A kit and method for detecting a genetic macular degeneration causative gene

Abstract

The present application relates to a kit and method for detecting genetic macular degeneration pathogenic genes, the kit comprising a hybridization mixture, the hybridization mixture comprising a probe set for detecting genetic macular degeneration pathogenic genes, the probe set comprising capture probes capable of simultaneously specifically capturing ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, TIMP3 pathogenic genes and MCDR3, MCDR1 pathogenic regions, the capture probes for capturing MCDR3, MCDR1 pathogenic regions comprising probes with sequences as shown in SEQ ID NO. 1-174, SEQ ID NO. 175-235 respectively. The present application proposes a targeted amplification strategy for NCMD non-coding pathogenic regions, successfully detects two new point mutations and one genomic structural variation, and realizes the detection of point mutations and structural variations in non-coding regions.

Description

Technical Field

[0001] This invention belongs to the field of gene diagnostic technology, specifically relating to a kit and method for detecting pathogenic genes of hereditary macular degeneration. Background Technology

[0002] Hereditary macular degeneration (IMD) is a group of monogenic inherited retinal diseases characterized by progressive degeneration of photoreceptor cells in the macula. Major IMD disorders include Stargardt's disease, vitrectomyeloid macular dystrophy, and North Carolina macular dystrophy. These diseases are characterized by early onset, rapid progression, and high rates of blindness, and are a significant cause of irreversible vision loss in the global working-age population. IMD exhibits significant heterogeneity in clinical phenotype, age of onset, rate of progression, and inheritance patterns. Its molecular basis involves multiple pathogenic genes, including ABCA4, BEST1, and PRPH2. Given the current lack of approved curative treatments, accurate early diagnosis, genotype-based prognostic assessment, and standardized follow-up management are crucial for delaying vision loss, guiding genetic counseling, and future participation in targeted therapy clinical trials.

[0003] North Carolina macular dystrophy (NCMD) is a rare, congenital, autosomal dominant macular disorder characterized by defects in the macular region. Patients experience poor vision from childhood, severely impacting their quality of life. Currently, NCMD is known to involve two main pathogenic regions, MCDR1 and MCDR3. MCDR1 is located on chromosome 6 (q14–q16.2), and MCDR3 is located on chromosome 5 (p15.33–p13.1). The pathogenic variants are highly unique compared to other genetic diseases; 20 different variants have been reported, primarily involving non-coding point mutations, CNVs, and SVs, which have traditionally been detected using WGS and third-generation long-length sequencing. Due to the rarity of the clinical manifestations of NCMD and the complexity of genetic testing, very few related cases have been reported in Asia previously. However, our team discovered over 20 NCMD patients in our research on ocular diseases and detected 7 different variants, including 3 newly discovered variants. These 3 new variants are all located in non-coding regions of the genome and involve complex genomic copy number variations. Based on this, we speculate that there are currently a large number of unidentified NCMD families in Asia. The locations of these newly discovered variants are close to those of the 20 previously reported variants, suggesting that there may be other unknown pathogenic variants in these two regions. Considering the large population of Asia and the current lack of clinical understanding of non-coding region mutations, the actual prevalence is likely much higher than the reported number. This means that current diagnostic methods do not yet cover many potential patients, posing a significant risk of missed diagnoses.

[0004] Stargardt disease (STGD) is the most common inherited macular dystrophy in adolescents. 95% of STGD cases are caused by mutations in ABCA4, also known as Stargardt disease type 1 (STGD1). ABCA4 encodes an ATP-binding cassette A4 transporter protein. Mutations are extremely diverse, including missense mutations, splicing abnormalities, heterozygous deletions, and promoter region mutations. Besides exonal region variations, previous reports indicate that 16.84% of mutations involve intron regions. In STGD patients where a clear cause cannot be detected by conventional methods, deep intron variations account for nearly 50%, and structural variations are also present. Methods that only capture coding regions cannot provide a definitive molecular diagnosis for these patients.

[0005] In addition, other rare STGD subtypes can be caused by other genes. Stargardt disease type 3 (STGD3) is usually inherited in an autosomal dominant manner and is associated with the ELOVL4 gene, which encodes a long-chain fatty acid elongase. Known pathogenic mutations are mostly frameshift mutations, often occurring at the C-terminus, making the mutant protein prone to forming aggregates within cells. These abnormal aggregates may interfere with the function of wild-type proteins through dominant-negative effects, leading to lipid imbalance in the retinal photoreceptor membrane and thus causing macular degeneration. Stargardt disease type 4 (STGD4) is inherited in an autosomal dominant manner and is associated with mutations in the PROM1 gene, mainly frameshift and missense mutations. PROM1 is involved in maintaining the function of the outer segment disc membrane of the retinal photoreceptor; its mutations can disrupt the structural integrity of photoreceptor cells, leading to decreased photosensitivity.

[0006] Vitelliform macular dystrophy (VMD) is another common subtype of IMD, characterized by yolk-like deposits in the center of the macula (usually the fovea). These deposits are primarily composed of lipofuscin and are clearly visible in fundus autofluorescence imaging. It is mainly caused by pathogenic mutations in the BEST1 gene, which leads to a spectrum of retinal diseases known as bestrophinopathies. These include Best Vitelliform Macular Dystrophy (BVMD), Autosomal Recessive Bestrophinopathy (ARB), Adult Onset Vitelliform Macular Dystrophy (AVMD), and Autosomal Dominant Vitreoretinalchoriodopathy (ADVIRC). The detection rate of BEST1 gene mutations was 96% in patients with autosomal dominant BVMD and 69% in sporadic cases, primarily missense variants. In biallelic variants of ARB, 98% were truncated variants, and 14-59% of patients meeting the clinical diagnostic criteria for ARB had no or only one BEST1 gene variant detected. Previous studies have demonstrated the presence of deep intron pathogenic variants in these patients as well.

[0007] Adult-onset VMD is genetically heterogeneous and can also be caused by other genes such as PRPH2, IMPG1, and IMPG2. PRPH2 is the second most common gene for AVMD, accounting for approximately 18% of patients. PRPH2 can also cause pattern dystrophy (PD). Nearly 70% of pathogenic mutations in PRPH2 occur in its EC2 / D2 loop (the second extracellular loop), a region crucial for the formation of homologous or heterologous oligomeric complexes. Mutations in this region significantly affect the function of normal proteins. Proteins encoded by IMPG1 (Interphotoreceptor Matrix Proteoglycan 1) and IMPG2 are key components of the extracellular matrix (IPM) of retinal photoreceptors, located between the outer segment of the photoreceptor and the retinal pigment epithelium. Heterozygous IMPG1 variants can cause both AVMD and PD, while IMPG2, in addition to causing autosomal dominant AVMD, has been found to have splicing variations associated with STGD.

