Molecular marker, primer, kit for predicting beef intramuscular fat traits and application thereof

Abstract

The application provides a molecular marker for predicting beef intramuscular fat traits, a primer, a kit and application thereof, and belongs to the technical field of molecular biology. The application finds a molecular marker for predicting beef intramuscular fat traits through beef GLTP gene polymorphism analysis. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 3, the base at the 266th position in the sequence is A or G, resulting in polymorphism of intramuscular fat content; the site of the molecular marker is located on the GLTP gene of the 17th chromosome of the cattle, at the 2nd intron chr.17:63392907 site, and is an A>G mutation. The molecular marker can be used as a SNP molecular marker related to beef quality traits, for predicting intramuscular fat in beef quality traits, screening beef individuals with high intramuscular fat traits, eliminating individuals with poor intramuscular fat, and for improving and / or breeding beef cattle with high or appropriate intramuscular fat.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker, primer, reagent kit, and their applications for predicting intramuscular fat characteristics in beef. Background Technology

[0002] The content and distribution of intramuscular fat in beef cattle are key indicators determining the marbling, tenderness, juiciness, and flavor of beef, directly impacting its grade and commercial value. The core indicator for beef grading both domestically and internationally (Chinese national standards, Wagyu, Angus grading) is the marbling of intramuscular fat. Higher intramuscular fat content indicates a higher grade, doubling the purchase and retail price and resulting in higher farming profits. Traditional beef cattle quality selection primarily relies on phenotypic testing, which suffers from long testing cycles, susceptibility to environmental and feeding conditions, and the inability to accurately assess individual cattle early on, making it difficult to achieve efficient and targeted improvement of intramuscular fat traits.

[0003] Molecular marker-assisted breeding and genomic selection technologies can overcome the limitations of traditional breeding, enabling early selection through genetic markers closely associated with target traits, significantly improving breeding efficiency and accuracy. Currently, key genes and functional molecular markers targeting intramuscular fat deposition in beef cattle are still relatively lacking, making it difficult to meet the actual needs of precision breeding for high-quality beef cattle.

[0004] Therefore, in-depth exploration of key genes regulating intramuscular fat deposition in beef cattle, development of stable, efficient, and scalable molecular markers, and establishment of reliable molecular detection methods are of significant technical and industrial value for accelerating the breeding of high-quality beef cattle breeds and improving the quality and core competitiveness of domestic beef. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker, primer, kit, and application for predicting intramuscular fat traits in beef. This molecular marker can be used as a SNP molecular marker related to beef quality traits to predict intramuscular fat in beef, screen beef cattle individuals with high intramuscular fat traits, and eliminate individuals with poor intramuscular fat traits.

[0006] To achieve the above objectives, the present invention provides a molecular marker for predicting intramuscular fat characteristics in beef. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 3, wherein the base at position 266 is A or G, resulting in polymorphism in intramuscular fat content. The molecular marker is located at the chr.17:63392907 site of the second intron of the GLTP gene on bovine chromosome 17, and is an A>G mutation.

[0007] The present invention also provides a primer pair for amplifying the molecular marker, comprising a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO. 1, and the sequence of the reverse primer is shown in SEQ ID NO. 2.

[0008] The present invention also provides a kit for amplifying the molecular marker, the kit comprising the primer pair described above.

[0009] The present invention also provides the use of the molecular marker, the primer pair, or the kit in at least one of the following: S1. Predicting intramuscular fat content in beef muscle; S2. Predict the initial moisture content of beef; S3. Improve beef cattle germplasm resources and / or breed beef cattle with high or suitable intramuscular fat.

[0010] Preferably, the cattle are Yanhuang cattle.

[0011] This invention also provides a method for screening beef cattle with high intramuscular fat content, comprising the following steps: Genotyping was performed on the mutation A>G at the second intron chr.17:63392907 of the GLTP gene on chromosome 17 of individual beef cattle to be identified; the GLTP gene was ARS-UCD2.0:ENSBTAG00000002591 published in the Ensembl database; the intramuscular fat content of the GG genotype was higher than that of the AA and AG genotypes.

[0012] Preferably, the genotyping detection is performed using the primer pair or the kit.

