried out at 50℃. Fusion PCR was performed in µL reaction system. The reaction components were the same as in the first round except for the template. The reaction program was: 95℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min 30 s, for a total of 24 cycles; and finally 72℃ extension for 7 min. The fusion product was detected by 1% agarose gel electrophoresis. The fragment containing the modified amiRNA precursor (about 800 bp) was excised and recovered and eluted in 20 µL ddH2O. (4) These amplification products were inserted into the corresponding sites of the PFGC5941 plasmid vector through homologous recombination and transformed into competent Escherichia coli cells. Positive bacterial solutions were selected for sequencing. The bacterial solutions with the correct positive sequence were selected for preservation and plasmid extraction to obtain the RNA interference vector amir-CseIF5A2.
[0063] Table 1 Primer Combinations and Templates
[0064]
[0065] S2. Agrobacterium transformation: (1) Take GV3101 Agrobacterium competent cells stored at -80℃, thaw them on ice, and add 10 μL of amir-CseIF5A2 plasmid DNA; (2) Place the competent cells with added plasmid on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and on ice for 5 min; (3) Add 700 μL of antibiotic-free LB liquid medium to centrifuge tubes in a clean bench, mix well, and incubate at 28℃ and 200 r / min in a constant temperature shaker for 2-3 h; (4) After incubation, centrifuge at 6000 r / min for 1 min, discard the supernatant, leave 100 μL of supernatant, gently resuspend the bacterial blocks, spread them on LB solid medium containing kanamycin and rifampin, and incubate upside down in a 28℃ incubator for 2-3 d; (5) Pick single clones, add 1.5 mL of LB liquid medium containing kanamycin and rifampin, and then incubate at 28℃ and 200 r / min in a constant temperature shaker for 2-3 h. (6) Take the overnight cultured bacterial solution for bacterial PCR detection. Take 500 μL of the correct bacterial solution and add an equal volume of 50% glycerol. Store in a -80℃ freezer. Take another 750 μL of bacterial solution in 50 mL of MT suspension medium containing 50 mg / L acetylsuccione (AS) for Agrobacterium infection.
[0066] S3. Genetic transformation of callus: (1) Preparation of callus material: After the callus has grown on MT medium for about 20 days, select the callus with vigorous growth and transfer it to MT liquid suspension medium. Incubate at 25℃ and 120 r / min for 4-5 days; (2) Preparation of Agrobacterium infection medium: Agrobacterium carrying the CseIF5A2 RNA interference vector is activated and added to MT suspension medium containing 50 mg / L acetylsuccinone. Incubate at 28℃ until OD. 600 The value is 0.6~0.8; (3) Infection and co-culture: Drain the water from the suspended callus tissue, add Agrobacterium tumefaciens solution for infection, blot dry with filter paper and transfer to MT solid medium containing acetylsuccinone, and co-culture in the dark at 23℃ for 3 days; (4) Screening culture: Transfer the co-cultured callus tissue to MT medium with added cephalosporin and corresponding antibiotics, screen in the dark at 28℃, subculture once a month until resistant callus grows; (5) Obtaining resistant callus: Pick the white and tender particles from the newly grown resistant callus and transfer them to a new screening medium, repeat the purification, and obtain a stable pure positive callus tissue single line;
[0067] S4. DNA was extracted from the callus tissue of transgenic citrus and positive PCR was performed using the primers Kan-F (SEQ ID NO. 10) and Kan-R (SEQ ID NO. 11) for the kanamycin resistance gene shown in Table 2. The PCR reaction system and procedure are shown in Table 3 and Table 4.
[0068] Table 2 PCR Primers
[0069]
[0070] Table 3 PCR reaction system
[0071]
[0072] Table 4 PCR reaction procedure
[0073]
[0074] Comparative Example 1
[0075] The difference between this comparative example and Example 2 is that the callus material in this example is wild-type "Virginia", while the other steps are the same as in Example 2.