[0008] Some cases of IMD can also be caused by mutations in the EFEMP1, RP1L1, or TIMP3 genes. EFEMP1 gene mutations lead to an autosomal dominant familial drusensis, also known as Doyne's honeycomb retinal dystrophy (DHRD), primarily caused by a missense mutation in exon 10, c.1033C>T (p.Arg345Trp). This causes abnormal aggregation of protein 1, a component of the fibronectin-epidermal growth factor domain, on the basal side of the retinal pigment epithelium (RPE), forming characteristic drusensis. Sorsby's macular dystrophy (SFD) is caused by mutations in the gene encoding tissue inhibitor of metalloproteinases-3 (TIMP3), and is inherited in an autosomal dominant manner. Known pathogenic missense mutations are mostly located in the C-terminal domain, interfering with normal protein folding or its binding to the extracellular matrix, leading to the deposition of drusen-like structures within Bruch's membrane. RP1L1-associated occult macular dystrophy (OMD) is also mostly autosomal dominant, with progressive central vision loss in both eyes as the main manifestation; more than 90% of patients carry missense variants, of which c.133C>T (p.Arg45Trp) accounts for nearly 70%, and another hotspot is located in the amino acid 1196–1201 region, accounting for about 25%.

[0009] In summary, hereditary macular degeneration (IMD) is a highly heterogeneous group of monogenic retinal diseases. Although significant progress has been made in gene therapy, with gene therapy drugs targeting pathogenic genes such as ABCA4, BEST1, and PRPH2 currently in clinical / preclinical trials, a definitive molecular diagnosis for the patient is an essential prerequisite for treatment. In clinical practice, in addition to coding region variations, there are splice site variations, structural and copy number variations in the deep intron regions of ABCA4 and BEST1, as well as non-coding region variations in the MCDR1 and MCDR3 regions, making traditional methods that only detect exon regions insufficient for accurate diagnosis.

[0010] In the context of precision medicine, there is an urgent need for an economical, rapid, targeted, and accurate high-throughput genetic testing platform that covers all pathogenic variants to address the pressing clinical need for molecular diagnostics of IMD. Rapid and targeted testing is essential to provide patients with timely gene therapy or other effective treatments, thereby slowing disease progression and improving their quality of life. Simultaneously, this testing will provide physicians with timely genetic counseling and reproductive guidance, reducing the risk of transmitting hereditary diseases. Therefore, conducting this test is of great significance for the diagnosis and treatment of IMD and for the precise screening of gene therapy clinical trials.

[0011] Currently, molecular diagnostics for IMD primarily relies on gene sequencing technology, with preferred methods including exon region targeted detection (single-gene / multi-gene panels), whole-exome sequencing (WES), and whole-genome sequencing (WGS). However, existing technologies have the following significant limitations: 1. Limited detection range: Except for WGS, other tests cannot detect non-coding regions. Conventional tests only cover gene exon regions, creating "blind spots" for deep introns, UTR regions, and upstream and downstream regulatory regions, and cannot fully capture pathogenic variants in non-coding regions.

[0012] 2. Insufficient variant type detection capability. It is difficult to identify all variant types in one go, and the detection sensitivity for large fragment insertions / deletions (Indels), copy number variations (CNVs), and complex structural variations (SVs) is limited; WES or WGS cannot complete the detection of all types of variants in one step, and the accuracy is limited.

[0013] 3. The testing process is cumbersome and inefficient. After WES / WGS screening, additional analysis of the deletion / duplication of the target gene is required to infer exon or whole-gene structural variations; further verification is required using methods such as quantitative PCR, long-range PCR, multiplex ligation-dependent probe amplification (MLPA), or gene-targeting microarrays. The testing cycle is long, the operation is complex, and the efficiency is low.

[0014] 4. Lack of targeted integrated detection solutions. Currently, there is no integrated detection solution for the full sequence (including upstream and downstream regions and complete intron regions) of key genes in IMD.

[0015] 5. Low accessibility of WGS in clinical applications. While the data volume is massive, the sequencing depth for key IMD genes is low, bioinformatics analysis is complex, and it demands extremely high computational resources and analytical capabilities; the testing cost is high, making it difficult to promote as a routine clinical testing method; and the large number of variants of unknown significance (VUS) makes clinical interpretation difficult, affecting diagnostic efficacy.

[0016] In summary, it is necessary to design effective reagent kits and corresponding detection methods to solve the following technical problems: (1) Previously overlooked non-coding region variants: detection of NCMD-related pathogenic regions MCDR1 and MCDR3; 20 different variants have been reported for the pathogenic regions MCDR1 and MCDR3, mainly involving non-coding point mutations, CNVs, and SVs. They were previously detected using WGS, third-generation long-length sequencing, etc. However, the rarity of the clinical manifestations of the disease and the complexity of gene testing, as well as the close proximity of the 20 variants, suggest that there may be other unknown pathogenic variants in these two regions. Current diagnostic methods have not yet covered many potential unknown variants, resulting in a huge risk of missed diagnosis. In addition, besides the pathogenic regions MCDR1 and MCDR3, non-coding regions such as the deep intron region of the ABCA4 gene, which contain structural variants of non-coding regions, have not been covered or focused on in previous targeted amplicon / exon detection, making it difficult to obtain a clear molecular diagnosis for these patients.

[0017] (2) Diverse types of mutations are difficult to be compatible: Traditional gene detection methods usually require the use of different technologies to detect point mutations, small fragment insertions / deletions, copy number variations and structural variations. The process is complex and inefficient, increasing costs and time.

[0018] (3) Time consumption for verification of test results: The preliminary results generated by high-throughput sequencing often need to be confirmed by low-throughput verification methods, which prolongs the detection cycle and increases the consumption of samples and reagents, thus restricting the widespread application of the technology in clinical practice. Summary of the Invention

[0019] To address the aforementioned technical problems, the present invention aims to provide a probe set, kit, and detection method for detecting pathogenic genes of hereditary macular degeneration. The present invention aims to comprehensively and accurately detect the pathogenic regions of pathogenic genes ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, TIMP3, as well as MCDR3 and MCDR1.