[0013] The present invention also provides a method for predicting intramuscular fat characteristics in beef, comprising the following steps: Using the genomic DNA of the individual beef cattle to be identified as a template, the template is amplified by PCR using the primer pair or the kit to obtain the amplification product; the amplification product is sequenced, and the intramuscular fat content of the beef cattle is judged based on the sequencing results: the intramuscular fat content of beef cattle individuals with GG at the 266th base of the amplification product is higher than that of beef cattle individuals with AG and AA at the 266th base of the amplification product.

[0014] Preferably, the beef cattle are Yanhuang cattle.

[0015] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 40 s, 64℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 34 cycles starting from the second step; 72℃ extension for 5 min.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a molecular marker for predicting intramuscular fat traits in beef. This molecular marker can be used as a SNP molecular marker related to beef quality traits to predict intramuscular fat and / or initial moisture content in beef, screen beef cattle individuals with high intramuscular fat traits, and eliminate individuals with poor intramuscular fat traits.

[0017] This invention provides primers and a kit for amplifying molecular markers predicting intramuscular fat traits in beef. These markers can specifically amplify molecular markers predicting intramuscular fat traits in beef, and can be used to predict intramuscular fat content and / or initial moisture content in beef, screen cattle individuals with high meat quality traits, cull individuals with poor intramuscular fat, and improve beef cattle germplasm resources and / or breed cattle with high or suitable intramuscular fat. This invention provides a method for breeding beef cattle with high meat quality traits, increases the speed of beef cattle breeding, and has significant technical and industrial value for accelerating the breeding of high-quality beef cattle new breeds and improving the quality and core competitiveness of domestic beef. Attached Figure Description

[0018] Figure 1 The image shows the electrophoresis diagram of the PCR amplification product of the GLTP gene chr.17:63392907 site in beef cattle in Example 1. In the image, 1 to 6 are all PCR amplification products, and the marker is a 5000bp DNA marker.

[0019] Figure 2 This is a graph showing the genotyping results of the GLTP gene polymorphism analysis at locus chr.17:63392907 in beef cattle in Example 1. Detailed Implementation

[0020] This invention provides a molecular marker for predicting intramuscular fat traits in beef. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 3, where the base at position 266 is either A or G, resulting in polymorphism in intramuscular fat content. The molecular marker is located at position chr.17:63392907 of the GLTP gene on bovine chromosome 17, and is an A>G mutation.

[0021] In this invention, the GLTP gene DNA sequence is the sequence information of the beef bovine GLTP gene published in Ensembl: ARS-UCD2.0:ENSBTAG00000002591. The nucleotide sequence of the GLTP gene shown in SEQ ID NO. 3 is: GAACGTGGACTCTGGGATCTGGTCAGGGCTGGACCCCGTTCCCACCTGCACCAGCTGTGTGACCCTAAGCACATCACTTCGCCTCTCTGAGCCTGCTTCCTCATCTGTAATTGGCACGACGGCAGGCACGTCAGGGTTGCTGTGGGGTTAGAGAAGGCTGTGGCTGTGAAGCGCCGCGTACATCCAGTGAATGCGGATGGCCTGGGGTTACTACTGTCGTGACCAGCCCCCACGCCGGTCCTGGCAGGACAGCGAGGCTCTGCT R GGGTGGCAGCTATGGAGGCAGCCTTCCCCAGGGGGAAACCCTGTGTGCTCTGTTCCAGAAAATCAAAGCTGTCTATGACACCAACCCGACCAAGTTCCGGACCCTGCAGAACATCCTGGAGGTGGAGAAGGAGATGTACGGGGCCGAGTGGCCCAAAGTGGGGGCCACG CTGGCACTGATGTGGCTGAAGAGGTGATGGGCTTGGGTGGCGGGGTGTTTGTGTGACCGGGGGGCTGGGGGCCTGCCCTGCAGAGGACGGACAGCCAACCCTGCCACTGCCCCAGGGCGTCTGCTCTGACGGGGCGGACGGGCACGTCCATCTTCCATAGGCG (SEQ ID NO.3). Among them, R represents G or A. Comparative analysis using DNASTAR 7.1 software with the DNA sequence of the GLTP gene (ENSBTAG00000002591) revealed a polymorphic site A>G at the second intron of the GLTP gene, specifically at chr.17:63392907. In the beef cattle population, the genotypes at the chr.17:63392907 site of the second intron of the GLTP gene (i.e., 266 bp of the sequence shown in SEQ ID NO. 3) were AA, GA, and GG, respectively; the alleles were A and G, respectively.

