A pleurotus citrinopileatus strain L6926 and a cultivation method thereof

Abstract

The present application relates to a kind of pholiota adiposa L6926 and its cultivation method, belong to the field of biotechnology.The pholiota adiposa L6926 has been preserved in Guangdong Microbial Culture Collection Center on May 27, 2025, and the preservation number is GDMCC No:66424.The present application pholiota adiposa L6926 is cultivated by optimizing the medium of third-level seed culture.After cultivation, the number of fruit bodies is in group, the cap is fan-shaped or nearly circular, the edge is corrugated, the middle is concave, the expansion period is golden yellow, the mature period is deep yellow, the color is bright, and the commodity character of fresh and dry products is relatively excellent.The average biological conversion rate of pholiota adiposa L6926 is 114.80%, and the yield is relatively high.The content of crude polysaccharide and calcium is relatively high, and the quality is excellent, suitable for greenhouse stacking planting, covering soil planting and factory planting.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a strain of *Pleurotus ostreatus* L6926 and its cultivation method. Background Technology

[0002] The elm yellow mushroom (Pleurotus citrinipileatus Singer), also known as the golden-topped mushroom, jade emperor mushroom, and yellow mushroom, is one of the important newly emerging edible fungi in my country. It is not only delicious and highly nutritious but also possesses significant biological activity, making it a "top-grade mushroom." Cultivation of the elm yellow mushroom started relatively late, with artificial cultivation beginning in 1976. Reports of its cultivation and promotion began gradually afterward. Few varieties have been developed and approved, with the "Qijin" series bred in Jilin Province being particularly well-known. Currently, the elm yellow mushroom is cultivated in large quantities in Guizhou, Jilin, Sichuan, and Yunnan provinces. The main cultivation methods are stacked bag cultivation and soil-covered bag cultivation. Cultivation techniques are becoming increasingly mature, and yields are increasing year by year, achieving good economic and social benefits.

[0003] The cultivation history of *Pleurotus ostreatus* is relatively short, and basic research is not systematic enough. The selection of superior strains and the supporting technologies for high-quality and efficient cultivation are insufficient, and the active functional components need further in-depth exploration. Product development and other aspects remain important issues restricting the development of the *Pleurotus ostreatus* industry. Currently, artificial cultivation techniques are still unable to meet the needs of large-scale commercial production and face problems such as unstable strain characteristics and fruiting body yield, and large differences in the content of effective substances. Therefore, establishing a scientific quality control standard system is an urgent problem to be solved to promote the healthy development of the *Pleurotus ostreatus* industry.

[0004] Furthermore, due to the high requirements for the preparation and cultivation of *Pleurotus ostreatus* spawn, in actual production, susceptibility to spawn contamination, inconsistent spawn quality, and unregulated workshop-style production frequently lead to problems such as failure to produce normal fruiting bodies, deformed fruiting bodies, and dead fruiting bodies, resulting in unstable fruiting body quality and yield. In addition, there is a lack of development of cultivation and production techniques tailored to different varieties, and key technical specifications such as cultivation season, cultivation environment parameters, and fruiting management requirements are lacking. Ultimately, this seriously affects the yield and bioconversion rate of *Pleurotus ostreatus*, hindering the large-scale promotion of the *Pleurotus ostreatus* cultivation industry.

[0005] Therefore, overcoming the shortcomings of existing technologies is a problem that urgently needs to be solved in the field of biotechnology. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a *Pleurotus ostreatus* strain L6926 and its cultivation method.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A strain of *Pleurotus ostreatus*, L6926, was deposited on May 27, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 66424.

[0008] This invention also provides a method for the artificial cultivation of the aforementioned *Pleurotus ostreatus* strain L6926, comprising the following steps: Step (1), strain preparation: Take the mother strain obtained from the tissue isolation of *Pleurotus ostreatus* L6926, rejuvenate it with mother strain culture medium, and then inoculate it into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, transfer the original strain to the cultivation container for culture. After the mycelium has filled the cultivation container, finally transfer the cultivation strain into the cultivation bag and culture until the mycelium has filled the bag. Step (2), cultivation management: Place the cultivation bags obtained in step (1) in the greenhouse for stacking cultivation or soil covering cultivation; Step (3), harvesting of fruiting bodies: harvest when the fruiting bodies are seven or eight parts mature, dark yellow in color, and before they release spores; The mother culture medium comprises the following components by weight: 198-202 parts potato, 18-20 parts sucrose, 2-3 parts tryptone, 0.39-0.41 parts calcium chloride, 16-17 parts agar, and 998-1002 parts water. The original culture medium in the original culture bottle includes the following components by weight: 59-61 parts buckwheat, 19-21 parts broadleaf tree sawdust, 16-18 parts wheat bran, 1-2 parts sugar, 1-2 parts gypsum, 1-2 parts lime, with a water content of 55-60%. The culture medium in the cultivar container comprises the following components by weight: 10-15 parts buckwheat, 38-42 parts broadleaf tree sawdust, 24-29 parts cottonseed hulls, 10-16 parts wheat bran, 1-2 parts sugar, 1-2 parts gypsum, and 1-2 parts lime, with a moisture content of 55-60%. The culture medium in the cultivation bag includes the following components by weight: 56-58 parts broadleaf tree sawdust, 18-22 parts cottonseed hulls, 19-21 parts wheat bran, 0.98-1.02 parts lime, and 0.98-1.02 parts gypsum.

[0009] Furthermore, when using the mother culture medium for rejuvenation, it is incubated in the dark at a temperature of 22-24℃; When culturing the original culture medium, it is in the dark at a temperature of 20-25℃; When culturing in containers, the seed culture is carried out in the dark at a temperature of 20-25℃; When culturing in cultivation bags, it is carried out in the dark at a temperature of 22-26℃.

[0010] Furthermore, in step (1), cultivation can begin when nodular mycelial protrusions appear inside the cultivation bag and are grayish-white.

[0011] Furthermore, in step (2), during stacking cultivation, the cotton-free cover of the mushroom log is replaced with an open wide-mouth ring as the mushroom outlet, or the cotton-free cover is removed directly and the bag is opened; buds will appear 2-3 days after opening. Do not spray water when the mushroom buds first appear. Spray humidification can be carried out when more than 70% of the mushroom buds turn golden yellow, and the relative humidity of the air should be maintained at 85%-90%. Furthermore, in step (2), when cultivating with soil, first spread quicklime on the surface of the greenhouse soil, 100-150 kg per mu, and till the soil 2-3 times. Then break up the surface soil until the soil particle diameter is less than 3 cm. Remove the mushroom bags from the mushroom sticks and place them horizontally on the ground, with a spacing of 29-31 cm between rows. Cover with 2-3 cm of soil and sprinkle 0.9-1.1 cm thick pine needles on the soil surface. After planting, water and keep the soil moisture at 20%-30%.