[0020] The objective of this invention is achieved through the following technical solution: A probe set for detecting pathogenic genes of hereditary macular degeneration, the probe set comprising capture probes capable of simultaneously and specifically capturing pathogenic genes ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, TIMP3, as well as pathogenic regions of MCDR3 and MCDR1, wherein the capture probes specifically capturing the pathogenic region of MCDR3 include probes with sequences as shown in SEQ ID NO.1-174; and the capture probes specifically capturing the pathogenic region of MCDR1 include probes with sequences as shown in SEQ ID NO.175-235.

[0021] This invention proposes a targeted amplification strategy for the non-coding pathogenic regions of NCMD. Capture probes designed for the MCDR3 and MCDR1 pathogenic regions successfully detected two novel point mutations (chr6: g.99593157A>G and chr6: g.99598996A>G) (the human reference genome used in this invention is GRCh38) and one genomic structural variant, specifically a large fragment duplication variant (chr5:4408587-4429165). This achieves the detection of point mutations and structural variants in non-coding regions, overcoming the difficulties of traditional techniques being unable to detect them or the high costs of WGS and third-generation sequencing. Furthermore, this probe set is a high-density capture probe designed by the inventors targeting common IMD pathogenic genes, comprehensively analyzing their variant spectra and sequence characteristics, optimizing the amplification region range, and including introns, UTR regions, and upstream and downstream 20kb regions.

[0022] The probe set includes capture probes that specifically capture the ABCA4 pathogenic gene, including probes with sequences as shown in SEQ ID NO. 236-257; and capture probes that specifically capture the BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3 pathogenic genes, including probes with sequences as shown in SEQ ID NO. 258-296.

[0023] The probe set described herein is used in the preparation of a kit for detecting genes causing hereditary macular degeneration.

[0024] A kit for detecting a gene causing hereditary macular degeneration, comprising a hybridization mixture including the probe set for detecting the gene causing hereditary macular degeneration.

[0025] The hybridization mixture also includes hybridization buffer, hybridization enhancer, universal blocking sequence mixture, and NF-water; the specific composition of the 19 μL hybridization mixture prepared by mixing the reagents is shown in the table below:

[0026] The kit further includes amplification reaction reagents for library hybridization capture followed by PCR enrichment, the amplification reaction reagents including a hot-start amplification reaction solution and an amplification primer premix.

[0027] The kit also includes pre-library construction reagents, which include enzyme digestion and fragmentation, end repair and A-tailing working solution, adapter ligation reagents, and pre-library amplification reagents. The enzyme digestion, fragmentation, end repair, and A-tailing working solution includes a fragmented end repair and A-tailing enzyme and a fragmented end repair and A-tailing buffer. The specific composition of 10 μL of the enzyme digestion, fragmentation, end repair, and A-tailing working solution is shown in the table below:

[0028] The connector bonding reagent includes a connector premix and a universal short connector; The pre-library amplification reagent includes paired-end tagged primers and a mixed reaction solution for library amplification, and the pre-library amplification system established by the pre-library amplification reagent is as follows:

[0029] Among them, the purified product after adapter ligation is the product obtained after purifying the DNA sample, digesting and fragmenting it with enzymes, repairing the ends, adding an A tail, ligating the adapter, and purifying it.

[0030] The application of the kit described herein in detecting pathogenic genes for hereditary macular degeneration.

[0031] The application described above, specifically the method for detecting the pathogenic gene for hereditary macular degeneration using the kit, is as follows: The extracted genomic DNA of the target sample was fragmented by enzyme digestion, end-modified, ligated with adapters, and amplified by PCR. A paired-end tag sequence was simultaneously introduced for sample identification during parallel testing of multiple samples. Subsequently, a specific capture probe designed for the target region was used to hybridize and capture the pre-library. Based on the principle of complementary base pairing in nucleic acid molecules, the probe specifically binds to the target DNA fragment in the genome. Streptavidin magnetic beads were used to capture the DNA fragment bound to the probe in the target region. The final library was then enriched by PCR amplification and sequencing using a reversible end-termination sequencing method. The sequencing data underwent bioinformatics analysis and genetic interpretation to determine whether clinically significant germline mutations existed in the tested samples. The capture probes include those capable of simultaneously and specifically capturing the pathogenic genes ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3, as well as the pathogenic regions of MCDR3 and MCDR1. The capture probes specifically capturing the pathogenic region of MCDR3 include probes with sequences as shown in SEQ ID NO.1-174; the capture probes specifically capturing the pathogenic region of MCDR1 include probes with sequences as shown in SEQ ID NO.175-235.

[0032] The method for detecting the pathogenic gene for hereditary macular degeneration using the aforementioned kit includes the following specific steps: (1) Extract genomic DNA from the target sample as a DNA sample; (2) Pre-library construction: The purified DNA sample was fragmented by enzyme digestion, end repaired, A-tailed, ligated with adapters, purified, and then amplified. The amplified products were then purified and quality-checked to obtain the pre-library. (3) Library hybridization: The pre-libraries are mixed to form a hybrid library; the target regions of the hybrid library are hybridized using capture probes; (4) Capture after hybridization: The capture magnetic beads are reacted with the hybridization mixture obtained after the hybridization reaction, and then the mixture is washed and eluted to obtain a DNA suspension with magnetic beads; then the library is enriched by PCR using amplification reaction reagents, and then purified and quality checked to form the final library. (5) DNA sequencing reaction: The sequencing reaction was performed using the reversible end-termination sequencing method; (6) Data analysis.

[0033] The pathogenic variants associated with hereditary macular degeneration detected using the probe set include the chr5:4408587-4429165 tandem repeat segment in the MCDR3 region and / or the g.99593157A>G non-coding point mutation in the MCDR1 region and / or the g.99598996A>G non-coding point mutation in the MCDR1 region.

[0034] A reagent for detecting the pathogenic variant, the reagent being primers, the primers comprising primers for detecting the chr5:4408587-4429165 tandem repeat region in the MCDR3 region and / or primers for detecting the g.99593157A>G non-coding point mutation in the MCDR1 region and / or primers for detecting the g.99598996A>G non-coding point mutation in the MCDR1 region; The primer sequences for detecting the chr5:4408587-4429165 tandem repeat region within the MCDR3 region are shown below: Forward primer sequence: 5'-ACAGACTTCATAGAACACTTCCA-3', Reverse primer sequence: 5'-GGTGATGTAAACCCCAGTGTG-3'; The primer sequences for detecting the g.99593157A>G non-coding point mutation within the MCDR1 region are shown below: Forward primer sequence: 5'- GGCTGGACCTTTTGCTCTGT -3', Reverse primer sequence: 5'- GTCAGGACAGGACTTGGTTGT-3'; The primer sequences for detecting the g.99598996A>G non-coding point mutation within the MCDR1 region are shown below: Forward primer sequence: 5'-GCCAGAAGTCCTGCTCCATT-3', Reverse primer sequence: 5'-TGCCCAACACATAACAGGCT-3'.

