Zmgral1 protein related to stage regulation of maize leaf color phenotype, coding gene and application thereof

Abstract

This invention discloses the ZmGRAL1 protein, its encoding gene, and its applications, which are related to the stage-specific regulation of maize leaf color phenotype. It belongs to the fields of plant genetic engineering and breeding technology. This invention screened and obtained a maize leaf color mutant. gral1 ,Should gral1 The mutant exhibits a significant albino phenotype before V5, followed by regreening; agronomic traits such as plant height, 100-grain weight, and grain number per ear are not different from the wild type, making it a leaf color mutant with application value. For analysis... gral1 The molecular mechanism of mutant phenotype formation was isolated in this invention using map-based cloning technology. ZmGRAL1 Genes, and verified through gene knockout. ZmGRAL1 Genes that regulate the development of maize leaf color. ZmGRAL1 Genes can regulate chloroplast development and stage-specific regulation of maize leaf phenotype, and can be used as maternal marker genes to efficiently identify false hybrids through leaf color during the seedling stage.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and breeding technology, specifically to the ZmGRAL1 protein, its encoding gene, and its applications, which are related to the staged regulation of maize leaf color phenotype. Background Technology

[0002] Maize is an important food crop, widely used for food supply, livestock feed, and industrial raw material production. As the main organ for photosynthesis in maize, the color of leaves is related to the chloroplast development state and photosynthetic efficiency, significantly affecting plant growth and yield. Leaf color-related genes play a crucial role in improving maize agronomic traits by regulating chloroplast development and chlorophyll synthesis, and are important targets for maize genetic breeding improvement and functional research. Leaf color mutants have become important materials for elucidating the regulatory mechanisms of plant photosynthesis, exploring gene physiological functions, and identifying key breeding genes.

[0003] Several types of leaf color mutants have been identified in maize, such as albino, yellow, greenish-white, yellowish-green, and striped varieties, and some related genes have been successfully cloned. For example, the yellow leaf mutant in maize... Hey2 The mutated gene encodes the D subunit of magnesium chelate, which is involved in the chlorophyll synthesis pathway. Abnormal function of this gene inhibits chlorophyll synthesis, resulting in a yellow phenotype in the leaves. (Maize pale green-yellow mutant) village Controlled by a recessive gene, it affects chlorophyll synthesis and metabolism, causing leaves to remain pale greenish-yellow for a long time; while the temperature-sensitive yellowing mutant of maize xy122 The function of related genes is regulated by temperature. Under high temperatures, chloroplast development is abnormal and the degree of yellowing is aggravated.

[0004] However, most reported leaf color mutants exhibit persistently abnormal leaf color traits throughout the entire growth period, such as albino lethal mutants. These mutants, unable to photosynthesize normally, typically fail to reach maturity, limiting the systematic analysis of the mechanisms of action of related genes throughout the growth cycle and their application in breeding. Furthermore, while some surviving etiolated mutants can complete the growth cycle, their low photosynthetic efficiency negatively impacts plant development, photosynthetic product accumulation, and yield formation, limiting their breeding potential. In contrast, staged leaf color mutants that exhibit abnormal leaf color only at specific developmental stages and subsequently recover naturally offer clear marker phenotypes without affecting normal photosynthesis and yield formation in later stages, thus possessing high research and application value. Therefore, identifying and analyzing staged leaf color mutants and their regulatory genes not only enriches the genetic resources for regulating maize leaf color development but also provides an important material basis for establishing an efficient and usable phenotypic marker system. However, research on such stage-specific leaf color mutants is still relatively scarce, and the molecular basis of their dynamic leaf color changes and the spatiotemporal control mechanism of key genes are still unclear. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a ZmGRAL1 protein, its encoding gene, and its application related to the staged regulation of maize leaf color phenotype.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a ZmGRAL1 protein associated with the staged regulation of maize leaf chromophobia, the amino acid sequence of which is shown in SEQ ID NO.3.

[0007] This invention is the first to obtain information from maize leaf color mutants. grail1 The key protein regulating the phased changes in maize leaf color phenotype—ZmGRAL1—was identified. By inactivating ZmGRAL1, the maize leaf color phenotype can exhibit phased changes: white stripes appear before stage V5 and gradually turn white; as development progresses, the white phenotype gradually recovers to light green, and by stage V11, it turns completely green.

[0008] Compared with the conventional albino mutant phenotype, the stage-specific changes in maize leaf color phenotype, which only show abnormal leaf color at specific developmental stages and can then naturally recover to green, can provide a clear marker phenotype without affecting the plant's normal photosynthesis and yield formation in the later stages. Therefore, it has high research and application value.