[0012] Furthermore, in step (2), after cultivation, during the growth period of the fruiting body, the temperature is controlled at 18-26℃; direct sunlight is avoided, and the light intensity is controlled at 1500-2500 lux, while the carbon dioxide concentration is controlled below 0.2%; and the relative humidity of the air is maintained at 85%-95%.

[0013] In this invention, the fruiting bodies are harvested when they are seven or eight parts mature, at which point the caps of the fruiting bodies are basically flat (3-4 cm in diameter), deep yellow in color, and before they release spores. *Pleurotus ostreatus* strain L6926 is a new variety of *Pleurotus ostreatus* isolated from wild species and cultivated through selective breeding. Its characteristics include a medium-sized fruiting body, a nearly round cap (sometimes nearly fan-shaped), often concave in the center, a smooth surface, and a deep yellow to dark yellow color with smooth or slightly wavy edges. The stipe is white, solid to soft inside. The gills are white, slightly dense, decurrent, unequal in length, forked with transverse veins, and have smooth edges. The spore print is white; the spores are colorless, smooth, nearly cylindrical, 7-9.5 μm × 3-4 μm. The basidia are nearly club-shaped, colorless, 21-22 μm × 5-6 μm. The L6926 elm yellow mushroom spawn exhibits strong mycelial growth, rapid germination, fast growth rate, and strong resistance to adverse conditions. The mycelium can grow normally between 10-30℃, with an optimal growth temperature of 26-28℃. Fruiting bodies can be produced within a temperature range of 18-28℃, with the optimal fruiting temperature being 24-26℃. The production cycle is short, with an average mycelial growth period of 23.83 days in cultivation bags and a fruiting cycle from late March to early October. The mushrooms show good uniformity, with a single bag yielding a fresh weight of 1722.07g and a biological conversion rate of 114.80%. Using SSR primers L6926 SSR-01, L6926 SSR-02, L6926 SSR-03, and L6926 SSR-04, the *Pleurotus ostreatus* strain L6926 was distinguished from the control strain 6925. The amplified specific fragment sizes of *Pleurotus ostreatus* strain L6926 were 120, 129, 106, and 119 bp, respectively, while the fragment sizes of the control strain 6925 were 116, 125, 100, and (125, 129) bp, respectively. This indicates that the two strains have genetic differences.

[0014] This invention relates to the *Pleurotus ostreatus* strain L6926, which has a sweet and delicious flavor and high nutritional value. Besides being consumed fresh and used in the preparation of various dried foods, it is rich in the functional component crude polysaccharide (29.8g / 100g), calcium (221mg / kg), and iron (145mg / kg). It can be used as a nutritional supplement and in the preparation of health-promoting immune enhancers. The polysaccharides possess a wide range of pharmacological activities, including lowering blood sugar and lipids, anti-thrombosis, anti-oxidation, scavenging free radicals, anti-aging, anti-radiation, anti-tumor, promoting blood circulation, regulating immunity, regulating nucleic acid and protein metabolism, promoting DNA synthesis, and promoting the proliferation of human umbilical cord blood LAK cells.

[0015] Using existing methods for detecting polysaccharide and triterpenoid content, the polysaccharide content of the *Pleurotus ostreatus* strain L6926 of this invention was found to be 1.68%, and the triterpenoid and sterol content was 2.84%. Polysaccharides possess a wide range of pharmacological activities, including lowering blood sugar and lipids, antithrombosis, antioxidation, free radical scavenging, anti-aging, anti-radiation, anti-tumor, promoting blood circulation, regulating immunity, regulating nucleic acid and protein metabolism, promoting DNA synthesis, and promoting the proliferation of human umbilical cord blood LAK cells. Triterpenoids have anti-inflammatory, analgesic, sedative, anti-aging, tumor cell cytotoxic, and anti-hypoxic effects. Therefore, the mycelium, fruiting body, or fermentation broth of the *Pleurotus ostreatus* strain L6926 of this invention can be used in the preparation of drugs to enhance human immunity.

[0016] This invention relates to the cultivation of *Pleurotus ostreatus* spawn L6926 through optimized three-stage spawn culture medium. The fruiting bodies grow in clusters of several, with fan-shaped or nearly circular caps, wavy edges, and a moderately concave center. They are golden yellow during the swelling stage and deep yellow when mature, exhibiting a vibrant color. Both fresh and dried products demonstrate excellent commercial qualities. Spawn 6926 has an average biological conversion rate of 114.80% and high yield. Furthermore, it has high levels of crude polysaccharides and calcium, resulting in superior quality and suitability for greenhouse stacking, soil-covered cultivation, and industrialized cultivation.

[0017] The elm yellow mushroom strain L6926 (classified name: Pleurotus citrinopileatus) of this invention was deposited on May 27, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, accession number GDMCC No: 66424, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences Institute of Microbiology.

[0018] Compared with the prior art, the beneficial effects of this invention are as follows: (1) The wild strain of *Pleurotus ostreatus* L6926 was collected from Zayu County, Linzhi City, Tibet Autonomous Region. Wild resources originate from high-altitude areas, exhibiting strong resistance to adverse conditions and low temperatures. Mycelium begins to germinate slowly at 5℃, and its growth rate is higher than the control under various temperature conditions. Its inhibition rate against *Cladosporium* is also higher than the control. In actual production, it exhibits low contamination rates, rapid substrate consumption, and is less susceptible to contamination by other fungi, demonstrating strong resistance to contamination. Furthermore, multiple batches of cultivation trials showed low rates of contamination and pest / disease occurrence. Therefore, the experiment indicates that *Pleurotus ostreatus* L6926 has strong disease resistance. (2) The quality of the mushroom strain L6926 is relatively good. The fresh mushroom cap is not easily broken, the fruiting body cap is golden yellow to dark yellow, the color is bright, and the dried mushroom has a bright color. It is very popular among consumers when used to prepare mushroom soup packets or for other purposes. In addition, the functional component crude polysaccharide and the mineral calcium content are high, so it can be used as a nutritional supplement and health food. (3) The yield of the elm yellow mushroom strain L6926 is relatively high, with an average fresh weight of 1722.07g / bag and an average biological conversion rate of 114.80%. This is 13.70% higher than the control. Moreover, the fruiting cycle is relatively concentrated. The fruiting of stacked cultivation is generally completed from early April to mid-October each year. During this period, each mushroom bag can be harvested 4 to 8 times.