[0035] The application of the described reagents in the preparation of diagnostic reagents and / or kits for hereditary macular degeneration.

[0036] Compared with the prior art, the advantages of the present invention are as follows: 1. This invention proposes a targeted amplification strategy for the non-coding pathogenic region of NCMD, successfully detecting two novel point mutations (chr6: g.99593157A>G and chr6: g.99598996A>G) and one genomic structural variant, specifically a large fragment duplication variant (chr5:4408587-4429165). This achieves the detection of point mutations and structural variants in non-coding regions, overcoming the challenges of traditional techniques being unable to detect them or the high costs of WGS and third-generation sequencing.

[0037] Furthermore, the three newly identified variants proposed in this invention expand the pathogenic region variant spectrum of MCDR3 and MCDR1, providing important evidence for early molecular screening, family genetic research, and genetic counseling of hereditary macular degeneration (AMD). Additionally, those skilled in the art can design corresponding primers and / or probes based on these three newly identified variants to establish corresponding detection methods, enabling more in-depth and precise detection and research of these three variants. This provides strong evidence for the diagnosis and clinical treatment of NCMD.

[0038] 2. Precise design targeting the mutation spectrum of the target gene: This invention targets common pathogenic genes of IMD, comprehensively analyzes their mutation spectrum and sequence characteristics, optimizes the amplification region range, and designs a high-density capture probe that includes introns, UTR regions and upstream and downstream 20kb regions.

[0039] 3. One-step accurate detection of multiple variant types: Utilizing optimized kits and high-throughput sequencing technology, it can simultaneously detect point mutations, small fragment insertions / deletions, large fragment copy number variations, and complex structural variations (such as break sites).

[0040] Compared with traditional technologies, this invention achieves high throughput, full coverage and high accuracy in mutation detection, significantly improving detection efficiency, simplifying the process and reducing costs.

[0041] 4. This invention, through in-depth analysis and optimization of the target gene variant spectrum and sequence characteristics, designs an efficient and accurate amplification system. Combined with high-throughput sequencing technology, it achieves comprehensive detection of multiple types of IMD pathogenic gene variants, significantly improving detection efficiency and accuracy. The detection method established by the kit of this invention is a comprehensive technical system for one-step detection of multiple variants. Compared with existing technologies, this invention has the following outstanding advantages: (1) Simplify the testing process and reduce experimental costs; (2) Improve the mutation detection rate and coverage uniformity; (3) It has the potential for flexibility and personalized application, providing a powerful tool for the accurate diagnosis and personalized treatment of hereditary macular degeneration.

[0042] Specifically, this is reflected in: Compared to whole genome sequencing (WGS): 1) It avoids data redundancy in WGS detection and reduces reagent and sequencing costs by targeting specific detection needs of IMD pathogenic genes; 2) The kit of this invention significantly improves the detection rate of point mutations and minor variations through high-depth sequencing of specific regions.

[0043] Compared to whole exome sequencing (WES): 1) This kit covers single nucleotide variants and structural variants in non-coding regions that WES cannot detect, and can accurately locate breakpoints in structural variants; 2) In the detection of complex IMD variants, this kit can provide comprehensive gene mutation analysis, filling the blind spots of WES technology.

[0044] Compared to Sanger sequencing: 1) This kit offers advantages in high throughput and efficiency, enabling simultaneous detection of multiple genes and variant types, thus avoiding the low-throughput limitations of Sanger sequencing. 2) It provides more comprehensive genomic and genetic evidence in the diagnosis and differential diagnosis of IMD. Attached Figure Description

[0045] Figure 1 These are the fundus findings of two NCMD patients from the V21 family. Patients III:2 and IV:1 both eyes showed retinal and choroidal atrophy in the macular region, with the sclera visible through, presenting a crater-like appearance. Optical coherence tomography showed retinal defect-like lesions in the macular region.

[0046] Figure 2 It is an NCMD-V21 family tree. Indicates male patients, This refers to a normal woman. Indicates a normal male. Indicates the first witness.

[0047] Figure 3 It is a large repeat of chr5:4408587-4429165 (abbreviated as V21) in the MCDR3 region detected by IGV visualization.

[0048] Figure 4 This is the breakpoint of the V21 variant detected by Sanger assay.

[0049] Figure 5 This is a pedigree chart of NCMD patients carrying MCDR1 region variants; Indicates male patients, This refers to a normal woman. Indicates a normal male. Indicates the first witness.

[0050] Figure 6 This invention detects point mutations V22 and V23 in the non-coding region.

[0051] Figure 7 These are the V22 and V23 variants detected by Sanger testing.

[0052] Figure 8 A: WES assay did not detect the non-coding region in MCDR1. B: WGS assay detected the V23 point variant, with an average sequencing depth <100X.

[0053] Figure 9 The WES test report for the STGD patient did not provide a clear molecular diagnosis. A: The STGD-01 WES test report only detected one heterozygous ABCA4: NM_000350.3:c.1561del / p.Val521Serfs 47. Maternal variant. B: The patient's STGD-02WES test report showed only one heterozygous ABCA4: NM_000350.3:c.4687G>A / p.Gly1563Arg paternal variant.

[0054] Figure 10 This invention additionally detects deep intron variants, confirming that STGD patients carry the ABCA4 complex heterozygous variant. Detailed Implementation

[0055] The present invention will now be described in detail with reference to the accompanying drawings and embodiments: The reagents used in this invention are shown in the table below:

[0056]

[0057] This invention provides a probe set for detecting pathogenic genes of hereditary macular degeneration. The probe set includes capture probes capable of simultaneously and specifically capturing pathogenic genes ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3, as well as pathogenic regions of MCDR3 and MCDR1. The capture probes specifically capturing the MCDR3 pathogenic region include probes with sequences as shown in SEQ ID NO. 1-174; the capture probes specifically capturing the MCDR1 pathogenic region include probes with sequences as shown in SEQ ID NO. 175-235. Capture probes specifically targeting the ABCA4 pathogenic gene include probes with sequences shown in SEQ ID NO. 236-257; capture probes specifically targeting the BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3 pathogenic genes include probes with sequences shown in SEQ ID NO. 258-296. The sequences of the above capture probes are shown in the probe sequence listing below: probe sequence listing

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] A kit for detecting genes causing hereditary macular degeneration, comprising pre-library construction reagents, hybridization mixture, and amplification reaction reagents for library PCR enrichment; The preliminary library construction reagents include enzyme digestion and fragmentation, end repair and A-tailing working solution, adapter ligation reagents, and preliminary library amplification reagents. The enzyme digestion, fragmentation, end repair, and A-tailing working solution includes a fragmented end repair and A-tailing enzyme and a fragmented end repair and A-tailing buffer. The specific composition of 10 μL of the enzyme digestion, fragmentation, end repair, and A-tailing working solution is shown in the table below:

[0066] The connector bonding reagent includes a connector premix and a universal short connector; The pre-library amplification reagent includes paired-end tagged primers and a mixed reaction solution for library amplification, and the pre-library amplification system established by the pre-library amplification reagent is as follows:

[0067] Among them, the purified product after adapter ligation is the product obtained after purifying the DNA sample, digesting and fragmenting it with enzymes, repairing the ends, adding an A tail, ligating the adapter, and purifying it.