[0009] In a second aspect, the present invention provides a gene encoding a stage-specific regulation of maize leaf color phenotype, and the gene is named... ZmGRAL1 Genes. The aforementioned ZmGRAL1 Genes are nucleic acid molecules as shown in i), ii), or iii): i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1; ii) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2; iii) Nucleic acid molecules other than i) or ii) that encode the amino acid sequence shown in SEQ ID NO.3.

[0010] A third aspect of the present invention provides the use of the above-described ZmGRAL1 protein in either (1) or (2) below: (1) Regulates maize chloroplast development; (2) Stage regulation of maize leaf color phenotype.

[0011] In the above application, the staged regulation of maize leaf color phenotype is as follows: before stage V5, white stripes appear and gradually turn white; as development progresses, the white phenotype gradually recovers to light green, and turns completely green by stage V11.

[0012] A fourth aspect of the present invention provides the above. ZmGRAL1 The application of genes in any of the following (1)-(3): (1) Regulates maize chloroplast development; (2) Stage-specific regulation of maize leaf color phenotype; (3) Screening of maize germplasm resources; In the above application, the staged regulation of maize leaf color phenotype is as follows: before stage V5, white stripes appear and gradually turn white; as development progresses, the white phenotype gradually recovers to light green, and turns completely green by stage V11.

[0013] In the above application, the screening of maize germplasm resources is carried out by identifying false hybrids through leaf color screening during the seedling stage.

[0014] This invention has found that: ZmGRAL1 Genes related to the development of maize chloroplasts will ZmGRAL1 Gene knockout or mutation resulted in a developmental stage-dependent phenotype of maize leaf color and chlorophyll content. Before stage V5, the leaves exhibited white stripes and gradually turned albinistic. As development progressed, the albinistic phenotype gradually reverted to light green, until it turned completely green by stage V11. Chlorophyll content decreased between stages V2 and V5, after which no significant difference was observed. ZmGRAL1 The agronomic traits of gene knockout or mutant plants, such as plant height, number of grains per ear, and grain size, did not differ significantly from those of the wild type. ZmGRAL1 Genes have extremely high application value and can be used as maternal marker genes for screening maize germplasm resources. In the process of maize hybrid seed production, genes carrying these markers can be used... ZmGRAL1 Plants with homozygous mutant genes are used as female parents, and plants without the mutant gene are used as male parents. If the female parent is not completely emasculated, its self-crossed offspring will show a significant albino phenotype in the seedling stage due to the homozygous mutation, while true hybrids will show normal green color. Based on this, false hybrids can be quickly identified and eliminated in the seedling stage, effectively ensuring the purity of hybrids.

[0015] In the above applications, targeted knockout can be used. ZmGRAL1 Genes are used to regulate the leaf color phenotype of maize in stages.

[0016] In some preferred embodiments of the present invention, targeted knockout ZmGRAL1 The material of a gene can be any of the following: e1) Targeted knockout ZmGRAL1 Nucleic acid molecules of genes; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3).

[0017] Furthermore, targeted knockout ZmGRAL1 The sequences of the knockout primers used for the gene are shown in SEQ ID NO.32-SEQ ID NO.35.

[0018] A fifth aspect of the present invention provides a method for staged regulation of maize leaf color phenotype, comprising the following steps: corn ZmGRAL1 Gene knockout or mutation, or inactivation or reduction of the activity of the GRAL1 protein in maize, can produce mutant maize. The mutant maize leaves exhibit white stripes before stage V5 and gradually turn white. As development progresses, the white phenotype gradually recovers to light green, and turns completely green by stage V11.

[0019] Of the above methods, the preferred method is through design. ZmGRAL1 Gene knockout targets are identified, and CRISPR / Cas9 knockout vectors are used to... ZmGRAL1 Gene knockout.

[0020] The beneficial effects of this invention are: (1) This invention screened and obtained a maize leaf color mutant. grail1 It possesses unique phenotypic characteristics, differing from existing maize leaf color mutants in that: grail1 The mutant exhibits a phenotype where leaves gradually turn white before the five-leaf stage and then gradually return to green; and its agronomic traits such as plant height, 100-grain weight, and number of grains per ear are no different from those of the wild type, making it a leaf color mutant with application value.

