SNP molecular marker related to mandarin fish feeding habit and application

Abstract

The application discloses a SNP molecular marker related to a Siniperca chuatsi domestication trait and application, and belongs to the technical field of aquatic product molecular genetics and breeding. In view of the problems of lacking a SNP molecular marker stably related to the Siniperca chuatsi domestication trait, long traditional breeding cycle and low efficiency, the application provides three SNP molecular markers, i.e. a polymorphic base G / A at a 2854374th position of a 13th chromosome of the Siniperca chuatsi, a polymorphic base G / A at a 2849943rd position of the 13th chromosome of the Siniperca chuatsi and a polymorphic base C / G at a 2803913rd position of the 13th chromosome of the Siniperca chuatsi, and the domestication trait is an individual weight gain rate in a Siniperca chuatsi domesticated feed process. By detecting the genotypes of the above-mentioned positions, whether the Siniperca chuatsi individual is easy to accept artificial compound feed can be effectively distinguished. The SNP molecular marker can be used for breeding a Siniperca chuatsi elite with high artificial compound feed acceptance and fast growth speed, early screening is realized, a breeding cycle is shortened, and breeding cost is reduced.

Description

Technical Field

[0001] This invention belongs to the field of aquatic molecular genetics breeding technology, specifically involving SNP molecular markers related to the feeding traits of mandarin fish and their applications. Background Technology

[0002] Mandarin fish (Siniperca chuatsi) is a unique, high-quality, and valuable freshwater economic fish species in my country. Its tender flesh and rich nutrition make it highly sought after by consumers and enjoy extremely high market recognition. It is a core premium species in my country's freshwater aquaculture industry. Currently, the mandarin fish farming industry is massive, possessing extremely high economic value and broad development prospects. However, mandarin fish are inherently carnivorous, feeding only on live prey in their natural state. The difficulty in domesticating them with formulated feeds has become a core bottleneck restricting the development of large-scale, intensive artificial aquaculture.

[0003] Currently, the mandarin fish farming industry still heavily relies on live bait fish for feeding. This not only results in high bait costs and unstable bait supply, but also means that live bait easily carries aquatic pathogens and parasites, which can easily trigger outbreaks of mandarin fish diseases, significantly increasing farming risks and losses. Furthermore, uneaten live bait can easily pollute the aquaculture water, causing water quality deterioration, which does not meet the current requirements for green and ecological aquaculture. Therefore, achieving the domestication of mandarin fish to artificial formulated feed and cultivating superior mandarin fish breeds that are easy to feed and grow quickly after domestication is key to breaking through the barriers of the mandarin fish farming industry and promoting its standardization and large-scale development.

[0004] Currently, the breeding of mandarin fish relies heavily on traditional phenotypic selection methods, which involve manually observing individual feed intake and statistically analyzing weight gain to select superior individuals. However, traditional breeding methods are greatly affected by the farming environment and human judgment standards, resulting in low accuracy, high subjectivity, and the ability to conduct trait screening only in the mid-to-late stages of mandarin fish growth, thus failing to achieve early selection. This approach also suffers from numerous drawbacks, including long breeding cycles, heavy screening workload, low breeding efficiency, and high breeding costs.

[0005] Molecular marker-assisted breeding (MMR) can precisely screen superior germplasm based on gene loci, effectively avoiding the drawbacks of traditional phenotypic selection. It enables early, efficient, and precise breeding of superior aquatic animal breeds and is currently the mainstream technology in the field of aquatic breeding. However, research on the molecular mechanisms of feeding traits in mandarin fish is relatively weak at present. The number of feeding-related functional molecular markers developed is extremely small, and there is a lack of stable and strongly correlated SNP functional markers, which makes it difficult to meet the industrial demand for large-scale molecular-assisted breeding of mandarin fish. This seriously restricts the breeding process and industrial upgrading of easily feeding mandarin fish breeds.

[0006] Therefore, identifying functional genes and specific SNP molecular markers closely related to the feeding and growth traits of mandarin fish, and constructing an efficient and precise molecular breeding system for feeding traits of mandarin fish, is of great practical significance and industrial value for shortening the breeding cycle of mandarin fish, reducing breeding costs, cultivating superior varieties of mandarin fish that are easy to feed, and promoting the high-quality development of the mandarin fish farming industry. Summary of the Invention

[0007] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0008] Another objective of this invention is to provide SNP molecular markers related to the domestication traits of mandarin fish.