[0068] The hybridization mixture includes the probe set used to detect the pathogenic gene of hereditary macular degeneration. The hybridization mixture also includes a hybridization buffer, a hybridization enhancer, a universal blocking sequence mixture, and NF-water; the specific composition of the 19 μL hybridization mixture prepared by mixing these reagents is shown in the table below:

[0069] The amplification reaction reagents for library PCR enrichment include hot-start amplification reaction solution and amplification primer premix. Thaw the hot-start amplification reaction solution and amplification primer premix at room temperature, and prepare the PCR reaction system in a 0.2 mL PCR tube according to the table below:

[0070] The method for detecting the pathogenic gene of hereditary macular degeneration using the kit described in this invention includes the following specific steps: This kit is used to detect human genomic DNA samples. (1) DNA sample source: Genomic DNA extracted from human EDTA anticoagulated whole blood, tissues, cells, etc.

[0071] (2) DNA sample purification requirements: Applicable to library construction of 50 ng~200 ng human genomic DNA. For DNA samples with a high degree of degradation, it is recommended to use a starting amount of not less than 100 ng for library construction.

[0072]

Test Methods

[0073] 1.2 DNA template purification Arrange the DNA samples in the order of the library construction task sheet, and add NF water and 50 ng to 200 ng of DNA sample to the PCR 8-tube in sequence. The total volume of the sample and NF water is 30 μL.

[0074] Purification process: 1) Add 54 μL of purified magnetic beads (1.8×) to each sample, seal, vortex to mix, and let stand for 5 min.

[0075] 2) After instantaneous centrifugation, place the solution on a magnetic rack and wait for the solution to clarify. Discard the supernatant and keep the magnetic beads.

[0076] 3) Add 200 μL of freshly prepared 80% ethanol, let stand for 30 seconds, discard the supernatant, and repeat twice.

[0077] 4) After sealing, centrifuge briefly, place on a magnetic rack, wait for the solution to become clear, discard the remaining liquid using a small-range pipette tip, and let stand at room temperature until the magnetic beads dry (about 5 minutes).

[0078] 5) Add 22 μL of NF water, seal the container, vortex to mix, and let stand at room temperature for 5 minutes.

[0079] 6) Place the PCR tubes on a magnetic rack and let them stand until the solution becomes clear. Transfer 20 μL of the supernatant to a new tube.

[0080] 1.3 Enzyme digestion and fragmentation, end repair, and addition of A-tails After thawing, mix the fragmented end-repair and A-tailed enzyme and fragmented end-repair and A-tailed buffer solutions, centrifuge briefly, and place on ice. Also, remove a 1.5 mL EP tube, label it, and place it on ice. Prepare the enzyme digestion, fragmentation, end-repair, and A-tailed working solution according to the proportions in the table below, based on the number of samples:

[0081] Vortex for 10 seconds, briefly centrifuge, and then add 5 μL to the 20 μL purified sample prepared in the previous step, for a total reaction volume of 25 μL. After capping the tube tightly, vortex and briefly centrifuge. Place the tube in a PCR instrument and run the following enzyme digestion, fragmentation, end-repair, and A-tailing reaction program:

[0082] 1.4 Connector Connection Thaw the ligation premix and universal short connector on an ice box. After thawing, invert the ligation premix to mix thoroughly. Vortex the universal short connector for 10 seconds, then briefly centrifuge. Add 2.5 μL of universal short connector to each 25 μL sample (after A-tailing correction), cap the tube, vortex, and briefly centrifuge. Add 10 μL of ligation premix to the above mixture, cap the tube, vortex, and briefly centrifuge. The total reaction volume is 37.5 μL. Place the tube in a PCR instrument and run the following connector ligation program:

[0083] 1.5 Purification after adapter ligation Add 30 μL of purified magnetic beads (0.8×) to each 37.5 μL sample after connecting the connector, seal the sample, shake to mix, and let stand at room temperature for 5 min. Purify according to the steps in 1.2. After purification, the sample is eluted with 17 μL of NF water. After separating the magnetic beads, take 15 μL of supernatant into a new tube, which is the purified product.

[0084] 1.6 Preliminary Library Amplification Take 2× library amplification reaction mixture and paired-end labeled primers, vortex to mix, briefly centrifuge, and aliquot the 2× library amplification reaction mixture into 8-tube strips according to the sample volume. Place on ice for later use. Prepare the following reaction on ice:

[0085] After preparing the solution, cap the tubes, vortex to mix, and briefly centrifuge. Place the tubes in a PCR instrument and run the following PCR amplification program:

[0086] 1.7 Purification of Amplification Products Add 50 μL of purification magnetic beads (1×) to each tube of amplification product, seal the tube, shake to mix, and let stand at room temperature for 5 min. Purify according to the method in 1.2. After purification, elute the sample with 52 μL of NF water, and collect 50 μL of the elution supernatant as the pretext library.

[0087] 1.8 Pretext Library Quality Inspection 1.8.1 Qubit Quantization Use nucleic acid quantification reagents, such as the Qubit dsDNA HS Assay Kit and its accompanying instruments, to determine the concentration of the sample DNA library. The calculated total library volume should be greater than 600 ng. Otherwise, the library preparation sample does not meet the requirements and should be reconstructed.

[0088] 1.8.2 Fragment Quality Inspection Use capillary electrophoresis reagents and instruments for fragment quality control. The library fragments should be between 300-600 bp, without obvious small or large fragment peaks. Otherwise, the library construction sample does not meet the requirements and should be reconstructed.