[0021] (2) For analysis grail1 The molecular mechanism of mutant phenotype formation was isolated in this invention using map-based cloning technology. ZmGRAL1 This is a completely new and previously unreported gene. Research has found that: ZmGRAL1 Genes can regulate chloroplast development and stage-specific regulation of maize leaf phenotype, in order to carry... ZmGRAL1 Homozygous materials with functional altered / reduced / deleted allelic variations were used as the maternal parent, while normal green materials were used as the paternal parent. If the maternal parent was not completely emasculated, its self-pollinated offspring exhibited albinism or staged abnormal leaf color during the seedling stage, while the true hybrids showed normal green color. The cloning of this new gene is of great significance for elucidating the leaf color regulation mechanism, discovering molecular markers for improving maize photosynthetic efficiency, and promoting the breeding of high-yielding and high-quality maize varieties. Attached Figure Description

[0022] Figure 1 : grail1Leaf phenotypes of mutants and wild-type (WT) at six stages: V1, V2, V4, V5, V7, and V11.

[0023] Figure 2 : grail1 The chlorophyll content, plant height, 100-grain weight, and number of grains per ear of mutants and wild-type (WT) at six stages (V1, V2, V4, V5, V7, and V11) are statistically analyzed. In the figure, (a) shows the chlorophyll a content measurement results, (b) shows the chlorophyll b content measurement results, (c) shows the total chlorophyll content measurement results, (d) shows the plant height measurement results, (e) shows the photos of maize fruits and kernels, (f) shows the 100-grain weight statistics, and (g) shows the number of grains per ear statistics.

[0024] Figure 3 : grail1 Ultrastructural observation of chloroplasts in mutants and wild-type (WT) at six stages: V1, V2, V4, V5, V7, and V11.

[0025] Figure 4 : grail1 Chloroplast composition was observed in mutants and wild-type (WT) at three stages: V2, V4, and V5.

[0026] Figure 5 : ZmGRAL1 Schematic diagram of gene location.

[0027] Figure 6 : grail1 Sequencing diagrams of mutation sites in mutants and wild-type (WT).

[0028] Figure 7 : ZmGRAL1 PCR detection results and phenotype of gene knockout plants. Detailed Implementation

[0029] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0030] Terminology Explanation: V1 stage: refers to the 1-leaf stage of maize.

[0031] V2 stage: refers to the 2-leaf stage of maize.

[0032] V4 stage: refers to the 4-leaf stage of corn.

[0033] V5 stage: refers to the 5-leaf stage of corn.

[0034] V7 stage: refers to the 7-leaf stage of corn.

[0035] V11 stage: refers to the 11-leaf stage of maize.

[0036] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0037] The experimental materials used in the embodiments of this invention, unless otherwise specified, are all conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the embodiments of this invention, they are generally performed under conventional conditions, such as those described in J. Sambrook et al., eds., *Molecular Cloning: A Laboratory Manual* (3rd Edition), Science Press, 2002; D.L. Spector et al., eds., *Cellular Laboratory Manual*, Science Press, 2001; or according to the conditions recommended by the manufacturer.

[0038] Example 1: grail1 Characterization of mutants 1. Test method: The inventors identified a mutant exhibiting stage-specific leaf color changes during the seedling stage within the genetic context of the maize inbred line J220 (wild-type, WT), and named it... grail1 Compared to the J220, grail1 During the seedling stage, the leaves gradually lighten and exhibit an albinism phenotype. Subsequently, as the plant develops, the leaves gradually return to green, and by the V11 stage, the leaves are basically or completely green again.

[0039] right grail1 The leaf phenotypic characteristics, chlorophyll content, chloroplast ultrastructure, chloroplast components and photosystem protein complexes, photosynthetic parameters, and agronomic traits such as plant height, number of grains per ear, and grain size of the mutants were measured and analyzed. Among these: The chlorophyll content was determined according to the method of Su et al. (2010). Fresh leaves were weighed and then immersed in 80% acetone, incubated at room temperature in the dark for 24 hours, and the supernatant was collected by centrifugation. The pigment content was determined using a spectrophotometer (Hitachi UH5700, Japan).

[0040] Transmission electron microscopy was used to observe the ultrastructure of chloroplasts. Specifically, maize inbred line J220 (WT) and... grail1 Leaves from mutant plants at stages V1, V2, V4, V5, V7, and V11 were cut into small pieces and fixed at 4°C for 4 hours in 0.1 M sodium phosphate buffer (pH 7.2). After rinsing, the samples were incubated overnight in 1% osmium tetroxide solution. Following graded ethanol dehydration, the leaf samples were embedded in Spurr resin and sectioned into ultrathin sections. The sections were stained with 2% uranyl acetate and 10 mM lead citrate (pH 12) and observed using a Hitachi H-7650 transmission electron microscope.