[0076] Comparative Example 2
[0077] The difference between this comparative example and Example 2 is that in this example, the CseIF5A2 RNA interference vector amir-CseIF5A2 is replaced with the CseIF5A1 RNA interference vector amir-CseIF5A1. The remaining steps are the same as in Example 2. The construction method of the vector amir-CseIF5A1 includes the following steps:
[0078] S1. Using the online tool Web MicroRNA Designer (WMD2, http: / / wmd2.weigelworld.org), specific artificial miRNAs were designed with the coding region (CDS) of the CseIF5A1 gene as the target sequence (as shown in SEQ ID NO.3) to replace the mature miRNA and its complementary sequence in the endogenous miR319a precursor. The four oligonucleotide sequences are shown below:
[0079] CseIF5A1-miRNA-Ⅰ: gaTTACAAAGTGACACTTGGCAGtctctcttttgtattcc (SEQ IDNO.12);
[0080] CseIF5A1-miRNA-Ⅱ: gaCTGCCAAGTGTCACTTTGTAAtcaaagagaatcaatga (SEQ IDNO.13);
[0081] CseIF5A1-miRNA-Ⅲ: gaCTACCAAGTGTCAGTTTGTATtcacaggtcgtgatatg (SEQ IDNO.14);
[0082] CseIF5A1-miRNA-IV: gaATACAAACTGACACTTGGTAGtctacatatattattcct (SEQ IDNO.15);
[0083] S2. Using plasmid pRS300 (containing the miR319a precursor cloned from the SmaI site of the pBSK vector) as a PCR template, and employing two universal primer sequences located outside the multiple cloning site (primer A (SEQ ID NO. 8): 5'-CTGCAAGGCGATTAAGTTGGGTAAC-3'; primer B (SEQ ID NO. 9): 5'-GCGGATAACAATTTCACACAGGAAACAG-3'), a two-round overlapping PCR strategy was used to introduce the designed amiRNA sequence into the miR319a precursor backbone. Subsequently, a two-round overlapping PCR strategy was used to introduce the designed amiRNA sequence into the miR319a precursor backbone. For the first round of PCR, three 50 µL PCR reaction systems were established, each containing: 5 µL of 10×PCR buffer (containing Mg...). 2+ The PCR reaction consisted of 5 µL dNTPs (2 mM), 2 µL each of upstream and downstream primers (10 µM), 2 µL pRS300 plasmid DNA diluted 1:100, 0.5 µL Pfu DNA polymerase, and 33.5 µL ddH2O. The PCR reaction program was as follows: 95°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 40 s, for a total of 24 cycles; and a final extension at 72°C for 7 min. The primer combinations and templates for the three reactions are shown in Table 5. After the PCR products were separated by 2% agarose gel electrophoresis, the target fragments were excised and recovered, and eluted in 20 µL ddH2O.
[0084] Table 5 Primer Combinations and Templates
[0085]
[0086] S3. For the second round of PCR, 0.5 µL each of the first round PCR products (a), (b), and (c) were used as templates. Using primers A and B as upstream and downstream primers, fusion PCR was performed in a 50 µL reaction system. The reaction components were the same as in the first round except for the template. The reaction program was as follows: 95°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min 30 s, for a total of 24 cycles; and finally, 72°C extension for 7 min. The fusion products were detected by 1% agarose gel electrophoresis. The fragment containing the modified amiRNA precursor (approximately 800 bp) was excised from the gel and recovered, and eluted in 20 µL ddH2O.
[0087] S4. These amplification products were inserted into the corresponding sites of the PFGC5941 plasmid vector via homologous recombination and transformed into competent E. coli cells. Positive bacterial cultures were selected for sequencing, and bacterial cultures with correct positive sequences were selected for preservation and plasmid extraction to obtain the vector amir-CseIF5A1.
[0088] like Figures 10-11 As shown, this invention involves constructing an RNA interference vector for CseIF5A1 and transforming it into *Volentina* embryogenic callus capable of somatic embryogenesis. DNA positivity was detected (…). Figure 10 ) and qRT-PCR expression level detection ( Figure 11 The expression levels of CseIF5A1 in the CseIF5A1 interference callus line were significantly lower than those in the wild-type callus, and the expression levels of CseIF5A2 in the CseIF5A2 interference callus line were significantly lower than those in the wild-type callus, proving that the vector transformation was successful, the transgenic material was successfully constructed, and the interference expression transgenic lines of CseIF5A1 (Comparative Example 2) and CseIF5A2 (Example 2) were obtained.