[0009] Another objective of this invention is to provide amplification primers for detecting the SNP molecular markers associated with the domestication traits of mandarin fish.

[0010] Another objective of this invention is to provide a method for distinguishing whether an individual mandarin fish is receptive to artificial formulated feed.

[0011] Another object of the present invention is to provide a method for screening mandarin fish that are readily accepting artificial compound feed.

[0012] Another objective of this invention is to provide a reagent kit.

[0013] Another objective of this invention is to provide the application of the SNP molecular marker, the amplification primer, or the kit in the selection of superior mandarin fish breeds that are highly accepting of artificial feed and have a fast growth rate.

[0014] Therefore, the technical solution provided by this invention is as follows: Firstly, SNP molecular markers related to the domestication traits of mandarin fish, wherein the SNP molecular markers are as shown in 1), 2), or 3) below: 1) Located at position 2854374 on chromosome 13 of the mandarin fish, the polymorphic base is G / A, which is referred to as molecular marker SNPchr13_2854374 in this paper; 2) Located at position 2849943 on chromosome 13 of the mandarin fish, the polymorphic base is G / A, which is referred to as molecular marker SNPchr13_2849943 in this paper; 3) Located at position 2803913 on chromosome 13 of the mandarin fish, the polymorphic base is C / G; referred to in this paper as molecular marker SNPchr13_2803913; The domestication trait refers to the weight gain rate during the domestication process of mandarin fish with feed.

[0015] Secondly, the amplification primers for detecting the SNP molecular markers associated with the domestication traits of mandarin fish include primer pairs capable of detecting one or more of the three SNP molecular markers.

[0016] Preferably, the amplification primers include: As shown in SEQ ID NO:1 and SEQ ID NO:2, a pair of primers can amplify the molecular marker SNP chr13_2854374; The primer pair shown in SEQ ID NO:3 and SEQ ID NO:4 can amplify the molecular marker SNP chr13_2849943, and / or, The primer pair shown in SEQ ID NO:5 and SEQ ID NO:6 can amplify the molecular marker SNP chr13_2803913.

[0017] Thirdly, a method for distinguishing whether an individual mandarin fish is receptive to artificial formulated feed includes: detecting the genotype of the mandarin fish to be tested at at least one polymorphic locus selected from the following group: 1) The G / A polymorphism site located at position 2854374 on chromosome 13 of the mandarin fish; 2) The G / A polymorphism site located at position 2849943 on chromosome 13 of the mandarin fish; 3) The C / G polymorphism site located at position 2803913 on chromosome 13 of the mandarin fish; Among them, when the genotype at the polymorphic site is detected to be the preferred genotype, it is determined that the mandarin fish individual has a higher acceptance of artificial compound feed; When the genotype at the polymorphic site is detected to be a non-preferred genotype, it is determined that the feed acceptance of the mandarin fish individual is relatively low. The preferred genotype is GG.

[0018] Fourthly, methods for screening mandarin fish that readily accept formulated feed include: Step 1: Extract genomic DNA from the individual mandarin fish to be tested; Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO:1 and SEQ ID NO:2, primer pairs as shown in SEQ ID NO:3 and SEQ ID NO:4, and / or primer pairs as shown in SEQ ID NO:5 and SEQ ID NO:6 respectively; Step 3: Sequencing analysis is performed on the amplification products obtained in Step 2 to determine the genotype of the SNP molecular markers of the mandarin fish individuals to be tested. Genotype analysis is then used to determine whether the mandarin fish to be tested are susceptible to artificial compound feed.

[0019] Preferably, in the method for screening mandarin fish that readily accept artificial feed, in step three, when performing PCR amplification with a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2, the polymorphic base located at position 2854374 on chromosome 13 of the mandarin fish is detected. Mandarin fish carrying the GG genotype are mandarin fish that readily accept artificial feed and have a high acceptance rate of artificial feed, while mandarin fish carrying the GA or AA genotypes have a relatively low acceptance rate of artificial feed. When PCR amplification was performed using the primer pair shown in SEQ ID NO:3 and SEQ ID NO:4, the polymorphic base located at position 2849943 on chromosome 13 of mandarin fish was detected. Mandarin fish carrying the GG genotype were more accepting of artificial feed and had a high acceptance rate of artificial feed. Mandarin fish carrying the AA genotype had a relatively low acceptance rate of artificial feed. The weight gain rate of mandarin fish carrying the GA genotype was significantly higher than that of individuals carrying the AA genotype. When PCR amplification was performed using the primer pair shown in SEQ ID NO:5 and SEQ ID NO:6, the polymorphic base located at position 2803913 on chromosome 13 of mandarin fish was detected. Mandarin fish carrying the GG genotype were more likely to accept artificial feed and had a high acceptance rate of artificial feed. Mandarin fish carrying the GC or CC genotypes had a relatively low acceptance rate of artificial feed.

