A 5-hydroxymethylcytosine detection method based on triple cascade signal amplification

Abstract

The application discloses a 5-hydroxymethylcytosine detection method based on triple cascade signal amplification, and belongs to the technical field of biochemical detection. The method comprises the following steps: 1) preparation of 5hmC specific glycosylation and azido labeling; 2) magnetic bead capture and enrichment separation of target DNA; 3) TdT mediated nucleic acid terminal polymerization extension; 4) APE1 triggered primer release and rolling circle amplification; 5) DNA enzyme catalytic cleavage and fluorescence signal detection. The application is free of bisulfite and sequence-independent, realizes extremely low background and ultra-high sensitive detection, and the detection limit reaches 4.41 fM, and can be widely applied to early cancer screening, marker detection of neurological or cardiovascular diseases in clinic, and provides a powerful platform for low-abundance epigenetic analysis in clinical diagnosis and biomedical research.

Description

Technical Field

[0001] This invention relates to the field of biochemical detection technology, and in particular to a method for detecting 5-hydroxymethylcytosine based on triple cascade signal amplification. Background Technology

[0002] Epigenetics refers to the heritable changes in gene function caused by chemical modifications of DNA and related proteins without altering the DNA sequence. 5-hydroxymethylcytosine (5hmC) is an important epigenetic modification formed by the oxidation of 5-methylcytosine (5mC) under the catalysis of TET dioxygenase, and it participates in the active DNA demethylation process. Studies have shown that 5hmC plays a crucial role not only in physiological processes such as cell differentiation and developmental regulation, but is also closely related to various diseases including cancer, neurological disorders, and cardiovascular diseases, thus becoming an important biomarker for disease diagnosis and prognostic assessment. Precise detection of 5hmC levels in genomic DNA is of great significance for studying disease mechanisms and promoting early cancer screening.

[0003] Although 5hmC is widely distributed in mammalian tissues and cells, its content is typically only one-hundredth to one-tenth that of 5mC. Furthermore, 5hmC is structurally highly similar to 5mC, 5-formylcytosine (5fC), and 5-carboxycytosine (5caC), and complex background interference in biological samples makes it difficult for conventional detection methods to accurately distinguish them. Therefore, developing a stable, highly sensitive, and highly specific method for detecting 5hmC is of great significance.

[0004] Currently, traditional detection techniques such as mass spectrometry, thin-layer chromatography (TLC), and high-performance liquid chromatography (HPLC) offer high accuracy but typically rely on expensive equipment and are complex to operate. While bisulfite sequencing (BS-seq) can achieve single-base resolution detection, it cannot effectively distinguish between 5mC and 5hmC. Subsequent advancements in oxidized bisulfite sequencing (OxBS-seq) and TET-assisted bisulfite sequencing (TAB-seq) have improved resolution, but still suffer from issues such as large DNA input volumes, easy DNA degradation, complex experimental procedures, and high costs. In recent years, researchers have developed various bisulfite-free detection techniques, such as glycosylation labeling methods based on T4β-glucosyltransferase, single-step deamination sequencing (SSD-seq), and single-cell detection technologies. However, these methods still suffer from insufficient sensitivity, susceptibility to 5fC / 5caC interference, complex operation, or significant detection bias.

[0005] Therefore, existing technologies still struggle to balance high sensitivity, high specificity, and ease of operation. Developing a stable, rapid, and accurate 5hmC detection method is of great significance. Summary of the Invention

[0006] The purpose of this invention is to provide a method for detecting 5-hydroxymethylcytosine based on triple cascade signal amplification, thereby achieving stable and rapid detection of 5hmC.

[0007] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a method for detecting 5-hydroxymethylcytosine based on triple cascade signal amplification, the method comprising the following steps: (1) Specific glycosylation and azide labeling of 5 hmC: The glycosylation of 5-hydroxymethylcytosine (5hmC) in genomic DNA was catalyzed by T4 phage β-glucosyltransferase to obtain azide-modified glycosylated DNA; (2) Magnetic bead capture and enrichment separation of target DNA: A DBCO-biotin probe modified with dibenzocyclooctylene (DBCO) was coupled with magnetic beads, and the azide-modified glycosylated DNA was covalently captured by a click chemical reaction. Unmodified background DNA and impurities were eluted by magnetic separation to obtain the enriched 5hmC-DNA product. (3) TdT-mediated terminal polymerization and extension of nucleic acids: In the presence of terminal deoxynucleotidyl transferase (TdT) and dATP, the ends of the enriched 5hmC-DNA were extended to generate poly(A) long chains. (4) APE1-triggered primer release and rolling circle amplification: An AP probe with a baseless site is introduced into the system. The AP probe hybridizes with the poly(A) long chain, and the baseless site is specifically cleaved by the APE1 enzyme to release the single-stranded primer. The single-stranded primer hybridizes with the circular DNA template and initiates rolling circle amplification (RCA) under the action of DNA polymerase, generating an amplification product containing multiple catalytically active DNAzyme sequences. (5) DNAase-catalyzed cleavage and fluorescence signal detection: A signal probe with a fluorescent group and a quencher group modified at the end is added to the amplification product. The catalytically active DNase cyclically cuts the signal probe and releases a fluorescent signal. Quantitative detection at 5 hmC is achieved by measuring the fluorescence intensity. The triple cascade signal amplification includes TdT-mediated nucleic acid terminal polymerization and extension, APE1-triggered primer release and rolling circle amplification, and DNase-catalyzed cleavage and fluorescence signal detection. The sequence of the DBCO-Biotin probe is as follows: BiotinAGCTATCCATCC / iDBCOdT / AT / iInvdT / ; The sequence of the AP probe is as follows: GCTGCTCCATCATTTTTTTTT / idSp / TTTTTTTTTTTT NH2 .