[0089] Example 3
[0090] This embodiment describes the effect of interfering with CseIF5A2 expression on somatic embryogenesis in citrus, and the specific method includes the following steps:
[0091] S1. Callus tissue with good growth status after being subcultured on MT medium for about 20 days was transferred to medium containing 20% glycerol for somatic embryogenesis induction. It was cultured at 25℃ under 16 h light / 8 h dark conditions, and subcultured every 30 days.
[0092] S2. Take callus tissue induced on glycerol induction medium for 90 days, take 3 bottles from each callus line, and randomly take 3 samples from each bottle. Blot dry the water on the surface of the callus, weigh about 0.1 g of callus tissue and count the number of somatic embryos under a stereomicroscope. The somatic embryogenesis capacity is expressed by the number of somatic embryos per g of callus tissue.
[0093] like Figure 12 As shown, after 90 days of induction, callus tissue interfering with CseIF5A2 expression (Example 2) began to show spherical embryos at 60 days of induction, and the number of somatic embryos increased significantly by 90 days, producing a large number of green somatic embryos. In contrast, wild-type callus tissue (Comparative Example 1) only showed a small number of green somatic embryos by 90 days. Callus tissue interfering with CseIF5A1 expression (Comparative Example 2) turned yellow during induction, but only a few calluses produced very small green somatic embryos by 90 days.
[0094] like Figure 13As shown, the number of somatic embryos was statistically analyzed, revealing that the callus with interfered CseIF5A2 expression (Example 2) produced significantly more somatic embryos than the wild-type callus (Comparative Example 1) (P<0.0001), while the callus with interfered CseIF5A1 expression (Comparative Example 2) showed no significant difference from the wild-type (Comparative Example 1). These results indicate that specifically interfering with CseIF5A2 expression can significantly enhance the somatic embryogenesis ability of *Village ferns* callus.
[0095] Example 4
[0096] This example illustrates the cellular observation of callus lines with interference with CseIF5A2 expression. The specific method includes the following steps:
[0097] S1. Paraffin Sectioning: Callus material was fixed with FAA fixative for 24 h, rinsed with distilled water to remove the fixative, and then washed three times with 70% ethanol for 30 min each time. The material was then dehydrated using a series of ethanol solutions (85% ethanol, 95% ethanol, and anhydrous ethanol, 1 h each). A clearing agent was then used to replace the dehydrating agent in the tissue, allowing paraffin to penetrate the plant tissue (first aspirate 1 / 5 of the reagent, add 1 / 5 chloroform; second aspirate 2 / 5 of the reagent, add 2 / 5 chloroform, until all is replaced with fresh chloroform). Following this, paraffin embedding was performed (adding crushed paraffin → 50% paraffin cup → 70% paraffin cup → pure paraffin A cup → pure paraffin B cup → pure paraffin C cup → embedding), allowing the paraffin embedding agent to penetrate the tissue and replace the clearing agent. Finally, the paraffin blocks were divided and trimmed, and sectioned using a paraffin microtome (Leica). Sectioning was performed using RM2265. The wax strip was adhered to the slide using egg white and glycerin. The slide was then placed in a slide dryer (around 36°C) to allow the wax strip to stretch due to heat. After observation under a microscope, slides with intact tissue structures were selected and dried in an oven (around 38°C).
[0098] S2. HE (Hematoxylin-Eosin) staining: Dewax the baked slide twice in a dewaxing tank containing xylene, 5-10 min each time; then hydrate with a gradient of ethanol (two times with anhydrous ethanol, one time each with 90% ethanol, 80% ethanol, and 70% ethanol, 3-5 min each time), and rinse with tap water for 1-3 min; then stain with hematoxylin for 5 min, rinse with tap water for 5 s, differentiate with 1% hydrochloric acid ethanol for 2-5 s, rinse with tap water for 20-30 s, counterstain with eosin for 3-5 min, and rinse with tap water for 30 s; then dehydrate with a gradient of ethanol (two times each with 80% ethanol and 90% ethanol, 10-20 s each time, two times each with 95% ethanol and anhydrous ethanol, 1-2 min each time), then clear with xylene three times, 2-3 min each time, and finally mount with neutral resin and observe under a microscope.