[0019] (4) The elm yellow mushroom strain L6926 is adaptable to a variety of planting methods. The inventors have tested factory planting, greenhouse soil covering planting, greenhouse stacking planting, and forest soil covering planting. All of these planting methods can achieve good planting results and have strong environmental adaptability. Attached Figure Description

[0020] This invention relates to the *Pleurotus ostreatus* strain L6926, which is named Dehua No. 1. Figure 1 Photographs of pure mycelial cultures; Figure 2 Phylogenetic tree of *Pleurotus ostreatus* species L6926; Figure 3 Gel image of SSR molecular marker for *Pleurotus ostreatus* strain L6926; Figure 4 Images of the antagonism test; Note: A is the front of the plate, B is the back of the plate; in the plate, the left side contains *Pleurotus ostreatus* strain 6925, and the right side contains *Pleurotus ostreatus* strain L6926; Figure 5 Figures showing mycelial growth rates under different carbon source conditions; Figure 6 Graphs showing mycelial growth rates under different nitrogen source conditions; Figure 7 Graphs showing mycelial growth rates under different inorganic salt conditions; Figure 8 Graphs showing mycelial growth rates under different temperature conditions; Figure 9 Figures showing mycelial growth rates under different pH conditions; Figure 10 Photos of the initial screening and cultivation of *Pleurotus ostreatus* strain L6926 in a small-scale trial. Figure 11 Photos of small-scale secondary screening cultivation of *Pleurotus ostreatus* strain L6926; Figure 12 Photographs of intermediate experimental cultivation of *Pleurotus ostreatus* strain L6926; Figure 13 To demonstrate the cultivation effect of *Pleurotus ostreatus* strain L6926; among them, A. Songming County, Kunming City, Yunnan Province; B. Yimen County, Yuxi City, Yunnan Province; C. Luliang County, Qujing City, Yunnan Province; Figure 14To demonstrate the cultivation effect of *Pleurotus ostreatus* strain L6925 as a control; among them, A. Songming County, Kunming City, Yunnan Province; B. Yimen County, Yuxi City, Yunnan Province; C. Luliang County, Qujing City, Yunnan Province; Figure 15 The image shows the antagonistic culture results of *Pleurotus ostreatus* and *Cladosporium*. A represents *Cladosporium* culture alone, B represents *Pleurotus ostreatus* strain 6925 and *Cladosporium*, and C represents *Pleurotus ostreatus* strain L6926 and *Cladosporium*. Figure 16 Morphological images of *Pleurotus ostreatus* spore strain L6926; where AB: fruiting body; C: clamp junctions of hyphae; D: spore print; E: basidia; F: spores (electron microscopy); G: spores (microscopy). Scale bars: A, B, D: 1 cm; C, E, G: 10 µm; F: 5 µm.

[0021] The elm yellow mushroom strain L6926 (Pleurotus citrinopileatus) of this invention was deposited on May 27, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, accession number GDMCC No: 66424, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Institute of Microbiology. Detailed Implementation

[0022] The present invention will now be described in further detail with reference to the embodiments.

[0023] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0024] Example 1

[0025] A strain of *Pleurotus ostreatus*, L6926, was deposited on May 27, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 66424.

[0026] The artificial cultivation method for the *Pleurotus ostreatus* strain L6926 includes the following steps: Step (1), strain preparation: Take the mother strain obtained from the tissue isolation of *Pleurotus ostreatus* L6926, rejuvenate it with mother strain culture medium, and then inoculate it into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, transfer the original strain to the cultivation container for culture. After the mycelium has filled the cultivation container, finally transfer the cultivation strain into the cultivation bag and culture until the mycelium has filled the bag. Step (2), cultivation management: Place the cultivation bags obtained in step (1) in the greenhouse for stacking cultivation or soil covering cultivation; Step (3), harvesting of fruiting bodies: harvest when the fruiting bodies are seven or eight parts mature, dark yellow in color, and before they release spores; The mother culture medium comprises the following components by weight: 200 parts potato, 19 parts sucrose, 2.5 parts tryptone, 0.4 parts calcium chloride, 16.5 parts agar, and 1000 parts water; The original culture medium in the original culture bottle includes the following components by weight: 60 parts buckwheat, 20 parts broadleaf tree sawdust, 17 parts wheat bran, 1.5 parts sugar, 1.5 parts gypsum, 1.5 parts lime, with a water content of 57%. The culture medium in the culture container comprises the following components by weight: 12 parts buckwheat, 40 parts broadleaf tree sawdust, 27 parts cottonseed hulls, 14 parts wheat bran, 1.6 parts sugar, 1.3 parts gypsum, and 1.8 parts lime, with a moisture content of 57%. The culture medium in the cultivation bag includes the following components by weight: 57 parts broadleaf tree sawdust, 20 parts cottonseed hulls, 20 parts wheat bran, 1 part lime, and 1 part gypsum.

[0027] Example 2

[0028] A strain of *Pleurotus ostreatus*, L6926, was deposited on May 27, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 66424.

[0029] The artificial cultivation method for the *Pleurotus ostreatus* strain L6926 includes the following steps: Step (1), strain preparation: Take the mother strain obtained from the tissue isolation of *Pleurotus ostreatus* L6926, rejuvenate it with mother strain culture medium, and then inoculate it into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, transfer the original strain to the cultivation container for culture. After the mycelium has filled the cultivation container, finally transfer the cultivation strain into the cultivation bag and culture until the mycelium has filled the bag. Step (2), cultivation management: Place the cultivation bags obtained in step (1) in the greenhouse for stacking cultivation or soil covering cultivation; Step (3), harvesting of fruiting bodies: harvest when the fruiting bodies are seven or eight parts mature, dark yellow in color, and before they release spores; The mother culture medium comprises the following components by weight: 198 parts potato, 18 parts sucrose, 2 parts tryptone, 0.39 parts calcium chloride, 16 parts agar, and 998 parts water. The original culture medium in the original culture bottle includes the following components by weight: 59 parts buckwheat, 19 parts broadleaf tree sawdust, 16 parts wheat bran, 1 part sugar, 1 part gypsum, 1 part lime, with a water content of 55%. The culture medium in the culture container comprises the following components by weight: 10 parts buckwheat, 38 parts broadleaf tree sawdust, 24 parts cottonseed hulls, 10 parts wheat bran, 1 part sugar, 1 part gypsum, and 1 part lime, with a water content of 55%. The culture medium in the cultivation bag includes the following components by weight: 56 parts broadleaf tree sawdust, 18 parts cottonseed hulls, 19 parts wheat bran, 0.98 parts lime, and 0.98 parts gypsum.

[0030] When using the mother culture medium for rejuvenation, it is incubated in the dark at a temperature of 22°C; The original culture medium is cultured in the dark at a temperature of 20°C. When culturing in containers, the culture is carried out in the dark at a temperature of 20°C; When culturing in the cultivation bags, it is carried out in the dark at a temperature of 22℃.

[0031] In step (1), cultivation can begin when nodular mycelial protrusions appear inside the cultivation bag and are grayish-white.