[0089] 2-Library Hybridization 2.1 Creating a Mixed Document Library Task Sheet Members of the same family are located in the same mixed library, and there are no replicates in the same mixed library index. The total amount of pre-library is 3.6 μg and is mixed with equal mass, and the sex ratio is at least 4 males and 4 females.

[0090] 2.2 Library Hybrid The mixing process requires double verification. Following the library mixing task sheet, sequentially pipette the pre-libraries into new 1.5 mL centrifuge tubes and record the total volume of each mixed library. Thaw the Cot-1 DNA beforehand, add 5 μL of Cot-1 DNA to each mixed library, vortex to mix, and briefly centrifuge for subsequent purification steps.

[0091] 2.3 Preparation of hybridization mixture Hybridization mixture preparation: Take 0.2 mL of PCR tube labeling, and add pre-thawed hybridization buffer, hybridization enhancer, universal blocking sequence mixture, and IMD gene capture probe to prepare the hybridization mixture according to the table below:

[0092] Place the prepared hybridization mixture on ice for later use.

[0093] 2.4 Purification before hybridization 2.4.1 After equilibrating the purified magnetic beads at room temperature for 30 min, take 3 times the volume of the purified magnetic beads according to the total volume of the Chinese library in 2.2 and add them to the centrifuge tube containing the mixed library and blocking agent. Vortex to mix and let stand at room temperature for 5 min. The specific purification process is the same as in 1.2.

[0094] 2.4.2 Add 19 μL of the hybridization mixture prepared in step 2.3, vortex to mix, and let stand for 5 min.

[0095] 2.4.3 Place the tube on a magnetic rack and let it stand until the solution becomes clear. Transfer all the supernatant (volume should be no less than 17 μL) to a new 0.2 mL PCR tube. Place the PCR tube on the PCR instrument and prepare to run the hybridization reaction program.

[0096] 2.5 Running the hybridization reaction Run the following hybridization reaction program on the PCR amplification instrument:

[0097] 3. Capture after hybridization 3.1 Preparation of washing working solution Thaw the magnetic bead elution buffer and wash buffer in advance, and allow the captured magnetic beads to equilibrate to room temperature (30 min). Prepare the working solutions of magnetic bead elution buffer and wash buffer according to the following table based on the number of captured libraries:

[0098] 3.2 Target Fragment Capture 3.2.1 After equilibrating the capture magnetic beads in 3.1, vortex to mix for 15 s. Add 80 μL of magnetic beads (per capture library) to each library in a 0.2 mL PCR tube and mix by pipetting.

[0099] 3.2.2 After brief centrifugation, place on a magnetic rack until clear (~1 min), remove the supernatant, being careful to avoid picking up the magnetic beads.

[0100] 3.2.3 Add 200 μL of magnetic bead elution buffer working solution, vortex to mix thoroughly for 10 s, centrifuge briefly, place on a magnetic rack until clear (~1 min), remove the supernatant, and be careful to avoid aspirating the magnetic beads.

[0101] 3.2.4 Repeat operation 3.2.3 once.

[0102] 3.2.5 Add 100 μL of magnetic bead elution buffer working solution, vortex thoroughly for 10 s, centrifuge briefly, and then place on a magnetic rack until clear (~1 min). Discard the supernatant, taking care to avoid aspirating the magnetic beads. After brief centrifugation, use a small-range pipette tip to completely remove the supernatant.

[0103] 3.2.6 Add the hybridization mixture from the overnight hybridization reaction in step 2.3 (try to operate on a PCR instrument at 65℃), and mix by pipetting 10 times.

[0104] 3.2.7 Place the 0.2 mL PCR tube containing the capture magnetic beads and hybridization mixture at 65°C for 45 min. Vortex and resuspend the tube every 15 min during the reaction to prevent the magnetic beads from settling and splashing onto the PCR tube cap.

[0105] 3.3 Post-capture rinsing and elution 3.3.1 Add the above reaction products to a 1.5 mL PCR tube containing 100 μL of washing buffer 1 working solution preheated to 65 °C, and mix thoroughly by pipetting (preferably on a metal bath at 65 °C).

[0106] 3.3.2 After brief centrifugation, place on a magnetic rack until clear (~1 min), remove the supernatant, taking care to avoid picking up magnetic beads.

[0107] 3.3.3 Add 200 μL of preheated (65℃) strict washing buffer working solution, mix by pipetting 10 times, and let stand at 65℃ for 5 min.

[0108] 3.3.4 After brief centrifugation, place on a magnetic rack until clear (~1 min), remove the supernatant, being careful to avoid picking up the magnetic beads.

[0109] 3.3.5 Repeat steps 3.3.3 to 3.3.4 once.

[0110] 3.3.6 Add 200 μL of washing buffer 1 working solution, mix by pipetting 10 times, and shake at 2000 rpm for 2 min at room temperature.

[0111] 3.3.7 After brief centrifugation, place on a magnetic rack until clear (~1 min), remove the supernatant, being careful to avoid picking up the magnetic beads.

[0112] 3.3.8 Add 200 μL of washing buffer 2 working solution, mix by pipetting 10 times, and shake at 2000 rpm for 1 min at room temperature.

[0113] 3.3.9 After brief centrifugation, place on a magnetic rack until clear (~1 min), discard the supernatant, taking care to avoid picking up the magnetic beads.

[0114] 3.3.10 Add 200 μL of washing buffer 3 working solution, mix by pipetting 10 times, and then shake at 2000 rpm for 30 s at room temperature.

[0115] 3.3.11 After brief centrifugation, place on a magnetic rack until clear (~1 min), discard the supernatant, taking care to avoid picking up magnetic beads.

[0116] 3.3.12 Remove the centrifuge tube from the magnetic rack, centrifuge briefly, then place it back on the magnetic rack for ~30 s. Use a 10 μL pipette to remove as much residual liquid as possible.

[0117] 3.3.13 Add 20 μL of NF water, vortex to mix thoroughly, centrifuge briefly, and then perform PCR with magnetic beads.

[0118] 3.4 Library PCR Enrichment and Purification 3.4.1 Library PCR Enrichment Thaw the hot-start amplification reaction solution, amplification primer premix, and reagents at room temperature. Prepare the PCR reaction system in a 0.2 mL PCR tube according to the table below:

[0119] Run the following program on the PCR amplification instrument:

[0120] 3.4.2 Library Purification Add 50 μL (1×) DNA purification magnetic beads to the PCR reaction product in step 3.4.1, vortex to mix, and let stand at room temperature for 5 min. The specific purification process is the same as in 1.2.

[0121] 3.5 Final Library Quality Inspection The method is the same as in 1.8. Qubit quantification is performed, and the final total library size should be greater than 10 ng. Fragment quality control is performed, and the library fragments should be between 300 and 600 bp.