[0008] Preferably, the specific steps of step (1) are as follows: 600 ng / µL 5hmC-DNA, 2 µL of 10× NEBuffer 4, 10 µM UDP-6-N3-Glu and 4 U of T4 β-GT are added to each 20 µL reaction system, and the mixture is incubated at 37°C for 2 hours to obtain azidoglycosylated modified DNA.

[0009] In this step, 5hmC can be recognized and covalently modified to undergo glycosylation, while 5-methylcytosine (5mC) and normal cytosine (C) do not undergo this reaction. Moreover, this step does not require the use of antibodies and avoids the severe DNA degradation problem caused by traditional bisulfite treatment, achieving highly specific labeling that is unrelated to the 5hmC sequence.

[0010] Preferably, the specific steps of step (2) are as follows: (a) Mix 40 μL of the DBCO-biotin probe with 1 μM and 40 μL of streptavidin-coated magnetic bead solution, and incubate in the dark for 30 minutes to obtain the DBCO-DNA-magnetic bead conjugate. (b) After washing the DBCO-DNA-magnetic bead conjugate, it is resuspended in ultrapure water to obtain a DBCO-DNA-MB conjugate solution; (c) The azidoglycosylated DNA was mixed with 40 μL of the DBCO-DNA-MB conjugate solution with a concentration of 5 mg / mL and incubated in the dark for 15 minutes to obtain mixed solution A; (d) Wash mixed solution A with 1× B&W buffer via magnetic separation to obtain enriched 5hmC-DNA solution.

[0011] In this step, the target analyte is immobilized on magnetic beads using the streptavidin-biotin system, and combined with magnetic separation technology, unmodified DNA and background interference substances can be effectively removed, greatly reducing background noise and improving the signal-to-noise ratio and sensitivity of subsequent detection.

[0012] Preferably, the specific steps of step (3) are as follows: (A) Add 10 U of terminal transferase (TdT), 0.5 µL of dATP (10 mM) and 2 µL of 10× TdT reaction buffer to 20 µL of the 5 hmC-DNA solution and incubate at 37 °C for 1 hour to generate poly(A) strands. (B) Incubate at 75°C for 20 minutes to inactivate TdT enzyme and obtain mixed solution B.

[0013] In this step, TdT is a template-independent DNA polymerase that can efficiently convert a single target molecule recognition event into an extendable nucleic acid terminus (poly(A) tail) under isothermal conditions, serving as the basic trigger point for subsequent multi-stage signal amplification.

[0014] Preferably, the specific steps of step (4) are as follows: a) Add 1.6 μL of 10 μM AP probe, 2 U of APE1 enzyme and 3 µL of 10×NEBuffer 4 to the mixed solution B. After reacting at 37°C for 1 hour, stop the reaction at 65°C for 20 minutes to release the primers. b) 1 μL of 1 μM circular DNA template, 1 μL of 2.5 mM dNTPs, 4 U Phi29 DNA polymerase and 1× Phi29 DNA polymerase reaction buffer were incubated at 30°C for 40 minutes for rolling circle amplification, and then reacted at 65°C for 20 minutes to inactivate Phi29 polymerase to obtain the amplification product. The sequence of the circular DNA template is as follows: AGACAAAGcCACCCTCCTCAGCAAGGTTTCCTCTCGTTGTAGCTAGCCTCCCTGGGCACCTAAAAAAAAATGATGGAGCAGC.

[0015] In this step, the inverted dT modification at the 3' end of the AP probe and the capture probe effectively prevents false positives caused by nonspecific amplification. Precise cleavage of APE1 enables efficient primer release, and the triggered RCA amplification achieves a leap in signal from linear to exponential, generating hundreds or thousands of catalytically active DNAse fragments.

[0016] Preferably, the specific steps of step (5) are as follows: A) Add 10 μL of 10 μM signal probe to the amplification product and incubate at 35°C for 1 hour to amplify the fluorescence signal; B) Measurements were performed using a fluorescence spectrometer, with both excitation and emission slits set to 5.0 nm, excitation wavelength at 577 nm, and emission wavelength scanning range of 590 ~ 700 nm. C) ROX fluorescence intensity was recorded at 608 nm for data analysis.

[0017] In this step, the fluorescent probe is cleaved, releases fluorescence, and detaches. The free DNase can continuously bind to other signal probes and catalyze cleavage. This self-circulating catalytic process converts the nucleic acid amplification signal into a quantifiable fluorescent signal, achieving a third signal amplification. Ultimately, this allows a single 5hmC site to produce an extremely high fluorescence signal output, with a detection limit as low as 4.41 fM.

[0018] Preferably, the sequence of the signal probes is as follows: ROX AAGGTTTCCTC / rA / / rU / CCCTGGGCA BHQ2 .

[0019] Secondly, the present invention provides a biosensing detection system for implementing the above-described detection method, the biosensing detection system comprising: Glycosylation and azide labeling module: contains T4 phage β-glucosyltransferase and UDP-6-N3-Glu; Magnetic enrichment and separation module: containing biotinylated DBCO-DNA probes and streptavidin-coated magnetic beads; The first linear amplification module contains TdT enzyme and dATP; The second exponential amplification module contains AP probes, APE1 enzyme, circular DNA template, Phi29 DNA polymerase, and dNTPs. The third catalytic cycle module contains signal probes with fluorescent and quenching groups modified at both ends, respectively.