[0032] In step (2), when stacking the mushroom logs for cultivation, replace the cotton-free cover with an open wide-mouth ring as the mushroom outlet, or directly remove the cotton-free cover and open the bag. After opening, the mushroom buds will appear in 2-3 days. Do not spray water when the mushroom buds first appear. Wait until more than 70% of the mushroom buds turn golden yellow before spraying to increase humidity and maintain the relative humidity of the air at 85%-90%. In step (2), when cultivating with soil, first spread quicklime on the surface of the greenhouse soil, 100 kg per mu, and till the soil twice. Then break up the soil on the surface until the soil particle diameter is less than 3 cm. Remove the mushroom bags from the mushroom sticks and place them horizontally on the ground with a 29 cm interval between rows. Cover with 2 cm of soil and sprinkle 0.9 cm thick pine needles on the soil surface. After planting, water and keep the soil moisture at 20%-30%.

[0033] In step (2), after cultivation, during the growth of the fruiting body, the temperature is controlled at 18-26℃; direct sunlight is avoided, and the light intensity is controlled at 1500-2500 lux, while the carbon dioxide concentration is controlled below 0.2%; and the relative humidity of the air is maintained at 85%-95%.

[0034] Example 3

[0035] A strain of *Pleurotus ostreatus*, L6926, was deposited on May 27, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 66424.

[0036] The artificial cultivation method for the *Pleurotus ostreatus* strain L6926 includes the following steps: Step (1), strain preparation: Take the mother strain obtained from the tissue isolation of *Pleurotus ostreatus* L6926, rejuvenate it with mother strain culture medium, and then inoculate it into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, transfer the original strain to the cultivation container for culture. After the mycelium has filled the cultivation container, finally transfer the cultivation strain into the cultivation bag and culture until the mycelium has filled the bag. Step (2), cultivation management: Place the cultivation bags obtained in step (1) in the greenhouse for stacking cultivation or soil covering cultivation; Step (3), harvesting of fruiting bodies: harvest when the fruiting bodies are seven or eight parts mature, dark yellow in color, and before they release spores; The mother culture medium comprises the following components by weight: 202 parts potato, 20 parts sucrose, 3 parts tryptone, 0.41 parts calcium chloride, 17 parts agar, and 1002 parts water. The original culture medium in the original culture bottle includes the following components by weight: 61 parts buckwheat, 21 parts broadleaf tree sawdust, 18 parts wheat bran, 2 parts sugar, 2 parts gypsum, and 2 parts lime, with a water content of 60%. The culture medium in the culture container comprises the following components by weight: 15 parts buckwheat, 42 parts broadleaf tree sawdust, 29 parts cottonseed hulls, 16 parts wheat bran, 2 parts sugar, 2 parts gypsum, and 2 parts lime, with a moisture content of 60%. The culture medium in the cultivation bag includes the following components by weight: 58 parts broadleaf tree sawdust, 22 parts cottonseed hulls, 21 parts wheat bran, 1.02 parts lime, and 1.02 parts gypsum.

[0037] When using the mother culture medium for rejuvenation, it is incubated in the dark at a temperature of 24℃; The original culture medium is cultured in the dark at a temperature of 25°C. When culturing in containers, the seed culture is carried out in the dark at a temperature of 25°C; When culturing in the cultivation bags, it is carried out in the dark at a temperature of 26℃.

[0038] In step (1), cultivation can begin when nodular mycelial protrusions appear inside the cultivation bag and are grayish-white.

[0039] In step (2), when stacking the mushroom logs for cultivation, replace the cotton-free cover with an open wide-mouth ring as the mushroom outlet, or directly remove the cotton-free cover and open the bag. After opening, the mushroom buds will appear in 2-3 days. Do not spray water when the mushroom buds first appear. Wait until more than 70% of the mushroom buds turn golden yellow before spraying to increase humidity and maintain the relative humidity of the air at 85%-90%. In step (2), when cultivating with soil, first spread quicklime on the surface of the greenhouse soil, 150 kg per mu, and till the soil 3 times. Then break the surface soil into clods until the soil particle diameter is less than 3 cm. Remove the mushroom bags from the mushroom sticks and place them horizontally on the ground with a 31 cm interval between rows. Cover with 3 cm of soil and sprinkle 1.1 cm thick pine needles on the soil surface. After planting, water and keep the soil moisture at 20%-30%.

[0040] In step (2), after cultivation, during the growth of the fruiting body, the temperature is controlled at 18-26℃; direct sunlight is avoided, and the light intensity is controlled at 1500-2500 lux, while the carbon dioxide concentration is controlled below 0.2%; and the relative humidity of the air is maintained at 85%-95%.

[0041] Example 4

[0042] A strain of *Pleurotus ostreatus*, L6926, was deposited on May 27, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 66424.

[0043] The artificial cultivation method for the *Pleurotus ostreatus* strain L6926 includes the following steps: Step (1), strain preparation: Take the mother strain obtained from the tissue isolation of *Pleurotus ostreatus* L6926, rejuvenate it with mother strain culture medium, and then inoculate it into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, transfer the original strain to the cultivation container for culture. After the mycelium has filled the cultivation container, finally transfer the cultivation strain into the cultivation bag and culture until the mycelium has filled the bag. Step (2), cultivation management: Place the cultivation bags obtained in step (1) in the greenhouse for stacking cultivation or soil covering cultivation; Step (3), harvesting of fruiting bodies: harvest when the fruiting bodies are seven or eight parts mature, dark yellow in color, and before they release spores; The mother culture medium comprises the following components by weight: 200 parts potato, 19 parts sucrose, 2.5 parts tryptone, 0.4 parts calcium chloride, 16.5 parts agar, and 1000 parts water; The original culture medium in the original culture bottle includes the following components by weight: 60 parts buckwheat, 20 parts broadleaf tree sawdust, 17 parts wheat bran, 1.5 parts sugar, 1.5 parts gypsum, 1.5 parts lime, with a water content of 58%. The culture medium in the culture container comprises the following components by weight: 12 parts buckwheat, 40 parts broadleaf tree sawdust, 27 parts cottonseed hulls, 15 parts wheat bran, 1.5 parts sugar, 1.5 parts gypsum, and 1.5 parts lime, with a moisture content of 58%. The culture medium in the cultivation bag includes the following components by weight: 57 parts broadleaf tree sawdust, 20 parts cottonseed hulls, 20 parts wheat bran, 1 part lime, and 1 part gypsum.

[0044] When using the mother culture medium for rejuvenation, it is incubated in the dark at a temperature of 23°C; The original culture medium is cultured in the dark at a temperature of 24℃. When culturing in containers, the culture is carried out in the dark at a temperature of 22°C; When culturing in the cultivation bags, it is carried out in the dark at a temperature of 24℃.

[0045] In step (1), cultivation can begin when nodular mycelial protrusions appear inside the cultivation bag and are grayish-white.