[0022] Further analysis of the association between genetic variation of the GLTP gene and meat quality traits in beef cattle revealed that the GLTP gene SNP site is associated with intramuscular fat and initial moisture content in beef. Individuals with the GG genotype had significantly higher intramuscular fat content than those with the AA and GA genotypes. This study can be used to predict intramuscular fat content and / or initial moisture content in beef, screen for individuals with high meat quality traits, cull individuals with poor intramuscular fat content, and improve beef cattle germplasm resources and / or breed beef cattle with high or suitable intramuscular fat content. This will lead to the development of beef cattle breeding methods with high meat quality traits, accelerate beef cattle breeding, and has significant technical and industrial value for accelerating the development of high-quality beef cattle breeds and improving the quality and core competitiveness of domestic beef.

[0023] The present invention also provides a primer pair for amplifying the molecular marker, comprising a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO. 1, and the sequence of the reverse primer is shown in SEQ ID NO. 2.

[0024] The present invention also provides a kit for amplifying the molecular marker, the kit comprising the primer pair described above.

[0025] This invention also provides the application of the molecular marker, the primer pair, or the kit in at least one of the following: S1, predicting intramuscular fat content in beef; S2, predicting initial moisture content in beef; S3, in the improvement of beef cattle germplasm resources and / or the breeding of beef cattle with high or suitable intramuscular fat. The preferred cattle are Yanhuang cattle.

[0026] This invention also provides a method for screening beef cattle with high intramuscular fat content, comprising the following steps: Genotyping was performed on the mutation A>G at the second intron chr.17:63392907 of the GLTP gene on chromosome 17 of individual beef cattle. The GLTP gene is identified as ARS-UCD2.0:ENSBTAG00000002591 published in the Ensembl database. The GG genotype has a higher intramuscular fat content than the AA and AG genotypes. The genotyping was preferably performed using the primer pair or the kit described above. The primer pair preferably includes a forward primer and a reverse primer; the forward primer sequence is shown in SEQ ID NO. 1, and the reverse primer sequence is shown in SEQ ID NO. 2.

[0027] This invention also provides a method for predicting intramuscular fat traits in beef, comprising the following steps: using the genomic DNA of the individual beef cattle to be identified as a template, performing PCR amplification on the template using the primer pair or the kit to obtain amplification products; sequencing the amplification products, and judging the intramuscular fat content of the beef cattle based on the sequencing results: beef cattle individuals with GG at the 266th base of the amplification product have higher intramuscular fat content than beef cattle individuals with AG and AA at the 266th base of the amplification product. The primer pair preferably includes a forward primer and a reverse primer; the forward primer sequence is shown in SEQ ID NO. 1, and the reverse primer is shown in SEQ ID NO. 2. The beef cattle are preferably Yanhuang cattle. As an optional implementation method: the preferred PCR amplification program is: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 40 s, 64℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 34 cycles starting from the second step; 72℃ extension for 5 min.

[0028] This invention provides primers and a kit for amplifying molecular markers predicting intramuscular fat traits in beef. These markers can specifically amplify molecular markers predicting intramuscular fat traits in beef, and can be used to predict intramuscular fat content and / or initial moisture content in beef, screen cattle individuals with high meat quality traits, cull individuals with poor intramuscular fat, and improve beef cattle germplasm resources and / or breed cattle with high or suitable intramuscular fat. This invention provides a method for breeding beef cattle with high meat quality traits, increases the speed of beef cattle breeding, and has significant technical and industrial value for accelerating the breeding of high-quality beef cattle new breeds and improving the quality and core competitiveness of domestic beef.

[0029] In the following embodiments of the present invention, the experimental material, Yanhuang cattle, came from the ranch of Yanbian Livestock Development Group Co., Ltd. in Longjing City, Jilin Province.

[0030] Unless otherwise specified, the test methods used in the following examples are conventional test methods; the materials and reagents used are commercially available unless otherwise specified.

[0031] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0032] Example 1 1. Sample Collection The experimental group in this embodiment consisted of 82 Yanhuang cattle raised under the same conditions. Blood was collected from the jugular vein and placed in anticoagulant tubes, which were then stored at 4°C.

[0033] 2. Genomic DNA extraction Genomic DNA was extracted from the collected Yanhuang cattle using a rapid blood genomic DNA extraction kit (Axygen, AP-MN-BL-GDNA-50), and its concentration and purity were determined using an ultra-micro spectrophotometer. The qualified DNA samples were aliquoted and stored at -20℃.