[0122] 4 DNA sequencing reaction The effective sequencing depth for each sample is no less than 150X.

[0123] 5. Data Analysis This kit is based on high-throughput sequencing technology and uses an open-source bioinformatics analysis workflow. After data splitting, Sentieon-bwa aligns the raw data with the reference genome hg38. Picard is used for quality control, deduplication, and sorting of the aligned BAM files, and Qualimap is used for quality control of the aligned files. Sentieon-GATK is used to analyze SNVs and small fragment indels in the filtered BAM files, and ISoGTools is used for site function annotation. For CNV copy number variation analysis, the CNVexon algorithm is used for exon-based copy number analysis. For pseudogenes and homologous region genes, a self-developed misalignment homologous region optimization algorithm is used for CNV detection.

[0124] The data quality control process consists of the following two parts: Step 1: Sample traceability and quality control, including sample gender determination, which is to determine the actual gender of the tested sample by the ratio of X to Y chromosome coverage in high-throughput sequencing data.

[0125] Step 2: Overall quality control of high-throughput sequencing, meeting the following requirements: Q30 of raw sequencing data ≥ 85%, effective depth of target region ≥ 150X, 20X coverage ≥ 95%, capture efficiency ≥ 65%, transversion rate of library samples between different batches, heterozygous to homozygous ratio, and no deviation in SNV / Indel site count.

[0126] Performance specifications and specific detection examples of this kit: To demonstrate the effectiveness of the kit described in this invention, a single-blind experiment was conducted using the above method, specifically testing 24 IMD probands and other IMD patients and their family members requiring definitive genetic diagnosis. DNA libraries were constructed and sequenced using the above technical solution. Sequencing results analysis showed that this kit can effectively detect gene mutations such as single-point base mutations, small deletions / duplications, and large fragment deletions.

[0127] Example 1. This invention can successfully detect a total of 24 cases covering different pathogenic genes / regions including ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG2, EFEMP1, RP1L1, TIMP3, MCDR1, and MCDR3, and can successfully identify various variant types including coding region point mutations, deep intron variants, small fragment insertions / deletions, copy number variations, and structural variations.

[0128] Table 1: Detection results of 24 positive validation samples

[0129] Example 2. The present invention can successfully detect the repeating of the chr5 segment (4408587-4429165, abbreviated as V21, 20578bp length) within the MCDR3 region. Patient clinical information in Family V21 (including their pedigree) Figure 2 As shown), the clinical diagnosis is "hereditary macular degeneration (North Carolina macular dystrophy, NCMD)". The fundus findings of two NCMD patients in the V21 family are as follows. Figure 1 As shown.

[0130]

[0131] The results of this invention in detecting large-fragment structural variations V21 (e.g.) Figure 3 (as shown) Figure 3 The large repeat (V21) fragment at chr5:4408587-4429165 within the MCDR3 region detected by IGV visualization. IGV (Integrative Genomics Viewer) visualization results of the MCDR1 pathogenic region detected by this invention: The green fragments detected within the red box at chr5:4408587 and chr5:4429165 represent the breakpoints of the tandem repeat insertion fragments.

[0132] Comparison and verification of Sanger test results: DNA samples from patients within the family were analyzed using polymerase chain reaction (PCR) and Sanger sequencing to verify the breaks in the inserted repetitive sequences. The primer pair used was: forward primer sequence: 5'-ACAGACTTCATAGAACACTTCCA-3', reverse primer sequence: 5'-GGTGATGTAAACCCCAGTGTG-3'. The Sanger assay verified the breakpoints of the detected V21 variant as follows: Figure 4 As shown.

[0133] Pathogenicity determination of the V21 variant in the MCDR3 region: Based on the guidelines for determining the pathogenicity of non-coding variants, the newly discovered V21 variant in this family was determined to be potentially pathogenic. Supporting evidence included: location within a mutation hotspot region (PM1); a variant not found in the population databases gnomAD and 1000 Genomes (PM2); family clinical data and test validation showing co-segregation of the variant with the patient (PP1); and high phenotypic specificity of the patient's phenotype for this variant region (PP4).

[0134] WES test results: Previous WES genetic testing results for patients in this family were negative.

[0135] Example 2 Comparison Conclusion: This example confirms that the kit of the present invention can efficiently detect large-fragment structural variations that WES cannot capture, and accurately determine the breakpoint location. The detection results can be verified by Sanger sequencing. Through the present invention, newly discovered variations in the MCDR3 region can be detected economically and efficiently. Therefore, the overall performance of this kit is better than that of WES detection.

[0136] Example 3. This invention can successfully detect two non-coding point mutations in the MCDR1 region: chr6:g.99593157A>G (abbreviated as V22) and chr6:g.99598996A>G (abbreviated as V23). Clinical information of three families: Family V22-1, Family V22-2, and Family V23 (their pedigrees are shown below). Figure 5 As shown in the figure, a total of 9 patients were clinically diagnosed with "hereditary macular degeneration (North Carolina macular dystrophy, NCMD)".

[0137]

[0138] The WES gene test results for NCMD patients were negative. However, the results of this invention's detection of non-coding region point mutations V22 and V23 are as follows: Figure 6 As shown.

[0139] Comparison and verification of Sanger test results: During PCR amplification, the primer sequence used for detecting the V22 site was 5'-GGCTGGACCTTTTGCTCTGT-3', and the reverse primer sequence was 5'-GTCAGGACAGGACTTGGTTGT-3'. The primer sequence used for detecting the V23 site was 5'-GCCAGAAGTCCTGCTCCATT-3', and the reverse primer sequence was 5'-TGCCCAACACATAACAGGCT-3'. Sanger assays were used to verify the detected V22 and V23 variants as follows: Figure 7As shown.

[0140] Pathogenicity determination of V22 and V23 variants in the MCDR1 region: Based on the guidelines for determining the pathogenicity of non-coding variants, the newly discovered V22 and V23 variants in this family were determined to be probably pathogenic. Supporting evidence included: location within a mutation hotspot region (PM1); variants not present in the population databases gnomAD and 1000 Genomes (PM2); co-segregation of these variants in patients, but not carried by healthy family members (PP1); and high specificity of the patient's phenotype for the variant region (PP4).

[0141] The results of the detection using WES and WGS are as follows Figure 8 As shown. A: WES detection did not detect the non-coding region in MCDR1. B: WGS detection could detect the V23 point variant, with an average sequencing depth <100X.