[0046] In step (2), when stacking the mushroom logs for cultivation, replace the cotton-free cover with an open wide-mouth ring as the mushroom outlet, or directly remove the cotton-free cover and open the bag. After opening, the mushroom buds will appear in 2-3 days. Do not spray water when the mushroom buds first appear. Wait until more than 70% of the mushroom buds turn golden yellow before spraying to increase humidity and maintain the relative humidity of the air at 85%-90%. In step (2), when covering the soil for cultivation, first spread quicklime on the surface of the greenhouse soil, 120 kg per mu, and till the soil 3 times. Then break the surface soil into clods until the soil particle diameter is less than 3 cm. Remove the mushroom bags from the mushroom sticks and place them horizontally on the ground with a 30 cm interval between rows. Cover with 2.5 cm of soil and sprinkle 1 cm thick pine needles on the soil surface. After planting, water and keep the soil moisture at 20%-30%.

[0047] In step (2), after cultivation, during the growth of the fruiting body, the temperature is controlled at 18-26℃; direct sunlight is avoided, and the light intensity is controlled at 1500-2500 lux, while the carbon dioxide concentration is controlled below 0.2%; and the relative humidity of the air is maintained at 85%-95%.

[0048] Application Examples I. Strain source of *Pleurotus ostreatus* strain L6926 On June 12, 2019, the inventor collected wild yellow elm mushrooms from rotten wood in Shangchayu Town, Chayu County, Linzhi City, Tibet Autonomous Region, and obtained pure culture strains through tissue isolation and purification.

[0049] II. Isolation, purification, and identification of *Pleurotus ostreatus* strain L6926 1. Separation and purification (tissue separation) Small pieces of internal tissue from wild *Pleurotus ostreatus* were cut near an alcohol lamp and placed on PDA medium. Germination was observed, and after purification, a pure strain was obtained. Under the same culture conditions, mycelial growth (growth rate, thickness, density, etc.) was compared. Strains with weak mycelial growth were eliminated, and the strain with the best mycelial growth, capable of producing fruiting bodies, was selected. This strain, *Pleurotus ostreatus* strain L6926, was named Dehua No. 1. A photograph of its pure mycelial culture is shown below. Figure 1 As shown.

[0050] 2. Molecular identification A suitable amount of pure cultured mycelium was scraped and ground with liquid nitrogen (or a grinder). Total DNA was extracted using a plant genomic DNA extraction kit (Beijing Jinsha Biotechnology Co., Ltd.). Four gene fragments—ITS, LSU, TEF-1a, and RBP2—were selected for amplification using RNA polymerase chain reaction (PCR). The specific primer base composition is shown in Table 1. The PCR reaction system (25 μL) included: 2.5 μL PCR reaction buffer, 2.5 μL 0.2% BSA, 2 μL dNTP (2.5 mm), 0.5 μL each of forward and reverse primers (concentration 100 pmol / μL), 0.2 μL 5 U / μL Taq DNA polymerase, 1 μL DNA solution, and 15.8 μL sterile ddH2O.

[0051] Table 1 Primers and base composition used for PCR amplification

[0052] The ITS PCR cycle was as follows: initial denaturation at 94℃ for 5 min; repeated 35 cycles of 94℃ for 30 s, 53℃ for 30 s, and 72℃ for 50 s; and a final extension at 72℃ for 10 min.

[0053] The PCR cycle for nrLSU was as follows: initial denaturation at 94℃ for 5 min; 35 cycles of 94℃ for 30 s, 52℃ for 30 s, and 72℃ for 1 min; and a final extension at 72℃ for 10 min.

[0054] The PCR cycle for TEF1-α was as follows: initial denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, denaturation at 55℃ for 30 s, denaturation at 72℃ for 50 s, and extension at 72℃ for 10 min; repeated for 35 cycles.

[0055] The PCR cycle for RPB2 was as follows: initial denaturation at 94℃ for 5 min; 94℃ for 30 s, 50℃ for 30 s, 72℃ for 50 s, repeated for 35 cycles; extension at 72℃ for 10 min.

[0056] The amplified product was stored at 4°C.

[0057] (1) Accurately weigh 1g of agarose using an electronic balance and dissolve it in 100mL of TBE (Tris-Borate-EDTA buffer). Heat the solution in a microwave oven on medium heat for 2.0min until it becomes clear and transparent. When the temperature reaches 65℃, add 1μL of nucleic acid dye and shake well. Pour the solution into a silica gel plate and allow it to cool. Place the plate in an electrophoresis pool and use a pipette to spot the sample. The spotting volume is 5μL. The electrophoresis voltage is 160V, the current is 90A, and the time is 15min. After electrophoresis in 1.0×TBE buffer, observe, photograph, and record the results using an ultraviolet gel imaging system. Detect the concentration of the extracted DNA. Send positive products to Shanghai Sangon Biotech for sequencing. When the sequence contains heterozygous INDELs or indeterminate sites, perform bidirectional sequencing on the sample to splice the amplified region or verify the indeterminate sites. ITS, LSU, TEF-1a, and RBP2 fragments were compared in the NCBI database, and sequences with high similarity were downloaded for comparison, confirming that the L6926 species of P. citrinopileatus Singer was indeed P. citrinopileatus Singer.

[0058] The characteristic sequences of the L6926 strain of *Pleurotus ostreatus* are as follows: ITS, LSU, TEF-1a and RBP2, as shown in SEQ ID NO.9~SEQ ID NO.12.

[0059] The ITS sequence is: aggtcattaatgaattcgcttttgaagctgaatgctggcccttaggggcatgtgcacgcttcattagtcccctttcacacccctgtgcacctttgatagattcgctggaaagacggtcgcctcacggtgacttgaactccggtgggtctataaccattacacacacaaacgtatgtctacgaatgtcatttatatgggccatgctgcctataaaaacctaatacaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgccccttggtattccgaggggcatgcctgtttgagtgtcattaaattctcaaacctaccttttgctttgctgtaaatcgtagtgtttggattgttgggggttgctggcttgtcaccgagtcggctcctcttaaatgcattagcgggactttgttgttgcctctgctacatggtgtgataattatctacgccagaccgtacgcaatgatacttattggagtccagctctctaatcgtcttcggacagctttttgaccatttgacctcaaatcaggaag (SEQ ID NO. 9).

[0060] nrLSU is: acgatcgatttgcacgtcagaatcgctacgagcctccaccagagtttcctctggcttcgccctattcaggcatagttcaccatctttcgggtcccaacatacatgctcaaccgcatagccgtccgtaaacttctggtatgggcgtcggtgctctccacgacagagatcccaactttcactttcattgcgcatccgggtttaccacccaaatactcgcaggcatgttagactccttggtccgtgtttcaagacgggtcgattaaagccattttgccagcatcctaagcacgaacgtgggcgaaccccggcctttcggcgtgctgagttcctcagtcccagccactgtatatgatcagagactataacacacccgaaggtgccacatttccctgacctttgtccagcagccaaaactgatgctgacccgtcaaccaggaagtacgcctcacaaaagcaaggttgatccccggccgacgcgactgacttcaagcgtttccctttcaacaatttcacgtactgtttaactctctttccaaagttcttttcatctttccctcacggtacttgttcgctatcggtctctcgccaatatttagctttagatggaatttaccacccattttgagctgcattcccaaacaactcgactcgttgagagtgcatcacaaagccctggtagtccgtgtcaaagacgggattctcaccctctatgacgccccattccaggggacttgtacacggtccagcacggataacacttctctagattacaactcggatggccagaagaccaccagattttaaatttgagcttttcccgcttcactcgcaggtactaggggaatccttgttagttctttt (SEQ ID NO.10).