[0020] Thirdly, the present invention provides the application of the above-described detection method or the above-described biosensor detection system in the preparation of clinical early cancer screening and diagnostic reagents, and biomarker detection tools for neurological diseases or cardiovascular diseases.

[0021] Fourthly, the present invention provides the application of the above-described detection method or the above-described biosensor detection system in the preparation of clinical early cancer screening and diagnostic reagents, and epigenetic research tools for nervous system diseases or cardiovascular diseases.

[0022] The beneficial effects of this invention are as follows: This invention constructs a bisulfite-free, sequence-independent triple cascade signal amplification biosensing method for whole-genome 5-hydroxymethylcytosine (5hmC) detection. This method is based on the synergistic integration of specific glycosylation-mediated magnetic separation technology and an isothermal multiplex signal amplification strategy, featuring extremely low background, extremely high sensitivity, high specificity, and no DNA damage. It can detect 5hmC at any location in the whole genome. Furthermore, this invention does not rely on expensive specific antibodies, enabling accurate and sensitive detection of complex clinical cell and tissue samples.

[0023] Secondly, this method creatively constructs a triple-cascade signal amplification system. First, the TdT enzyme extends the poly(A) chain at the target end, triggering APE1 enzyme cleavage of the probe and releasing a large number of primers (first amplification). The released primers then trigger rolling circle amplification (RCA), generating a long single strand containing hundreds or thousands of catalytically active DNAzyme sequences (second amplification). Finally, the generated DNAzyme, in its free state, cyclically catalyzes the cleavage of the fluorescent signal probe (third amplification). This leapfrog signal amplification from "linear extension" to "exponential amplification" and then to "enzymatic cycling" significantly breaks through the sensitivity limits of traditional detection methods, achieving an extremely low detection limit of 4.41 fM.

[0024] Furthermore, this method exhibits extremely high specificity and excellent resistance to interference. Through highly specific azidoglycosylation modification of the T4 β-GT enzyme, combined with covalent capture via "click chemistry" using DBCO-modified magnetic beads, robust enrichment of the 5hmC target is achieved. Subsequent magnetic separation thoroughly elutes unmodified background DNA and complex matrix impurities, resulting in extremely low background noise. This design perfectly avoids interference from structurally similar and highly abundant 5-methylcytosine (5mC) and normal cytosine (C) in the genome, ensuring extremely high quantitative accuracy.

[0025] Finally, this method can be widely and reliably applied to the detection of actual clinical samples. This invention possesses ultra-high sensitivity at the single-cell level (cell detection limit as low as 0.729 cells), accurately distinguishing significant differences in 5hmC levels between normal cells (e.g., HEK293) and various tumor cells from different sources (e.g., A549, MCF-7, HeLa). It offers significant advantages over existing technologies: Compared to traditional bisulfite sequencing methods (e.g., BS-seq, OxBS-seq): This invention operates entirely under mild enzymatic conditions, completely eliminating the harsh bisulfite treatment, perfectly avoiding severe degradation and fragmentation of whole-genome DNA, and reducing dependence on high DNA input volumes. Compared to the traditional gold standard enzyme-linked immunosorbent assay (ELISA): This invention requires no antibody incubation after extracting whole-genome DNA, effectively avoiding detection bias and high costs associated with antibodies, and its detection limit for human tissue samples (16.8 fg / μL) is far superior to commercially available ELISA kits. Meanwhile, the 5hmC distribution levels of various human tissues (brain, liver, lungs, etc.) measured by this method are highly consistent with the results obtained by the ELISA gold standard (correlation coefficient R² = 0.9703), providing a low-cost, non-destructive, and ultra-high-precision high-quality alternative for early clinical cancer screening and epigenetic research. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0027] Figure 1 This is a schematic diagram illustrating the detection principle of the present invention; Figure 2 This is a diagram showing the feasibility verification results of the detection method of the present invention; in, Figure 2 Figure A shows the verification results of polyacrylamide gel electrophoresis (PAGE). Figure 2 Figure B shows the fluorescence emission spectrum and signal-to-noise ratio bar chart for feasibility verification. Figure 2 The middle section (C) shows a comparison of the changes in Zeta potential before and after the magnetic beads were coupled to DNA; Figure 3 This is an optimized diagram of the experimental conditions for the detection method of the present invention; in, Figure 3 In Figure A, the relationship between fluorescence intensity and F / F0 value and AP probe concentration is shown. Figure 3 In Figure B, the relationship between fluorescence intensity and F / F0 value and the concentration of the circular template is shown. Figure 3In the figure, C represents the relationship between fluorescence intensity and F / F0 value and the amount of Phi29 DNA polymerase used. Figure 3 In the figure, D represents the relationship between fluorescence intensity and F / F0 value and the duration of the RCA reaction; Figure 4 This is a graph showing the fluorescence response of the detection method of the present invention to different concentrations of target analytes; in, Figure 4 In Figure A, fluorescence emission spectra of 5 hmC-DNA at different concentrations (1 fM to 0.1 μM) are shown. Figure 4 Figure B shows the linear relationship between fluorescence intensity and the logarithm of 5hmC-DNA concentration in the range of 10 fM to 10 nM. Figure 5 The graph shows the analysis results of the specificity and quantitative accuracy of the detection method of the present invention. in, Figure 5 In Figure A, the fluorescence intensity thermogram corresponds to double-stranded DNA containing different modification sites (5hmC, 5mC, C). Figure 5 Figure B shows the correlation verification graph between the detected 5hmC concentration and the actual input concentration; Figure 6 This is a graph showing the detection results of the detection method of the present invention on the 5hmC level in genomic DNA of different cell lines; in, Figure 6 A in the diagram represents the cell-level detection process. Figure 6 Figure B is a heatmap of the 5hmC level distribution in five different cell lines (HeLa, A549, MCF-7, SK-N-BE(2) and HEK293); Figure 6 C and Figure 6 The bars in the middle and D represent the comparison of 5hmC levels between normal cells and cancer cells, and between neurogenic cancer cells and other cancer cells. Figure 6 E in the figure represents the linear relationship between fluorescence intensity and the logarithm of the number of SK-N-BE(2) cells; Figure 7 The figure shows the quantitative analysis results of 5hmC in human tissue samples using the detection method of the present invention, and the comparison results with the commercial ELISA method. in, Figure 7 A in the diagram represents the human tissue sample testing process. Figure 7 B in the figure represents the standard curve for the ELISA method. Figure 7 Figure C shows the linear relationship between fluorescence intensity and tissue genomic DNA concentration as measured in this invention. Figure 7 China D and Figure 7The bar chart and heat map in the middle E represent the comparison of the detection results of 5hmC content in 7 human tissues by the present invention and the ELISA method, respectively. Figure 7 F in the figure represents a scatter plot showing the correlation between the results of this invention and the detection results of the ELISA method; Figures 1-7 The English abbreviations involved are explained below: 5hmC: 5-hydroxymethylcytosine; N3-5ghmC: azido-modified glycosylated DNA; UDP-6-N3-Glu: uridine diphosphate-6-azido-glucose; dATP: deoxyadenosine triphosphate; TdT: terminal deoxynucleotide transferase; rA: adenine ribonucleoside; APE1: depurin / depyrimidine endonuclease 1; phi29: phi29 DNA polymerase; MCF-7: human breast cancer cells; A549: human lung adenocarcinoma cells; HeLa: human cervical cancer cells; SK-N-BE(2): human neuroblastoma cells; HEK-293: human embryonic kidney cells. Detailed Implementation