[0034] 3. Primer design Primers were designed using Primer Premier 5.0 software based on the sequence information of the GLTP gene in beef cattle published in Ensembl (ARS-UCD2.0:ENSBTAG00000002591). The target fragment of the GLTP gene was 600 bp in length. The primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0035] The upstream primer sequences for the GLTP gene are as follows: 5'-GAACGTGGACTCTGGGATC-3' (SEQ ID NO.1); The downstream primer sequences for the GLTP gene are as follows: 5'-CGCCTATGTGGAAGATGGA-3' (SEQ ID NO. 2).

[0036] 4. PCR amplification The target fragment was amplified by PCR using the primers designed above.

[0037] The PCR reaction system (20 μL) is as follows: 10 μL of 2×ES Taq Master Mix, 0.5 μL each of upstream primer (SEQ ID NO. 1) and downstream primer (SEQ ID NO. 2), 1 μL of DNA (genomic DNA of Yanhuang cattle), and 8 μL of ddH2O.

[0038] The PCR amplification procedure is as follows: Pre-denaturation at 95℃ for 4 min, denaturation at 95℃ for 40 s, annealing at 64℃ for 30 s, extension at 72℃ for 1 min, for a total of 34 cycles starting from the second step; extension at 72℃ for 5 min; store at 4℃.

[0039] The amplified PCR products were detected by 1.5% agarose gel electrophoresis. The electrophoresis image of the PCR amplification of the GLTP gene at the chr.17:63392907 site is shown below. Figure 1 As shown. The fragment length is approximately 600 bp, consistent with the expected size. The bright-banded PCR product was sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing.

[0040] The specific sequence of the target gene obtained from sequencing is as follows: GAACGTGGACTCTGGGATCTGGTCAGGGCTGGACCCCGTTCCCACCTGCACCAGCTGTGTGACCCTAAGCACATCACTTCGCCTCTCTGAGCCTGCTTCCTCATCTGTAATTGGCACGACGGCAGGCACGTC AGGGTTGCTGTGGGGTTAGAGAAGGCTGTGGCTGTGAAGCGCCGCGTACATCCAGTGAATGCGGATGGCCTGGGGGTTACTACTGTCGTGACCAGCCCCCACGCCGGTCCTGGCAGGACAGCGAGGCCTCTGCT R GGGTGGCAGCTATGGAGGCAGCCTTCCCCAGGGGGAAACCCTGTGTGCTCTGTTCCAGAAAATCAAAGCTGTCTATGACACCAACCCGACCAAGTTCCGGACCCTGCAGAACATCCTGGAGGTGGAGAAGGAGATGTACGGGGCCGAGTGGCCCAAAGTGGGGGCCACG CTGGCACTGATGTGGCTGAAGAGGTGATGGGCTTGGGTGGCGGGGTGTTTGTGTGACCGGGGGGCTGGGGGCCTGCCCTGCAGAGGACGGACAGCCAACCCTGCCACTGCCCCAGGGCGTCTGCTCTGACGGGGCGGACGGGCACGTCCATCTTCCATAGGCG (SEQ ID NO.3). Among them, the bold and underlined R represents G or A.

[0041] 5. Sequencing and sequence analysis The PCR amplification product of the target fragment (600 bp) shown in SEQ ID NO. 3 was recovered from the gel and subjected to Sanger sequencing. Comparison analysis using DNASTAR 7.1 software with the DNA sequence of the GLTP gene (ENSBTAG00000002591) revealed a polymorphic site A>G at the second intron of the GLTP gene (specifically chr.17:63392907).

[0042] 6. Polymorphism analysis of GLTP gene in beef cattle From Table 1 and Figure 2It can be seen that the genotypes of the second intron chr.17:63392907 of the GLTP gene in the beef cattle population (i.e., at 266 bp of the sequence shown in SEQ ID NO. 3) are AA, GA, and GG, respectively; and the alleles are A and G, respectively.

[0043] Table 1. GLTP gene polymorphism analysis and genetic indicators

[0044] 7. Association analysis of genetic variation of GLTP gene in beef cattle with meat quality traits The cooked meat yield, intramuscular fat, initial moisture content, drip loss rate (24h, 48h, 72h), pressing moisture, tenderness, and pH value of 82 Yanhuang cattle were tested. The testing methods followed the "GB / T43838-2024 Technical Specifications for Beef Cattle Production Performance". The tested part was the longissimus dorsi muscle of Yanhuang cattle.