[0041] Chloroplast components and photosystem protein complexes were analyzed using blue-green temperate electrophoresis (BN-PAGE). Specifically, WT and... grail1 Leaf samples (0.1 g) from six stages were collected on ice and chloroplasts were separated using extraction buffer (0.33 M sorbitol, 30 mM methyl ricine, 5 mM EGTA, 5 mM EDTA, 10 mM NaHCO3). After removing starch by high-speed centrifugation, the precipitate was resuspended in 2% n-dodecyl-β-D-maltose. Blue-green mild electrophoresis (BN-PAGE) gels were prepared according to the method of Peng et al. (2006).

[0042] 2. Test Results: grail1 The mutant leaves exhibit white stripes before stage V5 and gradually turn white. As development progresses, the white phenotype gradually reverts to light green, and by stage V11, it has completely turned green. Figure 1 ).

[0043] Chlorophyll content measurements showed that grail1 The mutant had significantly lower chlorophyll a, chlorophyll b, and total chlorophyll content than the wild type in stages V2 to V5, but no significant difference thereafter. grail1 The mutant showed no significant differences from the wild type in agronomic traits such as plant height, number of grains per ear, and grain size. Figure 2 ).

[0044] Ultrastructural observation of chloroplasts showed that the chloroplast structure of WT leaf cells was complete in all six stages, containing regular layered structures and thylakoids. grail1 In stage V1, the thylakoids of chloroplasts in bundle sheath cells exhibit vacuolation, while the chloroplasts in mesophyll cells remain normal; in stage V4, the lamellar structure of chloroplasts in both mesophyll and bundle sheath cells is disordered or even disintegrates; from stage V5 onwards, the chloroplast structure of both cell types gradually returns to normal. Figure 3 This indicates that GRAL1 plays an important role in maintaining chloroplast structure and chlorophyll synthesis during early seedling development. BN-PAGE results show that... grail1 The thylakoid membrane protein complex composition of the mutant in stages V2 and V5 is basically the same as that of WT; however, in stage V4, grail1 The bands of multiple photosynthetic protein complexes were significantly weakened, indicating that the accumulation of photosynthetic complexes was significantly affected in this mutant during the abnormal leaf color stage. Figure 4 ).

[0045] Example 2: ZmGRAL1 Map-based cloning of genes use grail1Crossing with the maize inbred line "Huangzao 4," which has normal green leaves, resulted in F1 plants exhibiting normal leaf color. After self-pollinating the F1 plants to obtain the F2 segregating population, the leaf color phenotype was investigated. The results showed that the segregation ratio of plants with normal leaf color to those exhibiting stage-specific leaf color changes in the F2 population was 3:1. A chi-square test yielded χ²=0.625, df=1, χ²0.05,1=3.841, and P>0.05, indicating that the normal leaf color was within acceptable limits. grail1 The leaf color trait at the seedling stage is controlled by a pair of recessive nuclear genes.

[0046] For positioning control grail1 The target gene for leaf color traits during the seedling stage, the inventor used grail1 A segregating F2 population was constructed by inbred with a normal green inbred line, and linkage analysis was performed using individual plants exhibiting stage-specific leaf color changes within the population. Preliminary mapping results showed that the target gene is located on the long arm of chromosome 6 of maize. p-umc2170 and p-umc2059 Between the markers.

[0047] To further narrow the location range, we expanded the group, including the markers. p-umc2170 and p-umc2059 Develop SSR tags between tags, utilizing ( grail1 (Huang Zao Si) Of the 2112 mutant phenotype individuals in the F2 population, the target interval was further narrowed down to M1 to M2 The physical distance between the two markers is 4.7 Mb.

[0048] Because in M1 to M2 Since there were no available markers and the recombinant plants were no longer being exchanged, we grouped them. grail1 A new combination with the B73, and in M1 to M2 The design incorporates 12 pairs of SSR markers (Table 1), utilizing ( grail1 The 4235 mutant phenotype individuals in F2 of / B73) narrowed the target region to M11 and M12 Between the two markers, 83.7 Kb ( Figure 5 ).

[0049] Table 1: SSR Molecular Markers This region contains 5 candidate open reading frames (ORFs), and sequencing revealed a second ORF (…). Zm00001eb294320 (Reference genome: Zm-B73-REFERENCE-NAM-5.0) A single nucleotide mutation A→G exists 283 bp downstream of the ATG start codon, resulting in the substitution of isoleucine (Ile) for valine (Val). Figure 6 ).