[0020] Preferably, in the method for screening mandarin fish that are easy to accept artificial compound feed, mandarin fish carrying the GG genotype are easy to tame and gain weight quickly.

[0021] Preferably, in the method for screening mandarin fish that are readily accepting artificial compound feed, in step three, the genomic DNA of the mandarin fish to be tested is extracted from the fin tissue.

[0022] Fifthly, a kit containing amplification primers capable of detecting the SNP molecular markers associated with the domestication traits of mandarin fish.

[0023] The sixth aspect concerns the application of the SNP molecular marker, the amplification primers, or the kit in the selection of superior mandarin fish breeds that are highly accepting of artificial feed and have a fast growth rate.

[0024] The seventh aspect involves methods for breeding mandarin fish that are easy to tame and have a fast growth rate, including the following steps: Step 1: Extract DNA from the fin rays of the mandarin fish to be tested; Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO:1 and SEQ ID NO:2, primer pairs as shown in SEQ ID NO:3 and SEQ ID NO:4, and primer pairs as shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. Step 3: Sequencing analysis of the amplification products obtained in Step 2 to determine the genotype of the SNP molecular marker of the mandarin fish to be tested, and to determine whether the mandarin fish has the potential to be easily domesticated and grow rapidly through genotype analysis.

[0025] Preferably, in the method for breeding mandarin fish that are easy to tame and grow quickly, in step three, when performing PCR amplification with a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2, the polymorphic base located at position 2854374 on chromosome 13 of the mandarin fish is detected. The mandarin fish with the genotype GG (as shown in the base sequence of SEQ ID NO:7) has the potential to be easy to tame and grow quickly.

[0026] Preferably, in the method for breeding mandarin fish with easy acclimatization and fast growth rate, in step three, when performing PCR amplification with a primer pair as shown in SEQ ID NO:3 and SEQ ID NO:4, the polymorphic base located at position 2849943 on chromosome 13 of the mandarin fish is detected. The mandarin fish with the genotype GG (base sequence as shown in SEQ ID NO:8) has the potential to be easy to acclimatize and have a fast growth rate.

[0027] Preferably, in the method for breeding mandarin fish that are easy to tame and have a fast growth rate, in step three, when performing PCR amplification with a primer pair as shown in SEQ ID NO:5 and SEQ ID NO:6, the polymorphic base located at position 2803913 on chromosome 13 of the mandarin fish is detected. The mandarin fish with the genotype GG (as shown in the base sequence of SEQ ID NO:9) has the potential to be easy to tame and have a fast growth rate.

[0028] When the molecular marker is SNP chr13_2854374, mandarin fish with genotype GG have a higher weight gain rate during domestication, while those with genotypes GA and AA have a lower weight gain rate. When the molecular marker is SNP chr13_2849943, mandarin fish with genotype GG have a higher weight gain rate during domestication, while those with genotypes GA and AA have a lower weight gain rate. When the molecular marker is SNP chr13_2803913, mandarin fish with genotype GG have a higher weight gain rate during domestication, while those with genotypes GC and CC have a lower weight gain rate.

[0029] The present invention has at least the following beneficial effects: (1) This invention conducts genome-wide association analysis on a mandarin fish population to identify key gene loci associated with the mandarin fish's acclimatization trait. Three candidate SNP loci with significant associations to the acclimatization trait were ultimately selected: SNP chr13_2854374, SNP chr13_2849943, and SNP chr13_2803913. The results showed that the GG genotype was the preferred genotype in SNP chr13_2854374, SNP chr13_2849943, and SNP chr13_2803913. Mandarin fish carrying these genotypes are easier to acclimatize and grow faster. The three SNP sites mentioned above are highly stable and have a high correlation with traits. They can be used as specific molecular markers to accurately predict whether mandarin fish are easy to tame and their growth rate after taming. They can be effectively applied to molecular marker-assisted breeding of mandarin fish and have excellent breeding application value and industrialization prospects.

[0030] (2) The SNP marker of the present invention can complete the SNP locus genotype determination by using specific amplification primers. The detection method is simple to operate, has a short detection cycle, stable and reliable detection results, and low detection cost.