[0028] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] The sequences of the DNA oligonucleotides involved in this detection method are shown in Table 1.

[0030] Table 1 DNA oligonucleotides (HPLC purification)

[0031] Note: In the oligonucleotide sequence, Biotin indicates a biotin-modified 5' end; / DBCOdT / indicates a deoxythymidine with a dibenzocyclooctyne modification; Inv dT indicates a reverse deoxythymidine with a 3' end; / idSp / indicates a dspacer-free internal base site; ROX and BHQ2 represent the 5' carboxyl-X-rhodamine fluorophore and the 3' BlackHole Quencher 2, respectively; / rA / and / rU / represent the internal nucleotide residues, respectively; hmC and mC represent 5-hydroxymethylcytosine and 5-methylcytosine modifications, respectively.

[0032] Example 1 A method for detecting 5-hydroxymethylcytosine based on triple cascade signal amplification Specific glycosylation and azide labeling at 1.5 hmC To construct azide-modified glycosylated DNA (N3-5ghmC), 600 ng / µL 5hmC-DNA, 2 µL of 10× NEBuffer 4, 10 µM UDP-6-N3-Glu, and 4 U of T4 β-GT were added to a 20 µL reaction system and incubated at 37 °C for 2 hours to obtain azide-glycosylated 5hmC-DNA.

[0033] 2. Magnetic bead capture and enrichment separation of target DNA Take 20 μL of streptavidin magnetic beads (10 mg / mL), wash twice with 1× B&W buffer, and resuspend in 2× B&W buffer to make a final concentration of 5 mg / mL. Subsequently, the biotinylated DBCO-DNA probe was mixed with 40 μL of magnetic bead solution and incubated by rotation at room temperature in the dark for 30 min. After the reaction was completed, the DNA was magnetically separated and washed three times with 1× B&W buffer and resuspended in 20 μL of ultrapure water to obtain the DBCO-DNA-MB conjugate. The 5hmC-DNA modified by the above azide glycosylation was mixed with 40 μL of DBCO-DNA-MB conjugate and incubated on a roller for 15 min under dark conditions at room temperature to achieve specific coupling between the azide group and the DBCO group through click chemistry. The sample was then washed three times with 1× B&W buffer to remove unbound components and achieve enrichment and separation of the target DNA.

[0034] 3. TdT-mediated extension of nucleic acid ends Add 10 U of terminal deoxynucleotidyl transferase (TdT), 0.5 μL of dATP (10 mM) and 2 μL of 10× TdT reaction buffer to the above-enriched 20 μL 5hmC-DNA solution, and incubate at 37℃ for 1 h to perform the amplification reaction to generate poly(A) chains. Then, incubate at 75°C for 20 minutes to inactivate the TdT enzyme.

[0035] 4. APE1-triggered primer release and rolling circle amplification Add 1.6 μL of AP probe (10 μM), 2 U of APE1 enzyme and 3 μL of 10× NEBuffer4 to the above system and react at 37℃ for 1 h; Then, the reaction was terminated by reacting at 65°C for 20 minutes to release the primers; Subsequently, 1 μL of circular template (1 μM), 1 μL of dNTPs (2.5 mM), 4 U of Phi29 DNA polymerase and 1× Phi29 reaction buffer were added to the system, and rolling circle amplification (RCA) was performed by incubation at 30°C for 40 min. Then, the Phi29 polymerase was inactivated by reacting at 65°C for 20 min.