[0099] like Figure 14As shown, paraffin sectioning was used to observe the cytological morphology of wild-type callus (Comparative Example 1) and callus with interfered CseIF5A2 expression (Example 2). It was found that the callus cells with interfered CseIF5A2 expression (Example 2) exhibited a highly ordered arrangement, with a significantly smaller cell area than the wild-type (P<0.001), displaying a typical embryonic callus morphology. In contrast, the wild-type callus cells (Comparative Example 1) were irregularly arranged, with increased intercellular spaces and a larger cell area.
[0100] Example 5
[0101] This embodiment analyzes the expression of genes related to somatic embryogenesis, and the specific method includes the following steps:
[0102] S1. RNA was extracted from wild-type and CseIF5A2-interfering callus tissues induced on glycerol-induced medium for 0, 7, 14, 21 and 28 days, reverse transcribed into cDNA, and the cDNA was diluted 10-fold. Using Actin as the reference gene, genes related to somatic embryogenesis (LEC1, LEC2, FUS3, L1L, SERK, ABI3, AGL15, RKD4, etc.) were analyzed.
[0103] S2. Primer sequences for reference genes and somatic embryogenesis-related genes are shown in Table 6. The qRT-PCR reaction system and procedure are shown in Tables 7 and 8. The qRT-PCR reaction consisted of 45 cycles, with gene expression levels for each sample checked four times as technical replicates. The prepared reaction system was run on a Roche LightCycler 480 real-time PCR instrument. PCR specificity was determined based on melting curves. -△△Ct The relative expression levels of the target gene were calculated and plotted using Graphpad Prism software.
[0104] Table 6 qRT-PCR primer sequences
[0105]
[0106] Table 7 qRT-PCR reaction system
[0107]
[0108] Table 8 qRT-PCR reaction procedure
[0109]
[0110] like Figure 15 As shown, the expression levels of most genes showed a trend of first increasing and then decreasing during the induction process, but there was no stable and significant difference between the callus that interfered with CseIF5A2 expression and the wild type, indicating that CseIF5A2 mainly plays a role at the post-transcriptional level.
[0111] Example 5
[0112] This embodiment describes polyribosome analysis, and the specific method includes the following steps:
[0113] S1. Polyribosome analysis was performed on wild-type and CseIF5A2-interfering callus tissues induced on glycerol-induced medium for 0, 4, 7 and 14 days.
[0114] S2. Prepare 50 mL of 15% and 60% sucrose solutions in advance, and prepare the gradient using a Biocomp density gradient generator. Let the prepared sucrose gradient stand at 4℃ for 2 h.
[0115] S3. Grind the callus tissue into powder using liquid nitrogen, place it into an enzyme-free 2 mL centrifuge tube, add 1 mL of lysis buffer (100 mM KCl, 5 mM MgCl2, 200 mM Tris-HCl, 2% Triton X-100, 100 μg / mL CHX, 5 mM DTT), extract on ice for 30 min, vortex 3 times during extraction, and centrifuge at 12000 r / min for 15 min at 4℃.
[0116] S4. Take the supernatant and add it to the sucrose gradient surface. After strict balancing, centrifuge at 35,000 r / min for 3 h at 4 °C in an ultracentrifuge.
[0117] S5. After centrifugation, the components were separated using the Biocomp fully automated density gradient separation system and the A260 absorbance of each separation gradient was measured.
[0118] S6. RNA was extracted from the polyribosome components, reverse transcribed to obtain cDNA, and then qRT-PCR was performed to detect the content of mRNA being translated.
[0119] like Figure 16 As shown, the number of polyribosomes in callus tissue with impaired CseIF5A2 expression grown on MT medium was not different from that in wild-type callus tissue, although the number of ribosomal subunits was slightly higher, and the overall translational activity was not significantly different. After somatic embryonic induction, the number of 40S and 60S subunits in callus tissue with impaired CseIF5A2 expression was significantly higher than that in wild-type callus, while the number of 80S ribosomal monomers and polyribosomes was slightly higher than that in wild-type callus. This indicates that ribosomal subunits failed to effectively assemble into monomers for translational activity, suggesting that translation initiation may be inhibited, leading to a decrease in overall translational activity.