[0031] (3) The detection results of the SNP molecular markers of this invention are not affected by external factors such as the age and sex of the mandarin fish individuals. The markers have extremely high universality and stability, enabling early screening of mandarin fish that are easy to tame and grow rapidly. There is no need to wait for the individual traits to mature before conducting phenotypic identification, which greatly reduces the workload of artificial breeding, effectively shortens the breeding cycle, accelerates the process of selecting superior varieties, significantly improves the breeding efficiency of mandarin fish, and reduces the breeding production cost. This invention can efficiently screen for mandarin fish individuals that are easy to tame and grow rapidly, which is of great significance for improving the production performance of mandarin fish farming, reducing the cost of large-scale farming, and improving the economic benefits of aquaculture. It has extremely high industrialization promotion value and application prospects.

[0032] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0033] Figure 1 The images show the Manhattan plot and QQ plot in the GWAS analysis of the feeding traits of mandarin fish provided in this embodiment of the invention, where A is the Manhattan plot and B is the QQ plot.

[0034] Figure 2 This is a graph showing the statistical results of the weight gain rate of mandarin fish carrying different genotypes of SNP chr13_2854374 in the embodiments of the present invention. In this graph, A is the whole genome resequencing screening result and B is the first generation sequencing verification result.

[0035] Figure 3 This is a graph showing the statistical results of the weight gain rate of mandarin fish carrying different genotypes of SNP chr13_2849943 in the embodiments of the present invention. In this graph, A is the whole genome resequencing screening result and B is the first generation sequencing verification result.

[0036] Figure 4 This is a graph showing the statistical results of the weight gain rate of mandarin fish carrying different genotypes of SNP chr13_2803913 in the embodiments of the present invention. In this graph, A is the whole genome resequencing screening result and B is the first generation sequencing verification result. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description. It should be noted that, unless otherwise specified, the experimental methods described in the following embodiments are conventional methods, and the reagents and materials described are commercially available unless otherwise specified.

[0038] This invention focuses on the genetic improvement of the acclimatization trait in mandarin fish. It applies SNP molecular marker information to the molecular marker selection of the acclimatization trait in mandarin fish, and has invented a molecular marker related to the acclimatization trait that is simple and quick to operate, accurate and reliable in results, and low in cost, making it suitable for widespread application.

[0039] The SNP molecular markers related to the acclimatization trait of mandarin fish in this invention include the following three sites: 1) located at position 2854374 on chromosome 13 of mandarin fish, with a polymorphic base of G / A; 2) located at position 2849943 on chromosome 13 of mandarin fish, with a polymorphic base of G / A; 3) located at position 2803913 on chromosome 13 of mandarin fish, with a polymorphic base of C / G. This invention also discloses the application of these SNP molecular markers, amplification primers, and detection kits in the breeding of mandarin fish strains that are easily acclimatized and have a fast growth rate. The molecular markers described in this invention were obtained through genome-wide association analysis (GWAS) of weight gain rate during the acclimatization process of mandarin fish. Using this set of SNP molecular markers, early selection of easily acclimatized mandarin fish can be achieved, accurately screening for individuals that are easily acclimatized and have a fast growth rate after acclimatization. This method effectively avoids the drawbacks of traditional phenotypic breeding, such as high subjectivity, long breeding cycles, and low efficiency. It significantly reduces the workload of breeding screening, shortens the breeding cycle, accelerates the selection of superior varieties, improves the efficiency of molecular-assisted breeding of mandarin fish, and reduces breeding costs. Simultaneously, the application of this molecular marker can effectively address the industry's shortcomings of mandarin fish's reliance on live bait and the difficulty of artificial feeding. It effectively improves the success rate of artificial feed domestication, the survival rate, and the overall growth performance of mandarin fish. This has significant guiding significance for reducing the cost of large-scale mandarin fish farming, breaking through the bottlenecks in the development of the artificial mandarin fish farming industry, and improving the comprehensive economic benefits of aquaculture. It is suitable for large-scale promotion and industrial application.