[0036] 5. DNA enzyme catalytic cleavage and fluorescence signal detection Add 10 μL of a 10 μM signal probe to the amplification product, and incubate the mixture at 35°C for 1 hour to amplify the fluorescence signal; Measurements were performed using a Hitachi F-7000 fluorescence spectrometer. The excitation / emission slits were both set to 5.0 nm, the excitation wavelength to 577 nm, and the emission wavelength scan range to 590 ~ 700 nm. The ROX fluorescence intensity at 608 nm was recorded for subsequent analysis.

[0037] A schematic diagram of the detection principle of this invention is shown below. Figure 1 As shown.

[0038] Example 2 Feasibility verification of the detection method of the present invention (1) Preparation of double-stranded DNA substrate for testing To verify the feasibility, sensitivity, and specificity of the detection system of this invention, a double-stranded DNA (dsDNA) substrate was constructed using artificially synthesized oligonucleotides containing different pyrimidine modification sites. The specific method is as follows: Add 10 μM of the target oligonucleotide and its corresponding complementary strand to 1× annealing buffer (50 mM NaCl, 10 mM Tris-HCl, pH 8.0), heat at 95°C for 5 min, and then slowly cool to room temperature to form a double-stranded DNA substrate. Store at 4°C for later use.

[0039] The constructed double-stranded DNA substrates contain 5-hydroxymethylcytosine (5hmC), 5-methylcytosine (5mC), and unmodified cytosine (C) sites, which are used for subsequent feasibility verification, sensitivity analysis, and specificity analysis experiments.

[0040] (2) Feasibility verification 1. The reaction product was added to a 14% polyacrylamide gel. Using 1× GelRed as the nucleic acid dye, electrophoresis was performed at a constant voltage of 120 V for 45 min in 1× TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH 8.0). The results were then observed and recorded using a gel imaging system. Figure 2 As shown in Figure A.

[0041] from Figure 2 Lane A shows that a specific linker band was observed when the glycosylated 5hmC DNA substrate was incubated with the DBCO-modified probe, confirming the effectiveness of the click chemistry-based module for 5hmC labeling and capture (lane 2). Subsequently, the high molecular weight band detected in the presence of TdT indicates that TdT successfully mediated the extension of the poly(A) tail, completing the crucial transition from target recognition to signal transduction (lane 3). Next, after APE1 treatment of the double strand formed by the poly(A) product and the AP probe, a cleavage product band of the expected size (21 nt) was generated, confirming that the AP site can be accurately recognized and cleaved by APE1, thereby releasing the primers required for subsequent amplification (lane 4). Finally, in the presence of a circular template and DNA polymerase, this 21 nt product triggered a distinct RCA product band (lane 5) and a signal probe cleavage band (lane 6), verifying that the released primers effectively initiated rolling circle amplification and generated catalytically active DNAzymes. In summary, the expected electrophoretic features at each step systematically demonstrate the logical rationality and experimental feasibility of this cascade amplification analysis.

[0042] 2. To further verify the feasibility of this detection method, fluorescence spectroscopy analysis was performed. The specific steps were as follows: After adding 10 μL of a 10 μM signal probe and incubating at 35 °C for 1 hour, measurements were taken using a Hitachi F-7000 fluorescence spectrophotometer. The excitation wavelength was set to 577 nm, and the emission spectrum was recorded within the wavelength range of 590 to 700 nm. The slit width for both excitation and emission was set to 5.0 nm, and the voltage was set to 950 V. Finally, the fluorescence intensity at 608 nm was recorded for data analysis. The results are shown below. Figure 2 As shown in B.

[0043] from Figure 2 As shown in Figure B, due to the extremely high specificity and efficiency of the enzymatic labeling process, only 5hmC could be effectively labeled with an azide group, while other cytosine derivatives (such as 5-methylcytosine (5mC), 5-formylcytosine (5fC), and 5-carboxycytosine (5caC)) remained unmodified. Therefore, in the control group lacking 5hmC-DNA (grey curve), DNA could not be effectively enriched, and subsequent amplification reactions failed. Correspondingly, no obvious fluorescence signal was detected at an excitation wavelength of 577 nm.

[0044] In contrast, a strong fluorescence signal (red curve) was detected in the experimental group containing 5hmC-DNA. This indicates that only 5hmC-DNA can produce a characteristic fluorescence signal in the complete reaction system. This study used the signal-to-noise ratio (F / F0) to evaluate the performance of this analytical method, and the results showed that the fluorescence signal in the presence of 5hmC-DNA was 10.03 times that in the absence of 5hmC-DNA.

[0045] 3. This study performed Zeta potential analysis on naked magnetic beads (MB) and DNA-conjugated magnetic beads (DNA-MB). The specific steps were as follows: Prepared naked magnetic bead (MB) solutions and DNA-conjugated DNA-MB solutions were appropriately diluted with ultrapure water and injected into a Zeta potential sample cell. The surface potentials were measured at room temperature using a Zeta potential analyzer. The results are shown below. Figure 2 As shown in C.

[0046] from Figure 2 As shown in Figure C, the zeta potential of the bare magnetic beads is +2.81 mV, while after DNA coupling, the zeta potential of DNA-MB drops significantly to -43.26 mV. This obvious negative shift confirms that the negatively charged DNA molecules have been successfully coupled to the surface of the magnetic beads.