[0050] Therefore, this gene was identified as a regulatory mutant. grail1 The gene for leaf color phenotype was named... ZmGRAL1 The gene, the full-length sequence of which is shown in SEQ ID NO.1, the CDS region sequence of which is shown in SEQ ID NO.2, and the amino acid sequence of the encoded GRAL1 protein of which is shown in SEQ ID NO.3.

[0051] Example 3: ZmGRAL1 Functional verification of genes 1. ZmGRAL1 Construction of knockout lines: Constructing a B73-based system using CRISPR / Cas9 technology ZmGRAL1 The knockout strains are as follows: against ZmGRAL1 The target site (target information from the CRISPR-P 2.0 platform) and knockout primers were designed for the second exon of the gene. The sequences of the knockout primers used are as follows: 58-MT1T2-BsF: AATAATGGTCTCAGGCGATTCGCTAAACGCTGCTGTC; (SEQ ID NO.32) 58-MT1T2-F0: GATTCGCTAAACGCTGCTGTCGTTTTAGAGCTAGAAATAGC; (SEQ ID NO.33) 58-MT1T2-R0: TTCTGCTCCATGCGCGTAGACGCTTCTTGGTGCC; (SEQ ID NO.34) 58-MT1T2-BsR:ATTATTGGTCTCTAAACTTCTGCTCCATGCGCGTAGA. (SEQ ID NO.35) Specific guide RNA was integrated into the pBUE411 vector to obtain a recombinant vector. This recombinant vector was then transformed into Agrobacterium EHA105 strain, which infected immature maize B73 embryos. Next-generation sequencing (NGS) was used to sequence the target region of the transgenic lines to identify the mutant genotype and mutation site.

[0052] Two positive T1 generation plants were analyzed by PCR to obtain 2 ZmGRAL1 homozygous knockout mutant ( cris-1 and cris-2 ).

[0053] 2. ZmGRAL1 Leaf color phenotype of knockout strains: ZmGRAL1 Knockout strains cris-1 and cris-2 Showing grail1 Similar stage-specific leaf leukoplakia phenotypes all show white stripes before stage V5 and gradually turn white. As development progresses, the leukoplakia phenotype gradually recovers to light green and turns completely green by stage V11.

[0054] To further determine ZmGRAL1 Knockout strains and grail1 Do similar leaf color phenotypic traits result from allelic variation of the same gene? (The question then shifts to a discussion of homozygous genes.) cris-1 and grail1 Hybridization was performed, and allelicity analysis was conducted. The results showed that the leaves of the F1 generation plants also exhibited... grail1 Abnormal leaf color development phenotype ( Figure 7 ), confirm ZmGRAL1 It is a key gene that regulates chloroplast development.

[0055] right ZmGRAL1 Knockout strains ( cris-1 , cris-2 ) and the 100-grain weight and number of grains per ear of background material B73 were statistically analyzed, and it was found that ZmGRAL1 There were no significant differences in 100-grain weight and number of grains per ear between the knockout lines and B73.

[0056] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. Application of ZmGRAL1 protein inactivation in the phased regulation of maize leaf color phenotype; the amino acid sequence of the ZmGRAL1 protein is shown in SEQ ID NO.3, and the phased regulation of maize leaf color phenotype is as follows: white stripes appear before stage V5 and gradually turn white; as development progresses, the white phenotype gradually recovers to light green, and turns completely green by stage V11.

2. Targeted knockout ZmGRAL1 The application of genes in any of the following (1)-(2): (1) Stage-specific regulation of maize leaf color phenotype; (2) Screening of maize germplasm resources; The ZmGRAL1 Genes are nucleic acid molecules as shown in i), ii), or iii): i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1; ii) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2; iii) Nucleic acid molecules other than i) or ii) that encode the amino acid sequence shown in SEQ ID NO.3; the staged regulation of maize leaf color phenotype is as follows: white stripes appear before stage V5 and gradually turn white; as development progresses, the white phenotype gradually recovers to light green, and turns completely green by stage V11; the screening of maize germplasm resources is as follows: false hybrids are identified by screening leaf color during the seedling stage.

3. The application according to claim 2, characterized in that, Targeted knockout ZmGRAL1 The material of a gene is any of the following: e1) Targeted knockout ZmGRAL1 Nucleic acid molecules of genes; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3).

4. The application according to claim 3, characterized in that, Targeted knockout ZmGRAL1 The sequences of the knockout primers used for the gene are shown in SEQ ID NO.32-SEQ ID NO.35.

Images