[0061] TEF-1α is: tatcctcatcatcgccgccggcactggtgaattcgaagctggtatctctaaagatggccagactcgcgagcacgctctccttgccttcactctcggtgtccgtcagcttattgttgccgtcaacaagatggacaccaccaaggtacctccgtctgtttagaagactgaatattaatgctgactggcaatatagtggagtgaggaccgattcaacgaaattatcaaggaaacctcgaccttcatcaagaaggtcgggtataaccctaaggccgttgccttcgttcccatctctggctggcatggtgacaacatgttggaagaatcttccaagtaagctatcgtctgtctctaatgccagagttctctcaaatcgcctcctatctagcatgccttggtacaagggttggtccaaggagaccaaggctggtgtcgtcaagggcaagacgctccttgatgccatcgacgccattgagccccctgttcgaccctccgacaagcctcttcgccttcctctccaggatgtgtacaagatcggtg (SEQ ID NO. 11).

[0062] RBP2 is: tcttgtcaccttttccgaatgctctttcgcaagcttaccaaagatgtgtaccgatatctgcagaaggttggtatcgcgatttcacagcacattatacgctgacctcctttgaagtgcgtcgagacccataaagagttcaacctcacccttgctgtgaagcatcagacaattacgaatggtctcaagtattcgctagccacagggaactggggagaccaaaagaaatccatgtcctcgaaagctggcgtatctcaagtcctcaatcgttatacgtatgcttccacgctctcacatttacgccgctgcaatactccactcggaagagaaggcaagattgccaagccgcgtcagctgcacaatacccactggggtatggtgtgtccggcagagacgcccgaaggtcaagcttgtggtctcgtcaagaaccttgcgctcatgtcatgtatctctgttggttctatatctgcgcctgtcatcgaattcttggaggagtgggggttggagggcctggaagaaaatgctcacgccaacgtcccttgtaccaaggtcttcgtcaatggtgtttggatgggtgtacatcgagatccagccaatcttgtgaagactatcaagaagctacgcagaaaggacgatatcagtcccgaagtatctgtcgtgcgagatattcgagagaaagagttgagggtgtataccgacgctgggcgagtatgccgaccacttttcatcgtcgaaaatcatcagcttctactccagaagaagcacatacgatggttgaatcagggacacgatgataatggcgacgagttcaaatgggacgggctcattagaagtggtgtgattgagatgttggatgccgaagaggaagaaacggtaatgatatcaatgacaccggaggacctggaaaactctcgcctgcagctaaatggcattgacccgaggccaagcgaaagtgaatacgaccccgccgctcgg (SEQ ID NO. 12).

[0063] (2) The four multi-gene sequences of the mycelium of *Pleurotus citrinopileatus* strain L6926 were spliced ​​in both forward and reverse directions and compared with the NCBI database. The results showed that the ITS sequence of *Pleurotus citrinopileatus* strain L6926 had a 100.00% similarity to the sequence of *Pleurotus citrinopileatus* (ON557698); the nrLSU sequence had a 99.77% similarity to the sequence of *P. citrinopileatus* (KX787094); the TEF-1α sequence had a 99.81% similarity to the sequence of *P. citrinopileatus* (KX787111); and the RBP2 sequence had a 99.54% similarity to the sequence of *P. citrinopileatus* (MW291149). The sequence similarity between the control strain L6925 and *P. citrinopileatus* (KY962470) was 100.00% (strain L6925 is an existing variety, introduced from Zhejiang by Yimen County Dehua Fungi Industry Co., Ltd. many years ago). Sequence alignment results showed that both strain L6926 and the control strain 6925 had a high similarity to *P. citrinopileatus*. Based on the general assumption that macrofungi have a gene similarity greater than 97%, they are considered to be the same species. Therefore, it was preliminarily determined that both strain L6926 and the control strain 6925 are *P. citrinopileatus*, but there are certain differences in their molecular sequences and clades, thus they are different strains of the same species.

[0064] (3) Base differences ① The sequences of *Pleurotus ostreatus* strains L6926 and 6925 were compared using BioEdit software. The results showed that there was a one-base difference between the nrLSU sequences of *Pleurotus ostreatus* strains L6926 and 6925. The 329th base of *Pleurotus ostreatus* strain L6926 is g, while the 329th base of *Pleurotus ostreatus* strain 6925 is t.

[0065] ② The sequences of *Pleurotus ostreatus* strains L6926 and 6925 were compared using BioEdit software. The results showed that there were two base differences in the RBP2 sequences of *Pleurotus ostreatus* strains L6926 and 6925. In *Pleurotus ostreatus* strain L6926, the 71st base was 't' and the 164th base was 'g'; in *Pleurotus ostreatus* strain 6925, the 71st base was 'c' and the 164th base was 'a'.

[0066] ③ The sequences of *Pleurotus ostreatus* strains L6926 and 6925 were compared using BioEdit software. The results showed that there were two base differences in the TEF-1α sequences of *Pleurotus ostreatus* strains L6926 and 6925. In *Pleurotus ostreatus* strain L6926, the 60th base was 't' and the 364th base was 'a'; in *Pleurotus ostreatus* strain 6925, the 60th base was 'c' and the 364th base was 'g'.

[0067] (4) Phylogenetic analysis of the elm yellow mushroom strain L6926 Based on the NCBI alignment results of four gene sequences, relevant reference sequences were downloaded from GenBank. From these, 40 gene sequences from 19 species of the genus *Pleurotus* were selected, and polygenic phylogenetic analysis was performed based on the ITS+nrLSU+TEF1-α+RPB2 sequence. Maximum likelihood (ML) phylogenetic analysis and RAxML combinatorial dataset analysis generated an optimal score tree. Guided values ​​with a maximum likelihood (ML) greater than 70% were displayed at the nodes (e.g.,...). Figure 2 ).

[0068] Phylogenetic analysis showed that *Pleurotus citrinopileatus* species L6926 and the control species 6925 formed a separate branch with the previously reported *Pleurotus citrinopileatus* in the phylogenetic tree of the genus *Pleurotus*, and received 100% support (e.g., ...). Figure 2 Based on morphological analysis, strain L6926 of *Pleurotus citrinopileatus* was identified as the same species as the control strain 6925, but there were some differences in genetic distance.

[0069] III. SSR Molecular Markers 1. DNA extraction The mycelia L6926 and 6925 of *Pleurotus ostreatus* were transferred to potato dextrose agar solid medium and cultured at 25°C for 15 days. Mycelia were then collected. Genomic DNA was extracted from the mycelia using the DE711-50 kit from Jinsha Biotechnology. The purity and concentration of the DNA were determined by agarose gel electrophoresis and biospectrophotometry.