[0047] Example 3 Sensitivity analysis of the detection method of the present invention To obtain optimal sensor performance, this paper systematically optimized a series of experimental conditions ( Figure 3 This includes the concentration of the AP probe, the concentration of the circular template, the amount of Phi29 DNA polymerase, and the RCA reaction time. Optimization of the AP probe includes... Figure 3 As shown in Figure A, F represents the fluorescence intensity in the presence of 5hmC DNA, and I0 represents the fluorescence intensity in the absence of 5hmC DNA. The relative fluorescence intensity value F / F0 increases rapidly in the range of 0.08 μM to 0.32 μM, reaching a maximum at 0.32 μM. A higher F / F0 value indicates a better signal-to-noise ratio under these conditions. This indicates that a 0.32 μM AP probe concentration is the optimal concentration for the reaction; therefore, a 0.32 μM AP probe concentration will be used in subsequent studies.

[0048] The concentration of the circular template directly determines the amount of product generated in the rolling circle amplification reaction (RCA). Therefore, this paper further optimizes the concentration of the circular template used in RCA. Figure 3 As shown in Figure B, the F / F0 ratio gradually increases as the template concentration increases from 8 nM to 20 nM, and decreases after exceeding 20 nM. This demonstrates that 20 nM is the optimal concentration for the cyclic template; therefore, a cyclic template concentration of 20 nM will be used in subsequent studies.

[0049] The amount of Phi29 DNA polymerase used affects the amplification rate and final signal intensity of the amplified strand; therefore, this paper optimizes the amount of Phi29 DNA polymerase used. Figure 3 As shown in Figure C, the F / F0 value increases as the enzyme dosage increases from 2 U to 4 U. When the dosage exceeds 4 U, the F / F0 value decreases. This is because Phi29 DNA polymerase has exonuclease activity, and excessive enzyme may cause abnormal degradation of the amplified strand, thereby interrupting the strand elongation process. Therefore, further experiments used 4 U of Phi29 DNA polymerase for RCA.

[0050] This study further explores the optimal time for Phi29 DNA polymerase to act on RCA, such as... Figure 3 As shown in Figure D, the F / F0 ratio gradually increased from 20 to 40 minutes during the reaction time, and then leveled off after 40 minutes. Therefore, a 40-minute incubation time was chosen as the optimal amplification duration for subsequent studies.

[0051] In this embodiment, under optimized experimental conditions, the changes in fluorescence intensity caused by different concentrations of 5hmC-DNA were measured to systematically evaluate the analytical sensitivity of the detection method of this invention. The results are as follows: Figure 4 As shown.

[0052] from Figure 4 As can be seen from Figure A, the fluorescence intensity significantly increases with increasing 5hmC-DNA concentration. From... Figure 4 As can be seen from Figure B, within the range of 10 fM to 10 nM, the fluorescence intensity (F) and the logarithm (C) of the 5hmC-DNA concentration exhibit a linear relationship, with the linear regression equation being: F = 2009.62 + 330.42 lgC, and the correlation coefficient (R²) being [missing value]. 2 The limit of detection (LOD) was calculated to be 4.41 fM by adding three times the standard deviation to the blank signal. Compared with surface-enhanced Raman spectroscopy (0.05 nM) and nanosphere fluorescence spectroscopy (0.167 nM), this method improves by 4 and 5 orders of magnitude, respectively.

[0053] Example 4 Specificity analysis of the detection method of the present invention This invention uses single-stranded oligonucleotides containing a 5hmC site (a-5hmC and...) ), 5mC site (a-mC and ) and unmodified cytosine sequences (aC and The ssDNA is paired and annealed to form different double-stranded DNA (dsDNA) duplexes, which is used to ensure the specificity of the method in this invention. The specific experimental steps are as follows: The above-mentioned double-stranded DNA substrates are prepared into 1 nM solutions, which are then added to the detection system to replace the target 5 hmC-DNA. After sequentially undergoing labeling, capture, and cascade signal amplification processes, the fluorescence intensity of each group of reaction solutions is measured at 608 nm and compared. The results are as follows: Figure 5 As shown in Figure A.

[0054] from Figure 5 As shown in Figure A, dsDNA lacking the 5hmC site produces an extremely low fluorescence signal intensity, comparable to the background level. In contrast, dsDNA containing the 5hmC site elicits a significantly enhanced fluorescence signal, with an intensity approximately 12.3 times that of the average signal in the control group of dsDNA without the 5hmC site. These results conclusively demonstrate that the detection method of this invention has high selectivity for 5hmC-DNA.

[0055] Example 5 Correlation analysis of the detection method of the present invention To further evaluate the quantitative accuracy and reliability of the proposed detection method, this paper investigates the correlation between the actual input 5hmC concentration and the measured value. The specific steps are as follows: A known concentration gradient (10...) is input into the system... -4 nM,10 -3 nM, 10 -2 nM, 10 -1 The fluorescence signal of 5hmC-DNA samples (nM, 1 nM) was measured. Then, the measured concentration of 5hmC was calculated in reverse based on the measured fluorescence signal using the established linear regression equation. Finally, the linear relationship between the measured concentration and the actual input concentration was compared and analyzed.

[0056] The results obtained are as follows Figure 5 As shown in B.

[0057] from Figure 5 As can be seen from Figure B, the 5hmC level measured by the detection method of this invention shows excellent consistency with the theoretical input concentration, with the regression equation being y = 0.01772 + 0.9985 lg C (R² = 0.9998), and the slope being very close to 1. These results strongly confirm that the detection method provided by this invention has high accuracy and reliability for the quantitative detection of 5hmC.