[0040] To enable those skilled in the art to better understand the technical solution of the present invention, the following embodiments are provided for illustration: Example 1: Screening of SNP molecular markers associated with the acclimatization trait of mandarin fish 1. Sample collection All samples in this experiment were obtained from a recirculating aquaculture system (RAS) workshop of a company in Fangshan District, Beijing. The mandarin fish used in the experiment were uniformly trained to eat artificial feed (manufacturer: Foshan Nanhai Jieda Feed Co., Ltd., model: Mandarin Fish No. 2) under standardized feeding conditions. After the feeding experiment, 710 healthy mandarin fish with no external injuries and good vitality were randomly selected from the group that had completed artificial feed training. The body weight of all experimental individuals before and after rearing was accurately measured and recorded. The feeding ability of the mandarin fish was quantified by calculating the individual weight gain rate (WGR), objectively reflecting the individual's acceptance of artificial feed and growth rate. Subsequently, caudal fin tissue was collected from each experimental individual, preserved at low temperature, and used for subsequent extraction and preparation of mandarin fish genomic DNA.

[0041] 2. Genomic DNA extraction Genomic DNA was extracted from all mandarin fish tail fin tissues using the classic phenol-chloroform method. The integrity of the extracted genomic DNA was assessed by 1.5% agarose gel electrophoresis, and the degree of DNA degradation and protein residue were observed using a UV gel imaging system. Simultaneously, the purity and concentration of the genomic DNA were precisely determined using a NanoDrop 2000 spectrophotometer. DNA samples with good integrity, no significant degradation, and meeting purity standards were selected. All samples were then uniformly diluted to 100 ng / μL according to the detection concentration to prepare standardized DNA working solutions for subsequent genome-wide association studies.

[0042] 3. Genotyping and Quality Control Whole-genome SNP genotyping was performed on all mandarin fish samples using whole-genome resequencing technology to obtain individual genotype data. To ensure the accuracy and reliability of the genotyping data, PLINK (V1.90) software was used to standardize the quality control of the original genotyping results, and unqualified SNP sites and samples were removed. The specific quality control standards are as follows: (1) the SNP site genotyping deletion rate is less than 0.05; (2) the minimum allele frequency of the SNP site is greater than 0.05; (3) the overall genotyping deletion rate of a single experimental sample is less than 0.05. After completing the quality control, high-quality and effective genotype data that can be used for subsequent association analysis were obtained.

[0043] 4. Genome-wide association analysis of the trait of weight gain rate after domestication Weight gain rate (WGR) during the artificial domestication of mandarin fish was used as the core indicator for quantitatively evaluating individual domestication ability. Genome-wide association analysis (GWAS) was conducted using a mixed linear model (MLM) with GEMMA software. During the analysis, population structure was treated as a fixed effect, and the individual kinship matrix as a random effect to eliminate confounding factors such as population differentiation and individual kinship, ensuring the accuracy and reliability of the results. The Bonferroni correction method was routinely used, with 0.05 / N (where N is the total number of SNPs in the GWAS analysis) as the significance threshold for the association analysis. P After value correction and screening, the results showed that there were no significant sites in the GWAS results of mandarin fish acclimatization weight gain rate that met this strict threshold. Therefore, this study will... P -value < 1e-5 is set as the screening criterion. If the SNP locus P If the value is below this threshold, it can be determined that the SNP locus is significantly associated with the weight gain rate trait of mandarin fish domestication. Finally, the Manhattan plot and QQ plot of the association analysis results were plotted using the CMplot package in R language, completing the visualization analysis of the associated loci of mandarin fish domestication trait, and accurately screening out the SNP molecular marker loci that are significantly associated with the mandarin fish domestication trait.

[0044] 5. Results Analysis After data quality control and cleaning using PLINK software, a total of 1,163,958 high-quality SNP loci were obtained from 710 mandarin fish individuals, which can be used for subsequent genome-wide association analysis (GWAS) of mandarin fish domestication traits. The GWAS analysis results for the mandarin fish domestication weight gain rate trait are as follows: Figure 1 As shown, five SNP loci on chromosomes 13, 17, and 19 were identified as significantly associated at the genomic level with the trait of weight gain rate during domestication in mandarin fish. Among them, three SNP loci on chromosome 13 showed the strongest association with this trait: SNP chr13_2854374 G>A (…). P = 1.46E-06), SNP chr13_2849943 G>A ( P = 3.11E-06) and SNP chr13_2803913 C>G ( P = 5.32E-06).