[0070] 2. Genome sequencing After purification and library construction, the DNA of *Pleurotus ostreatus* strains L6926 and 6925 was sequenced using sequencing technology on a sequencing platform. SSR sites were searched for in the genome sequence of *Pleurotus ostreatus* strain L6926.

[0071] 3. Development of SSR primers based on genome sequencing results Based on the genome data of *Pleurotus ostreatus*, four pairs of SSR primers, L6926SSR-01, L6926SSR-02, L6926SSR-03, and L6926SSR-04, were used to distinguish *Pleurotus ostreatus* strain L6926 from the control strain 6925. Detailed information on the marker primers is shown in Table 2.

[0072] Table 2 SSR marker primer information

[0073] 4. PCR amplification SSR-labeled PCR amplification was performed on the extracted DNA using SSR molecular markers: The PCR amplification system consisted of a total volume of 25 μL, including: 12.5 μL of 2×San Taq PCR Mix (with black dye); 1 μL each of SSR-labeled forward and reverse primers (both at a concentration of 0.1 mmol / μL); 1 μL of template DNA; and 9.5 μL of ddH2O. The PCR reaction conditions were: 95℃ for 2 min; 95℃ for 30 seconds, 53℃ for 30 seconds, and 72℃ for 30 seconds, for 36 cycles; and 72℃ for 5 min. To ensure the accuracy of identification, three replicate experiments were performed. The control CK (Ulmus pumila spore strain 6925) was also replicated three times under the same conditions.

[0074] 5. Electrophoresis Electrophoresis was performed using polyacrylamide gel, followed by silver staining to reveal bands: 48 mL of 1×TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED; pour the gel immediately after preparation, removing air bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 2 μL per well, and the electrophoresis conditions are 270V constant voltage for 1 h. After electrophoresis, wash the gel twice with distilled water; add 400 mL of 10% silver nitrate solution and shake on a shaker for 8 min; after silver staining, wash twice with water; add sodium hydroxide and formaldehyde for color development (NaOH 6 g, distilled water 400 mL, formaldehyde solution 2 mL).

[0075] Table 3 compares the amplified fragment sizes of primers in *Pleurotus ostreatus* strain L6926 and control *Pleurotus ostreatus* strain 6925.

[0076] As shown in Table 3, the SSR primers L6926SSR-01, L6926SSR-02, L6926SSR-03, and L6926SSR-04 can distinguish the *Pleurotus ostreatus* strain L6926 from the control strain 6925. The sizes of the specific fragments amplified by *Pleurotus ostreatus* strain L6926 were 120, 129, 106, and 119 bp, respectively, while the sizes of the fragments from the control strain 6925 were 116, 125, 100, and (125, 129) bp, respectively. This indicates that the two strains have genetic differences.

[0077] IV. Antagonism Test The procedure was performed according to the national industry standard "Differential Identification of Edible Fungi Strains - Antagonistic Reaction" (NY / T 1845-2010). *Pleurotus ostreatus* strain L6926 and control strain 6925 were inoculated into PDA medium for activation. Then, 0.5 cm diameter inoculation blocks of 7-day-old mycelium were taken using a punch, spaced 30 mm apart, and placed 15 mm from the center of the plate with mycelium facing upwards. The plates were incubated at 26°C for 6-7 days, with three replicates, and the antagonistic phenomenon of mycelium at the colony boundaries between the strains was observed.

[0078] Antagonism test results as follows Figure 4 As shown, the results indicate that antagonistic experiments were conducted between the isolated *Pleurotus ostreatus* strain L6926 and the control strain 6925. The results showed a strong antagonistic reaction between the pure strain L6926 and the control strain 6925, indicating no affinity and forming distinct "depressed" antagonistic lines. The mycelium of strain L6926 grew faster, while the mycelium of the control strain 6925 was whiter and denser.

[0079] V. Cultivation Method of Pleurotus ostreatus strain L6926 1. Mother culture medium and its preparation The mother culture medium formula is modified potato glucose agar medium (PDA): 200g potato, 20g sucrose, 2g tryptone, 0.4g calcium chloride, 16g agar, and 1000mL water.

[0080] The improved method for preparing potato glucose culture medium is as follows: (1) Cooking: Peel the potatoes, wash and slice them. Weigh 200g, add 1000mL of water, heat and boil until the potato slices are tender but not mushy, and filter with six layers of gauze.

[0081] (2) Preparation ratio: Add 20g sucrose, 2g tryptone, 0.4g calcium chloride and 16g agar to the filtrate, add water to make up to 1L, and stir to dissolve.

[0082] (3) Dispensing and sterilization: After dissolving, dispense the solution into test tubes while still hot, generally filling 1 / 5 to 1 / 4 of the test tube length. After dispensing, plug the tubes with cotton plugs, 50 plugs per bundle, and wrap one end of the test tube opening tightly with kraft paper. After wrapping, place the test tubes in an autoclave and sterilize at 121℃ for 20 minutes.

[0083] (4) Slant placement: After sterilization, take out the test tube while it is still hot and place it on the workbench to form a slant. Usually, the length of the slant is 1 / 2 of the test tube. After solidification, place it in a clean and dry place for later use.

[0084] The mother culture was isolated using a tissue isolation method, which has advantages such as simplicity, convenience, stable genetic traits, and strong regeneration ability. Fresh fruiting bodies were collected, and impurities at the base were scraped off with a knife. The bodies were then wiped with cotton balls (after squeezing out the alcohol solution) and placed in petri dishes. The dishes were then transferred to a clean bench, and hands were sterilized. Inoculation needles, forceps, and blades were flammed over an alcohol lamp for later use. Tissue blocks measuring 0.5cm × 0.5cm were cut using a scalpel and inoculated into the culture medium. After purification and culture, the mother culture was obtained.

[0085] 2. Culture media for primary and cultivated strains and their preparation The original culture medium formula is: 59-61 parts buckwheat, 19-21 parts broadleaf tree sawdust, 16-18 parts wheat bran, 1-2 parts sugar, 1-2 parts gypsum, 1-2 parts lime, with a water content of 55-60%.

[0086] The culture medium formula for the cultivated seed is as follows: 10-15 parts buckwheat, 38-42 parts broadleaf tree sawdust, 24-29 parts cottonseed hulls, 10-16 parts wheat bran, 1-2 parts sugar, 1-2 parts gypsum, 1-2 parts lime, with a water content of 55-60%.