[0058] Example 6 Verify the feasibility of the detection method of this invention for whole-genome 5hmC analysis at the cellular level. All cell types (MCF-7, A549, HeLa, SK-N-BE(2), HEK-293, etc.) were cultured in Dulbecco modified Eagle medium (DMEM) with 10% (v / v) fetal bovine serum and 1% (v / v) antibiotic-antimycin (penicillin-streptomycin). The cell culture incubator was set to 37 °C and CO2 concentration of 5%. Cells were washed twice with 1×PBS buffer (pH 7.4), then digested with trypsin and collected in the exponential growth phase. The collected cells were resuspended in 200 μL of 1×PBS buffer (pH 7.4). Genomic DNA was extracted from the cells using the QIAamp DNA Mini Kit, and then the extracted DNA was further processed using dsDNA fragmentation enzyme to fragment the long DNA for subsequent experiments.

[0059] The procedure for applying the detection method of this invention to cell-level detection is as follows: Figure 6 As shown in Figure A.

[0060] The test samples in this embodiment included: one normal cell line: human embryonic kidney cells HEK 293 and four cancer cell lines: human lung adenocarcinoma cells (A549), human breast cancer cells (MCF-7), human neuroblastoma cells (SK-N-BE(2)), and human cervical cancer cells (HeLa). The distribution heatmap of 5hmC levels in the five different cell lines (HeLa, A549, MCF-7, SK-N-BE(2), HEK293) is shown below. Figure 6 As shown in B.

[0061] from Figure 6 As can be seen from Figure B, the abundance of 5-hydroxymethylcytosine in cancer cells is lower than that in normal cells.

[0062] The results of the 5hmC levels among the cell lines measured using the detection method of this invention are as follows: Figure 6 C and Figure 6 As shown in D. From Figure 6 As can be seen from the C-values, the 5hmC level in the normal HEK293 cell line was significantly higher than that in the three cancer cell lines (A549, MCF-7, and HeLa). ).from Figure 6 As can be seen from D, although SK-N-BE (2) is also a cancer cell line, its 5hmC level is significantly higher than that of A549, MCF-7 and HeLa cells, corresponding to its neural origin. This observation is consistent with the established 5hmC distribution pattern.

[0063] To examine the quantitative relationship between fluorescence signal and cell number, the neuroblastoma cell line SK-N-BE(2) was selected as the experimental model. The quantitative relationship was established as follows: First, SK-N-BE(2) cells were collected, and cell suspensions with different gradients ranging from 1 to 10,000 cells were prepared. Then, genomic DNA was extracted and fragmented using dsDNA fragmentation enzyme. Finally, the DNA was used as a detection target in the detection system of this invention, and the generated fluorescence intensity was recorded. The logarithmic relationship between fluorescence intensity and the number of SK-N-BE(2) cells was then examined. The results are shown below. Figure 6 As shown in E.

[0064] from Figure 6 As can be seen from E, the fluorescence intensity increases significantly with the increase of SK-N-BE(2) cell number. When plotted on a logarithmic scale, the fluorescence value (F) shows a robust linear correlation with the cell number (N) ranging from 1 to 10,000 cells. This relationship is expressed by the equation F = 427.2 lg N + 303.5 (R 2 =0.9961). The detection limit was calculated to be 0.729 cells based on the mean of the blank signal plus three times the standard deviation. These results demonstrate that the detection method provided by this invention can highly sensitively monitor endogenous 5hmC levels in complex biological samples.

[0065] Example 7 Verify the feasibility of the detection method of this invention for whole-genome 5hmC analysis at the human tissue level. Clinical tissue samples were first ground, and then genomic DNA was extracted from cells using the QIAamp DNA Mini Kit. The extracted DNA was then further processed using dsDNA fragmentation enzyme to fragment the long DNA chains for subsequent experiments. The 5hmC levels in genomic DNA isolated from seven human tissues (brain, liver, spinal cord, lung, heart, spleen, and kidney) were quantified using a commercially available enzyme-linked immunosorbent assay (ELISA) kit and the detection method provided in this invention. The flowchart of the detection process is shown below. Figure 7 As shown in Figure A.

[0066] For ELISA, a standard curve was generated using standard 5hmC DNA according to the manufacturer's instructions, and the results are as follows: Figure 7 As shown in Figure B, the calculation equation for ELISA is:

[0067] Where x represents the concentration of 5hmCDNA (ng / μL), and A and A0 represent the absorbance at 450 nm with and without 5hmCDNA, respectively. The calculated limit of detection is 0.17 ng / μL.

[0068] Then, using brain tissue genomic DNA as a model, the dose-response relationship of the detection method of this invention was further studied. The results are as follows: Figure 7 As shown in C.

[0069] from Figure 7 As can be seen from the data, within the range of 38.5 fg / μL to 3.85 ng / μL, the fluorescence intensity showed a linear correlation with the logarithm of the genomic DNA concentration (C), following the regression equation I = 1350 + 241.9lg C (R²). 2 =0.9904). This method achieved a limit of detection (LOD) of 16.8 fg / μL, which is lower than the LOD of commercial ELISA kits.

[0070] The ELISA method and this invention were used to detect and analyze the 5hmC content in seven human tissues. The specific detection steps were as follows: First, genomic DNA was extracted from the seven human tissue samples using a genomic DNA extraction kit and fragmented. Then, for each tissue type, 10 ng of genomic DNA was added to the detection system for each test, followed by specific glycosylation and azide labeling, magnetic separation, cascade nucleic acid signal amplification, and fluorescence signal measurement. Three repeated measurements were performed, and the corresponding 5hmC content ratio was calculated based on the standard curve. The resulting comparative bar chart and heatmap are shown below. Figure 7 As shown in D in 7 and E in 7.