[0045] Association validation was conducted on genotype and domestication weight gain rate for the three core SNP loci mentioned above. The results are as follows: Domestication weight gain rate of individuals with different genotypes at the SNP chr13_2854374 G>A locus is shown in the figure below. Figure 2 As shown in Figure A, there were significant differences in the weight gain rate after acclimatization among individuals with different genotypes at this locus. The average weight gain rate after acclimatization for individuals carrying the GG genotype was 11.41 ± 5.32%, significantly higher than the 9.49 ± 6.17% for individuals with the AA genotype.P <0.05). The domestication weight gain rate of individuals with different genotypes at the SNP chr13_2849943 G>A locus is as follows: Figure 3 As shown in Figure A, there were significant differences in the weight gain rate after acclimatization among individuals with different genotypes at this locus. The average weight gain rate after acclimatization for individuals carrying the GG genotype was 12.12 ± 5.23%, significantly higher than that for individuals with the AA genotype (10.06 ± 5.46%). P <0.05). The domestication weight gain rate of individuals with different genotypes at the SNP chr13_2803913 C>G locus is as follows: Figure 4 As shown in Figure A, there were significant differences in the weight gain rate after acclimatization among individuals with different genotypes at this locus. The average weight gain rate after acclimatization for individuals carrying the GG genotype was 11.42 ± 5.11%, significantly higher than the 9.82 ± 5.51% for individuals with the CC genotype. P <0.05).

[0046] In summary, the genotypes of the three SNP loci mentioned above are highly correlated with the weight gain rate of mandarin fish after acclimatization, and can effectively distinguish the artificial feed acclimatization ability and growth performance of individual mandarin fish, thus serving as specific molecular markers for identifying mandarin fish acclimatization traits.

[0047] Example 2: Validation of SNP molecular markers related to the acclimatization trait of mandarin fish To verify the universality and accuracy of the SNP molecular markers obtained by the present invention in determining the feeding traits of mandarin fish, a repeatability verification experiment was conducted using an independent mandarin fish farming population. Seventy-two healthy, undamaged mandarin fish with good vitality were randomly selected from another farming tank and subjected to standardized artificial feed training. The feeding weight gain rate of all experimental individuals was measured and statistically analyzed, and the data related to feeding performance of each individual were quantitatively recorded. Caudal fin tissue was simultaneously collected from each mandarin fish and preserved at low temperature for subsequent genomic DNA extraction. The DNA extraction method, detection, and standardized processing procedures were consistent with those in Example 1.

[0048] Using the prepared mandarin fish genomic DNA as a template, PCR-specific amplification was performed using primer pairs SEQ ID NO:1 and SEQ ID NO:2 to obtain a gene fragment containing the SNP chr13_2854374 G>A mutation site. The amplified gene sequence is shown in SEQ ID NO:7. This mutation site is located at position 201 of the gene fragment, and the base mutation type is G / A.

[0049] The sequences of the upstream and downstream primer pairs for SNP chr13_2854374 are as follows: SNP chr13_2854374-F:5'-ATTGTTCTGGGCTGTTTTG-3' (SEQ ID NO:1); SNP chr13_2854374-R:5'-AAGCTACTGAAGGGGATA-3' (SEQ ID NO:2).

[0050] The total PCR amplification volume was 25 μL, and the specific reaction system is shown in Table 1.

[0051] Table 1 PCR reaction procedure The specific amplification procedure is shown in Table 2: Table 2 PCR amplification reaction procedure The molecular marker sequence is shown in SEQ ID NO:7. SNP chr13_2854374 is located at position 201 of gene fragment SEQ ID NO:7, and the mutation type is G / A.

[0052] SEQ ID NO:7 (where bold underline indicates mutation site, and underline indicates the corresponding position of upstream and downstream primers): CTAAACAGGAGCTTTCCTGGCTCCTGGATGTCGTGTATGTGAACAGCTGTTGGTCACGCTGCTGATTGTACTGAACTGCTTATTGTTTTGTGTCTCTGCAGGTTTTTA ATTGTTCTGGGCTGTTTG ATTCTGGCCATACTGACAACATTCAGGGAACACGAGAAGGTGTCTGCACACTGGCTGGTTATACTGGTAAGATA G CTGGGATTTCTTTCGTTTCGTGTTTTGTTTTTTGTTGCCTCGTACAGTACTACTGCTACAGTAAAACATCCAGTTTTCCCCTTTA TATCCCCTTCAGTA GCTT TAGGTTTGTAAAAATCATGCTATTCCACACTGTCAGACAATATCATCTTGTGTATCATTTTGTTCCAGATTATAGATAAATGATGTTTACACTTAATA Two μL of PCR amplification product was taken and the amplification effect was detected by 1% agarose gel electrophoresis. Samples with clear bands, no impurities and qualified amplification effect were selected for first-generation Sanger sequencing to determine the genotype of each sample at the SNPchr13_2854374 site.