[0120] like Figure 17As shown, mRNA was extracted from polyribosome fractions based on ribosome separation curves. After reverse transcription, the relative content of mRNAs of genes related to somatic embryogenesis that are being translated in this fraction was detected by qRT-PCR. It was found that in callus that interfered with CseIF5A2 expression, the content of mRNAs of genes such as LEC1, AGL15, and HB1 that were being translated was significantly higher than that of wild type, indicating that eIF5A2 may affect somatic embryogenesis by negatively regulating the translation efficiency of these key genes.
[0121] Example 6
[0122] This embodiment observes autophagy activity and starch content, and the specific method includes the following steps:
[0123] S1. Construction of GFP-ATG8a vector: (1) Using the AtATG8a gene in Arabidopsis thaliana as a reference sequence, the corresponding citrus ATG gene was found in the Citrus tangerine genome database by BLAST alignment. Primers were designed based on the full-length CDS sequence and adapters for the corresponding vector were added. The primer sequences were FhATG8a-pFN-F (SEQ ID NO.44): GCATGGACGAGCTGTACAAGTCTAGAATGATGTTCATCTGTTTCAAATTTG; FhATG8a-pFN-R (SEQ ID NO.44). NO.45): CGCTTTACTTGTACGGATCCTTAAAATGACCAACCGAAGGTATTC; (2) The target gene sequence was amplified using cDNA of Citrus aurantiacus as a template. The PCR reaction system is shown in Table 9, and the PCR amplification program is shown in Table 10. After detection by agarose gel electrophoresis, the bands corresponding to the size of the target gene were cut off, and the target gene DNA was recovered using a DNA product gel purification and recovery kit (TIANGEN Beijing); (3) pFNHG19 was linearized after double digestion with XbaI and BamHI. The enzyme digestion reaction system is shown in Table 11, and the reaction was carried out at 37℃ for 4 h; (4) The gene FhATG8a was homologously recombined into the pFNHG19 vector using the Smart Assembly Cloning Kit. The homologous recombination reaction system is shown in Table 12, and the reaction was carried out at 50℃ for 30 min; (5) 5 μL of the reaction mixture was transformed into DH5α competent cells;
[0124] Table 9 PCR Reaction System
[0125]
[0126] Table 10 PCR reaction procedure
[0127]
[0128] Table 11 pFNHG19 double enzyme digestion system
[0129]
[0130] Table 12 Homologous Recombination System
[0131]
[0132] S2. Autophagosome observation: The GFP-ATG8a vector was transformed into wild-type "Volentina" callus and "Volentina" callus with CseIF5A2 expression interference. The specific steps were the same as in Example 1. The selected positive callus was transferred to glycerol induction medium for somatic embryo induction. A small amount of callus was placed in a centrifuge tube containing MT liquid medium and gently pipetted to suspend the callus. A small amount of suspended callus was aspirated into the groove of a glass slide, and a coverslip was slowly covered. The slide was then observed and photographed under a fluorescence microscope (Olympus BX63).
[0133] S3. Starch staining: Take a small amount of wild-type "Volscha" callus induced for 8 days on glycerol-induced medium and "Volscha" callus with interference CseIF5A2 expression on a glass slide, flatten it, add an appropriate amount of Lugol's staining solution (1% I2 + 2% KI solution) and stain for 30 s, then wash with ddH2O for 15 min, add an appropriate amount of clearing agent, cover with a coverslip, place in a refrigerator at 4℃ overnight, and then observe and photograph under a differential interference microscope.
[0134] like Figure 18 As shown, compared with callus cultured on MT medium, both wild-type callus and callus with CseIF5A2 expression interference showed an increase in the number of autophagosomes after somatic embryonic induction. Furthermore, 4 days after somatic embryonic induction, the number of autophagosomes in callus with CseIF5A2 expression interference was greater than that in wild-type callus, indicating that interfering with CseIF5A2 expression can enhance autophagy activity.