[0071] The results show that the 5hmC abundance measured in this invention is as follows: brain (0.63%), liver (0.35%), spinal cord (0.15%), lung (0.16%), heart (0.24%), spleen (0.16%) and kidney (0.25%).

[0072] The correlation detection results between the present invention and the ELISA method are as follows: Figure 7 As shown in F.

[0073] from Figure 7 As can be seen from F, a strong linear relationship was established between the two methods, with a Pearson correlation coefficient R0. 2=0.9703 (p<0.0001). The linear regression equation (y = 0.01445 + 0.9315x) produced a slope close to 1 (b = 0.9315) and an intercept close to zero (a = 0.01445), indicating excellent agreement between the two methods. These results demonstrate that the 5hmC quantitative analysis method provided in this study is in good agreement with the gold standard ELISA method, validating its accuracy in real sample analysis.

Claims

1. A method for the in vitro quantitative detection of 5-hydroxymethylcytosine in isolated DNA samples for non-disease diagnosis and treatment, characterized in that, Includes the following steps: (1) Specific glycosylation and azide labeling of 5-hydroxymethylcytosine (5hmC): In a 20 μL reaction system, 600 ng / μL of the 5hmC-DNA to be tested, 2 μL of 10×NEBuffer 4, 10 μM of UDP-6-N3-Glu and 4 U of T4 phage β-glucosyltransferase were added, and the reaction was carried out at 37℃ for 2 h to specifically modify the 5-hydroxymethylcytosine in the 5hmC-DNA to be tested with azidoglycosylation, thereby obtaining glycosylated 5hmC-DNA containing azido groups; (2) Magnetic bead click capture and enrichment separation of target DNA: 40 μL of 1 μM biotinylated DBCO-DNA probe was mixed with 40 μL of 5 mg / mL streptavidin-coated magnetic beads and incubated in the dark for 30 min. After washing, the DBCO-DNA-MB conjugate was obtained. The glycosylated 5hmC-DNA containing azide groups obtained in step (1) was mixed with the DBCO-DNA-MB conjugate and incubated in the dark for 15 min to allow the azide groups and DBCO groups to covalently couple through a copper-free click chemical reaction. Then, magnetic separation and washing were performed using 1×B&W buffer to remove unbound DNA, unmodified background DNA and impurities, and the enriched 5hmC-DNA was obtained. The sequence of the biotinylated DBCO-DNA probe is as follows: Biotin-AGCTATCCATCC / iDBCOdT / AT-iInvdT; (3) TdT-mediated nucleic acid terminal polymerization and extension: 10 U of terminal deoxynucleotidyl transferase, 0.5 μL of 10 mM dATP and 2 μL of 10×TdT reaction buffer were added to 20 μL of the enriched 5hmC-DNA solution. The mixture was reacted at 37 °C for 1 h to allow the 3′ end of the enriched 5hmC-DNA to undergo template-independent extension and generate a poly(A) long chain. The mixture was then treated at 75 °C for 20 min to inactivate the terminal deoxynucleotidyl transferase. (4) APE1 cleaves the AP probe and releases the rolling circle amplification primers: Add 1.6 μL of 10 μM AP probe, 2 U of APE1 enzyme and 3 μL of 10×NEBuffer 4 to the reaction system obtained in step (3) to hybridize the AP probe with the poly(A) long chain. React at 37°C for 1 h. The APE1 enzyme recognizes and cuts the baseless site in the AP probe, releasing the single-stranded primer that can initiate rolling circle amplification. Then, react at 65°C for 20 min to terminate the APE1 enzyme reaction. The sequence of the AP probe is as follows: GCTGCTCCATCATTTTTTTTT / idSp / TTTTTTTTTTTT-NH2; (5) Rolling circle amplification and generation of DNAzyme catalytic units: Add 1 μL of 1 μM circular DNA template, 1 μL of 2.5 mM dNTPs, 4 U of Phi29 DNA polymerase and 1×Phi29 DNA polymerase reaction buffer to the reaction system obtained in step (4) to hybridize the single-stranded primers with the circular DNA template. Perform rolling circle amplification at 30°C for 40 min to generate a long-chain amplification product containing multiple DNAzyme catalytic units. Then react at 65°C for 20 min to inactivate Phi29 DNA polymerase. The sequence of the circular DNA template is as follows: P-AGACAAAGcCACCCTCCTCAGCAAGGTTTCCTTCGTTGTAGCTAGCCTCCCTGGGCACCTAAAAAAAAATGATGGAGCAGC; (6) DNAzyme cyclic catalytic cleavage and quantitative fluorescence detection: Add 10 μL of a 10 μM signal probe to the long chain amplification product obtained in step (5), and react at 35°C for 1 h. The DNAzyme catalytic unit cyclically recognizes and cuts the ribonucleotide cleavage site in the signal probe, so that the fluorescent group and the quenching group are separated and the fluorescent signal is released. The detection was performed using a fluorescence spectrometer with an excitation wavelength of 577 nm and an emission wavelength scanning range of 590–700 nm. The ROX fluorescence intensity at 608 nm was recorded, and the 5-hydroxymethylcytosine in the ex vivo DNA sample was quantified based on the fluorescence intensity. The sequence of the signal probes is as follows: ROX-AAGGTTCCTC / rA / / rU / CCCTGGGCA-BHQ2; The detection method does not include the step of determining the disease diagnosis or health status of the subject based on the detected 5-hydroxymethylcytosine content.

Images