[0142] Example 3 Conclusion: The MCDR1 region is a non-coding region that cannot be covered by WES detection. WGS has a wide detection range, reports a large number of SNVs, and is difficult to interpret and analyze. This kit can detect single-point base mutations in non-coding regions with high efficiency and accuracy. The sequencing depth is higher than that of WGS, and the accuracy can be verified by Sanger sequencing. Therefore, the overall performance of this kit is better than WES and Sanger sequencing, and its cost-effectiveness and practicality are better than WGS detection.

[0143] Example 4. Previous WES gene testing in multiple STGD patients only revealed one heterozygous pathogenic variant in ABCA4. This invention successfully detected another deep intron variant in ABCA4. Previous Western Spectroscopy (WES) testing in STGD patients only revealed a heterozygous pathogenic variant in the ABCA4 gene, which was insufficient for a complete molecular diagnosis of STGD caused by ABCA4 in an autosomal recessive manner. Due to the technical limitations of WES testing, it is impossible to rule out the presence of other pathogenic variants in this gene, such as copy number variations or non-coding region variations. Therefore, it is recommended to use other testing methods to further investigate pathogenic variants in the ABCA4 gene.

[0144] Results of WES detection, such as Figure 9 As shown, according to Figure 9 It can be seen that the WES test report of STGD patients did not clearly indicate a molecular diagnosis. Figure 9 A: Patient STGD-01 WES test report, only one heterozygous ABCA4 was detected: NM_000350.3:c.1561del / p.Val521Serfs 47. Maternal variant. B: Patient STGD-02 WES test report, only one heterozygous ABCA4 was detected: NM_000350.3:c.4687G>A / p.Gly1563Arg paternal variant.

[0145] This invention successfully detected two pathogenic ABCA4 variants, including one additional variant located in a non-coding region (e.g., ...). Figure 10 (as shown) Figure 10 To further detect deep intron variants, this invention identifies STGD patients carrying the ABCA4 complex heterozygous variant. In STGD-01 and STGD-02 patients, in addition to detecting small fragment deletions and point mutations in the exon regions, this invention also detected the ABCA4:c.161-395G>A / p.? heterozygous variant located in the deep intron region.

[0146] Comparative conclusion: This representative embodiment confirms that the present invention can detect not only small fragment deletions and point mutations in the coding region, but also successfully detect deep intron variations in the ABCA4 gene. It has clear technical advantages and clinical application value in the detection of deep intron variations in the ABCA4 gene, making up for the detection blind spots of WES in regions outside the coding region. It can effectively solve the limitations of traditional WES detection in the molecular diagnosis of STGD patients and improve the completeness and accuracy of genetic diagnosis.

[0147] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A probe set for detecting pathogenic genes of hereditary macular degeneration, characterized in that: The probe set includes capture probes capable of simultaneously and specifically capturing the pathogenic genes ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3, as well as the pathogenic regions of MCDR3 and MCDR1. The capture probes specifically capturing the pathogenic region of MCDR3 include probes with sequences as shown in SEQ ID NO.1-174; the capture probes specifically capturing the pathogenic region of MCDR1 include probes with sequences as shown in SEQ ID NO.175-235.

2. The probe assembly according to claim 1, characterized in that: Capture probes that specifically capture the ABCA4 pathogenic gene include probes with sequences as shown in SEQ ID NO.236-257; Capture probes that specifically capture pathogenic genes BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3 include probes with sequences as shown in SEQ ID NO. 258-296.

3. The use of the probe set as described in any one of claims 1 or 2 in the preparation of a kit for detecting pathogenic genes of hereditary macular degeneration.

4. A kit for detecting the pathogenic gene of hereditary macular degeneration, characterized in that: It includes a hybridization mixture comprising a probe set for detecting pathogenic genes of hereditary macular degeneration as described in any one of claims 1 or 2.

5. The reagent kit according to claim 4, characterized in that: The hybridization mixture also includes hybridization buffer, hybridization enhancer, universal blocking sequence mixture, and NF-water; the specific composition of the 19 μL hybridization mixture prepared by mixing the reagents is shown in the table below: 。 6. The use of the kit as described in claim 4 or 5 in the preparation of products for detecting the pathogenic gene of hereditary macular degeneration.

7. The application as described in claim 6, characterized in that: The method for detecting the pathogenic gene for hereditary macular degeneration using the aforementioned kit is as follows: The extracted genomic DNA of the target sample was fragmented by enzyme digestion, end-modified, ligated with adapters, and amplified by PCR. A paired-end tag sequence was simultaneously introduced for sample identification during parallel testing of multiple samples. Subsequently, a specific capture probe designed for the target region was used to hybridize and capture the pre-library. Based on the principle of complementary base pairing in nucleic acid molecules, the probe specifically binds to the target DNA fragment in the genome. Streptavidin magnetic beads were used to capture the DNA fragment bound to the probe in the target region. The final library was then enriched by PCR amplification and sequencing using a reversible end-termination sequencing method. The sequencing data underwent bioinformatics analysis and genetic interpretation to determine whether clinically significant germline mutations existed in the tested samples. The capture probes include those capable of simultaneously and specifically capturing the pathogenic genes ABCA4, BEST1, PRPH2, ELOVL4, PROM1, IMPG1, IMPG2, EFEMP1, RP1L1, and TIMP3, as well as the pathogenic regions of MCDR3 and MCDR1. The capture probes specifically capturing the pathogenic region of MCDR3 include probes with sequences as shown in SEQ ID NO.1-174; the capture probes specifically capturing the pathogenic region of MCDR1 include probes with sequences as shown in SEQ ID NO.175-235.

8. A reagent for detecting pathogenic variants associated with hereditary macular degeneration, characterized in that: The reagent is a primer, which includes primers for detecting the chr5:4408587-4429165 tandem repeat region in the MCDR3 region and / or primers for detecting the g.99593157A>G non-coding point mutation in the MCDR1 region; The primer sequences for detecting the chr5:4408587-4429165 tandem repeat region within the MCDR3 region are shown below: Forward primer sequence: 5'-ACAGACTTCATAGAACACTTCCA-3', Reverse primer sequence: 5'-GGTGATGTAAACCCCAGTGTG-3'; The primer sequences for detecting the g.99593157A>G non-coding point mutation within the MCDR1 region are shown below: Forward primer sequence: 5'- GGCTGGACCTTTTGCTCTGT -3', Reverse primer sequence: 5'- GTCAGGACAGGACTTGGTTGT-3'.

9. The use of the reagent as described in claim 8 in the preparation of diagnostic reagents and / or kits for hereditary macular degeneration.

Images