[0135] For example Figure 19As shown, compared with callus cultured on MT medium, the starch content was significantly reduced after transfer to glycerol-inducible medium (EIM) for somatic embryogenesis induction. Furthermore, the starch content in callus with interfered CseIF5A2 expression was significantly lower than that in wild-type callus. This is consistent with the previously observed increase in autophagosome numbers after induction, particularly in callus with interfered CseIF5A2 expression, suggesting that eIF5A may affect starch content and thus somatic embryogenesis through autophagy. Autophagosome labeling and starch staining revealed that after somatic embryogenesis induction, the number of autophagosomes in callus with interfered CseIF5A2 expression was significantly higher than in wild-type, while the starch content was significantly lower. This indicates that CseIF5A2 may also participate in regulating somatic embryogenesis by modulating the autophagy-mediated starch metabolism pathway.
[0136] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention, or modify them into equivalent embodiments, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention, without departing from the content of the technical solutions of the present invention, shall still fall within the scope of protection of the present invention.
Claims
1. The application of a reagent that inhibits CseIF5A2 gene expression in citrus somatic embryogenesis, characterized in that: The reagent used to inhibit CseIF5A2 gene expression is a specific artificial miRNA as shown in SEQ ID NO.4~SEQ ID NO.
7. By reducing the expression level of the CseIF5A2 gene in citrus tissues, it improves the efficiency of citrus somatic embryogenesis. The specific method for improving the efficiency of citrus somatic embryogenesis includes the following steps: S1. Using the CDS of the CseIF5A2 gene as the target sequence, a specific artificial miRNA was designed to replace the mature miRNA and its complementary sequence in the endogenous miR319a precursor; the CDS sequence of the CseIF5A2 gene is shown in SEQ ID NO.1, the amino acid sequence of the protein encoded by the CseIF5A2 gene is shown in SEQ ID NO.2, and the nucleotide sequence of the specific artificial miRNA is shown in SEQ ID NO.4~SEQ ID NO.
7. S2. Using plasmid pRS300 containing the miR319a precursor cloned from the SmaI site of the pBSK vector as a PCR template, and employing two universal primer sequences located outside the multiple cloning site, a two-round overlapping PCR strategy was used to introduce the designed miRNA sequence into the miR319a precursor backbone to obtain the amplification product; the nucleotide sequences of the universal primers are shown in SEQ ID NO.8 and SEQ ID NO.9; S3. The amplification product was inserted into the PFGC5941 plasmid vector via homologous recombination and transformed into E. coli competent cells to obtain the RNA interference vector amir-CseIF5A2. S4. Transform the RNA interference vector amir-CseIF5A2 into Agrobacterium to obtain recombinant Agrobacterium; S5. Citrus embryogenic callus was cultured in MT medium, and callus with vigorous growth was selected and cultured in MT liquid suspension medium. S6. After activating the recombinant Agrobacterium, add it to MT suspension medium containing acetylsuccinone and culture it to obtain Agrobacterium liquid; S7. Drain the water from the suspended callus tissue, add Agrobacterium tumefaciens solution for infection, and after infection, blot dry with filter paper. Then transfer the callus tissue to MT solid medium containing acetylsyleugenol for dark culture. S8. The callus tissue after dark culture was transferred to MT medium supplemented with cephalosporin and herbicide for dark culture screening. Subculture was performed once a month. White and tender granules were picked from the newly grown resistant callus and transferred to a new screening medium. The purification was repeated to obtain transgenic positive callus lines.
2. The application according to claim 1, characterized in that: In step S3, the RNA interference vector amir-CseIF5A2 can inhibit or interfere with the expression of the CseIF5A2 gene.
3. The application according to claim 1, characterized in that: In step S5, the callus is cultured in MT medium at a temperature of 25-26°C for 20-22 days; the callus is also cultured in MT liquid suspension medium at a temperature of 25-26°C, a rotation speed of 110-130 r / min, and a culture time of 4-5 days.
4. The application according to claim 1, characterized in that: In step S6, the concentration of acetylsuccinone in the MT suspension medium is 50 mg / L; the culture temperature is 26-28℃; and the OD of the Agrobacterium tumefaciens solution is... 600 It ranges from 0.6 to 0.
8.
5. The application according to claim 1, characterized in that: In step S7, the inoculation time with Agrobacterium liquid is 20-25 min; the temperature for dark culture is 22-23℃, and the dark culture time is 3-4 days.
Citation Information
Patent Citations
Application of poplar salt tolerant gene PtoeIF5A1
CN103709238A
Application of GhEIF5A gene associated with cotton fiber strength character
CN116751887A