[0053] Genotyping of all validation individuals was completed using Sanger sequencing, and the differences in acclimatization weight gain rates among different genotypes of mandarin fish were statistically analyzed. The corresponding population validation results are as follows: Figure 2 As shown in Figure B, the experimental results indicate that there are significant differences in the weight gain rate of different genotypes of mandarin fish at the SNP chr13_2854374 locus. Among them, the weight gain rate of mandarin fish carrying the GG and GA genotypes is significantly higher than that of individuals with the AA genotype. This further confirms that this SNP locus can be stably used to identify the quality of mandarin fish's acclimatization performance and can serve as a reliable molecular marker for screening mandarin fish for acclimatization traits.

[0054] The verification method for SNP chr13_2849943 G>A is the same as above, using the following upstream and downstream primers: SNP chr13_2849943-F:5'-CGAGGTTCAGAGGAAAGA-3' (SEQ ID NO: 3); SNP chr13_2849943-R:5'-TGGAGCGAGTAGAGGAGA-3' (SEQ ID NO: 4).

[0055] The gene fragment containing SNP chr13_2849943 was obtained as shown in SEQ ID NO: 8. The mutation site is located at position 201, and its mutation type is G / A.

[0056] SEQ ID NO:8 (where bold underline indicates mutation site, and underline indicates the corresponding position of upstream and downstream primers): TTTCATGGAAAAATGATGAATATGTTGACCGGACTGGCTCTGGTTTTTGTCGCACTAGATTTGTATTGATTTATACATTTATATCTGTTTATAGGAATGTAGGAACCC CGAGGTTCAGAGGAAAGA TTTTGGATCCAAGCTGTGTGGATGCCACTCGTACTCATTGATGAGTCTCATGTTTTATCAGTTTTTCACTGAT G CTGTTCCACCCTTTGATTTTCAGCCCGGTCCTCTTGATGTGTCCGGTCTAATGGGCATCGACATCGCTCTGTGTGCCTTATTGAACAAACTATCTGACTGTGAGGCAGATCAGTATCTGTTGAATCATATCGAGTTAACATCGA TCTCCTCTACTCGCTCCA GGATTATCTTCTGTCCTCTGGATAACTTTGAGGGAAAT Figure 3Section B presents the experimental verification results for SNP chr13_2849943. (By...) Figure 3 According to B, there are significant differences in the weight gain rate of domestication among individuals with different genotypes of mandarin fish SNPchr13_2849943; among them, the weight gain rate of domestication of individuals carrying the GG and GA genotypes is significantly higher than that of individuals carrying the AA genotype.

[0057] The verification method for SNP chr13_2803913 C / G is the same as above, using the following upstream and downstream primers: SNP chr13_2803913-F:5'-CTGAAGCCAGAGGAAACT-3' (SEQ ID NO: 5); SNP chr13_2803913-R:5'-CATCCCAACTGCCTAATC-3' (SEQ ID NO: 6).

[0058] The gene fragment containing SNP chr13_2803913 was obtained as shown in SEQ ID NO: 9. The mutation site is located at position 201, and its mutation type is C / G.

[0059] SEQ ID NO:9 (where bold underline indicates mutation site, and underline indicates upstream and downstream primer counterparts): ACAATAACCACATACAGCTAAGCTTAAGACTGTGAGTGAGGAGAAATGAGTCATTTTTTCCAGCCACCCAGGTCTTCTGACGGTGGCAGAAACTGTAGCTGATCGCTACAGGACGGGATTCGATGTGTTGATGTATTCTGCTGTGACTTTGT CTGAAGCCAGAGGAAACT CCGGGACATATGAAGCTGTTTGTCTCTGTA C TGCTGCTTTATACACTGGAGGTTACGCAGTTTGTGTGTTGATGCTGTTGTTTTGTGTAAAAATGACCGTCCTTATGAAGGAAAGTGTGATTATTT GATT AGGCAGTTGGGATG ATTTTTGTCATTTTCTGGTTCCTGATTCTCCGATGTAAGGATTTGCTGTTTTCTCTGTTTTATTTCACTGTAAACTGAATATCTTTGG Figure 4 Section B presents the experimental verification results for SNP chr13_2803913. (By...) Figure 4According to data from B, there are significant differences in the weight gain rate of domestication among individuals with different genotypes of mandarin fish SNPchr13_2803913; among them, the weight gain rate of domestication of individuals carrying the GG genotype is significantly higher than that of individuals carrying the CC genotype.