[0045] The association between three genotypes and meat quality traits in the Yanhuang cattle population was analyzed using software. The results in Table 2 show that the GLTP gene SNP site was not significantly associated with intramuscular fat and initial moisture content in beef, but with other detected meat quality traits.

[0046] Table 2. Results of meat quality trait analysis for each genotype of the GLTP gene in beef cattle.

[0047] Note: Different lowercase letters indicate significant differences between groups. P <0.05, the same lowercase letter indicates that the difference between groups is not significant ( P >0.05).

[0048] As shown in Table 2, the intramuscular fat content of individuals with the GG genotype in this population was significantly higher than that of individuals with the AA and GA genotypes. This indicates that the intramuscular fat content of beef from individuals with the GG allele was significantly higher than that of homozygous wild-type (AA) individuals, and that beef from individuals with the GG allele was more in line with market demand than beef from homozygous wild-type (AA) individuals.

[0049] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A molecular marker for predicting intramuscular fat characteristics in beef, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3, with base A or G at position 266, resulting in polymorphism in intramuscular fat content; the molecular marker is located at position chr.17:63392907 of the GLTP gene on bovine chromosome 17, and is an A>G mutation; the GLTP gene is ARS-UCD2.0:ENSBTAG00000002591 published in the Ensembl database; The cattle in question are Yanhuang cattle.

2. The application of the molecular marker according to claim 1 in at least one of the following: S1. Predicting intramuscular fat content in beef muscle; S2. Predict the initial moisture content of beef; S3. Improve beef cattle germplasm resources and / or breed beef cattle with high or suitable intramuscular fat; The beef cattle in question are Yanhuang cattle.

3. The use of primer pairs for amplifying the molecular markers as described in claim 1 in at least one of the following: S1. Predicting intramuscular fat content in beef muscle; S2. Predict the initial moisture content of beef; S3. Improve beef cattle germplasm resources and / or breed beef cattle with high or suitable intramuscular fat; The beef cattle mentioned are Yanhuang cattle; The primer pair consists of a forward primer and a reverse primer; the forward primer sequence is shown in SEQ ID NO.1, and the reverse primer sequence is shown in SEQ ID NO.

2.

4. The use of the kit for amplifying the molecular marker as described in claim 1 in at least one of the following: S1. Predicting intramuscular fat content in beef muscle; S2. Predict the initial moisture content of beef; S3. Improve beef cattle germplasm resources and / or breed beef cattle with high or suitable intramuscular fat; The beef cattle mentioned are Yanhuang cattle; The kit includes primer pairs for amplifying the molecular marker as described in claim 1; The primer pair consists of a forward primer and a reverse primer; the forward primer sequence is shown in SEQ ID NO.1, and the reverse primer sequence is shown in SEQ ID NO.

2.

5. A method for screening beef cattle with high intramuscular fat content, characterized in that, The process includes the following steps: Genotyping is performed on the mutation A>G at the second intron chr.17:63392907 of the GLTP gene on chromosome 17 of the individual beef cattle to be identified; the GLTP gene is ARS-UCD2.0:ENSBTAG00000002591 published in the Ensembl database; the intramuscular fat content of the GG genotype is higher than that of the AA and AG genotypes; The beef cattle in question are Yanhuang cattle.

6. The method according to claim 5, characterized in that, The genotyping detection is performed using the primer pair described in claim 3 or the kit described in claim 4.

7. A method for predicting intramuscular fat characteristics in beef, characterized in that, Includes the following steps: Using the genomic DNA of the individual beef cattle to be identified as a template, the template is amplified by PCR using the primer pair described in claim 3 or the kit described in claim 4 to obtain the amplification product; the amplification product is sequenced, and the intramuscular fat content of the beef cattle is judged based on the sequencing results: the intramuscular fat content of beef cattle individuals with GG at the 266th base of the amplification product is higher than that of beef cattle individuals with AG and AA at the 266th base of the amplification product; The beef cattle in question are Yanhuang cattle.

8. The method according to claim 7, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 40 s, 64℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 34 cycles starting from the second step; 72℃ extension for 5 min.

Images