[0060] In summary, this embodiment identified three SNP markers (SNP chr13_2854374, SNP chr13_2849943, and SNP chr13_2803913) that are significantly associated with the domestication trait of mandarin fish. Their genotypes can be determined using a single primer pair, a simple and reliable operation. These three SNP loci show promise for application in molecular marker-assisted breeding and genome selection breeding of mandarin fish.

[0061] This invention discloses SNP molecular markers related to the domestication trait of mandarin fish, which is the weight gain rate during the domestication process of mandarin fish, including one or more of SNP chr13_2854374, SNP chr13_2849943 and SNP chr13_2803913. Among them, SNP chr13_2854374 is located at position 2854374 of chromosome 13 in the GCA_020085105.1 version of the mandarin fish genome, with a mutation type of G / A. The GG genotype is the preferred genotype, and individuals with this genotype have a high acceptance rate to artificial feed and a fast growth rate; SNP chr13_2849943 is located at position 2849943 of chromosome 13 in the GCA_020085105.1 version of the mandarin fish genome, with a mutation type of G / A. The GG genotype is the preferred genotype, and individuals with this genotype have a high acceptance rate to artificial feed and a fast growth rate; SNP The mutation chr13_2803913 is located at position 2803913 on chromosome 13 of the mandarin fish genome, version GCA_020085105.1. The mutation type is C / G, with the GG genotype being the preferred genotype. Individuals with this genotype exhibit high acceptance of formulated feed and rapid growth. This invention also discloses primers and kits for amplifying or detecting the aforementioned SNP molecular marker; and the application of the above-mentioned SNP molecular marker, primers, and kits in breeding mandarin fish with high acceptance of formulated feed and rapid growth. The SNP molecular markers provided by this invention can be used to detect the acclimatization traits of mandarin fish and to select mandarin fish populations with rapid growth during the acclimatization process, showing promising application prospects in marker-assisted breeding of mandarin fish. SNP molecular markers are not affected by individual age, sex, or other factors, and can be used for early screening of acclimatization traits in mandarin fish, significantly shortening the breeding time. SNP markers can be determined using one or more pairs of primers, making the operation simple, quick, accurate, reliable, and inexpensive, suitable for widespread application.

[0062] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.

Claims

1. A method for using SNP molecular markers to distinguish whether individual mandarin fish readily accept formulated feed and have a fast growth rate, characterized in that, include: The genotype of the mandarin fish at position 201 of the SNP molecular marker was detected. The SNP molecular marker is shown in SEQ ID NO:

7. When the genotype is GG, it is determined that the mandarin fish individual is more likely to accept artificial compound feed and has a fast growth rate. The artificial compound feed is Mandarin Fish No. 2 from Foshan Nanhai Jieda Feed Co., Ltd.

2. A method for using SNP molecular markers to screen mandarin fish that readily accept formulated feed and have a fast growth rate, characterized in that, include: Step 1: Extract genomic DNA from the individual mandarin fish to be tested; Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using a primer pair as shown in SEQ ID NO:1 and SEQ ID NO:2; Step 3: Sequencing analysis is performed on the amplification products obtained in Step 2 to determine the genotype of the SNP molecular marker of the mandarin fish individual to be tested. Genotype analysis is used to determine whether the mandarin fish to be tested is easily accepted by artificial compound feed and has a fast growth rate. The artificial compound feed is Mandarin Fish No. 2 from Foshan Nanhai Jieda Feed Co., Ltd. The SNP molecular marker is shown in SEQ ID NO:

7. When the genotype is GG, it is determined that the mandarin fish individual is more likely to accept artificial compound feed and has a faster growth rate.

3. The method for screening mandarin fish that readily accepts formulated feed and has a fast growth rate, as described in claim 2, is characterized in that... In step three, the genomic DNA of the mandarin fish to be tested was extracted from the fin tissue.

4. The application of primers for amplifying SNP molecular markers related to the feeding habits of mandarin fish in the breeding of superior mandarin fish breeds with high acceptance of artificial formulated feed and fast growth rate, characterized in that... The amplification primers are a pair of primers as shown in SEQ ID NO:1 and SEQ ID NO:2; The SNP molecular marker is shown in SEQ ID NO:

7. When the genotype is GG, it is determined that the mandarin fish individual is more likely to accept artificial compound feed and has a fast growth rate. The artificial compound feed is Mandarin Fish No. 2 from Foshan Nanhai Jieda Feed Co., Ltd.

Images