[0087] The preparation methods for the culture media of primary strains and cultivated strains are as follows: (1) Ingredients and pretreatment: Weigh the ingredients according to the formula. Among them, broadleaf tree wood chips and cottonseed hulls need to be pre-wetted with water before being mixed with other auxiliary materials; buckwheat needs to be soaked in water with 0.2% lime beforehand. (2) Mixing and bottling (packing): Mix the prepared main material with other ingredients, with a moisture content of 55-60%. Use breathable cap tissue culture bottles for the original culture and use spawn bags for the cultivated culture. Pack the bottles (bags) tightly and punch holes in the center for easy inoculation. (3) Sterilization: Before sterilization, cold air needs to be completely removed to ensure that the bacteria in the sterilization package are completely killed. The original culture bottle is placed in an autoclave and sterilized at 121°C and 0.103MPa for 2 hours; (4) Inoculation of the primary culture: Place the sterilized primary culture bottles into the inoculation room and sterilize them with a UV lamp for half an hour before inoculation. Strict aseptic procedures should be followed during the operation. Cut the mother culture into small pieces and inoculate them in the center of the culture medium. After inoculation, move all the primary culture bottles into the incubation room and control the temperature at 22-25℃. When the mycelium in the culture bottles has covered 1 / 3 of the bag, lower the temperature of the incubation room to 20-23℃. Check the primary culture bottles for contamination by other microorganisms at least once a week. If contaminated, remove the contaminated bottles from the incubation room immediately and record the mycelial growth of *Pleurotus ostreatus*.

[0088] 3. Method for making cultivation bags The culture medium formula for the cultivation bags is as follows: 56-58 parts broadleaf tree sawdust, 18-22 parts cottonseed hulls, 19-21 parts wheat bran, 0.98-1.02 parts lime, and 0.98-1.02 parts gypsum.

[0089] (1) Ingredients and pretreatment: Weigh the ingredients according to the formula. The broadleaf tree wood chips and cottonseed hulls need to be pre-wetted with water 24 hours in advance. Dissolve the required gypsum and lime in water first, then sprinkle them on the broadleaf tree wood chips, cottonseed hulls and wheat bran. Add water while stirring, pile and let it sit for 1 hour, then stir again until uniform.

[0090] (2) Bagging: Use 25 cm × 50 cm × 0.05 cm polyethylene bags for bagging. The bagging should be appropriately tight, and the culture medium should be compacted while adding the material. The material should be packed tightly, and the height of the material after bagging should be about 25 cm. Put on the collar and the cap. Each bag of culture medium has a dry weight of 1.5 kg and a wet weight of about 3.0 kg.

[0091] (3) Sterilization: When using atmospheric pressure steam sterilization, vent the cold air in advance during the heating process. When the temperature reaches 110℃, start timing and maintain this temperature for 8-10 hours. Then stop heating and allow it to cool down naturally. When the internal temperature of the sterilizer drops below 60℃, the bags can be transferred to the cooling chamber for natural cooling. When using high pressure steam sterilization, first open the exhaust valve to allow the cold air inside the pot to escape freely. When the temperature inside the pot reaches 100℃, close the exhaust valve. When the pressure is increased to 0.05MPa, slowly lift the exhaust valve and slowly vent the air. When the pressure gauge drops to the starting point, close the exhaust valve and pressurize again. Repeat this operation 2-3 times to exhaust all the cold air inside the pot. Different sterilizers and different sterilization quantities per batch vary greatly. The exhaust endpoint is determined by the temperature indicated by the pressure gauge and the temperature gauge being equal. After complete exhaust, increase the pressure to 0.14MPa-0.16MPa and maintain it for about 2 hours.

[0092] (4) Inoculation of cultivation bags: Place the cultivation bags and cultured spawn in the inoculation room and sterilize them with a UV lamp for half an hour before inoculation. Strict aseptic procedures must be followed during the operation. Thoroughly disinfect hands, cultivation bags, and tools with 75% alcohol swabs. Burn and cool the scalpel and forceps over an alcohol lamp, then transfer the spawn at a 1:20 propagation ratio using the scalpel, and seal the bags with a sterilized sponge. After inoculation, transfer the cultivation bags to the incubation room and incubate in the dark at 22℃-26℃. The bags will fully colonize in 25-30 days. During the incubation process, promptly remove any cultivation bags contaminated with other microorganisms.

[0093] 4. Mycelial Culture After inoculation, the mother culture was placed in an incubator at 22-24℃. The original culture and the cultivated culture were placed in a culture room at 22-25℃. When the mycelium grew to 1 / 3 of the substrate bag, the temperature was adjusted to 20-23℃, and the cultivation substrate bags were placed in a culture room at 22-26℃. All were placed on culture racks and cultured in the dark, maintaining an air humidity of 60-65%. The culture bags were observed once a week, and any contaminated cultivation substrate bags were discarded. The relevant growth conditions were recorded.

[0094] 5. Cultivation methods When the mycelium fully grows in the cultivation bag and nodular mycelial protrusions appear inside the bag, turning grayish-white, the mycelium has reached physiological maturity and can be used for cultivation.

[0095] (1) Greenhouse stacking cultivation When using stacked cultivation, replace the cotton-free caps on the mushroom logs with open, wide-mouthed rings to serve as the fruiting outlets, or simply remove the cotton-free caps and open the bags. Allow fruiting to occur at one or both ends. Neatly stack the treated logs in the greenhouse, with a stack height not exceeding 6 layers and a 50-60cm gap between each stack, leaving room for passage. Fruiting buds will appear 2-3 days after opening. Do not spray water when the buds first appear; wait until over 70% of the buds have turned golden yellow before misting to increase humidity, maintaining a relative humidity of 85%-90%.

[0096] Greenhouse soil covering cultivation First, apply quicklime to the soil surface of the greenhouse, at a rate of 100-150 kg per acre. Till the soil 2-3 times, then break up the surface soil into clods less than 3 cm in diameter. Gently cut open the mushroom bags and peel them off, then place them horizontally on the ground, spacing them 30 cm apart. Cover with 2-3 cm of soil, and then sprinkle a 1 cm layer of dry pine needles on the surface. After planting, water the soil and maintain a moisture level of 20%-30%.

[0097] (3) Mushroom Management During the fruiting body growth period, the temperature should be controlled between 18-26℃. Below 18℃, mushroom buds will be difficult to form; above 26℃, it is detrimental to fruiting body growth. Shading should be provided above the mushroom shed, along with a small amount of diffused light to avoid direct sunlight. Adjust the light intensity to 1500-2500 lux. Ensure good ventilation and keep the carbon dioxide concentration below 0.2%. Frequently and finely spray with a fruiting-promoting solution, either by watering the ground or by air misting, avoiding spraying water directly onto the mushroom bags. Maintain a relative humidity of 85%-95%. Too low a humidity level is detrimental to fruiting body growth, while humidity above 95% can lead to the growth of unwanted microorganisms and mushroom rot.

[0098] (6) Harvesting The fruiting bodies of *Pleurotus ostreatus* are high in protein, polysaccharides, and iron. The harvested fruiting bodies are usually the main product of cultivation. The harvesting standard is: the fruiting body is seven or eight parts mature, at which time the cap of the fruiting body is basically flat (3-4 cm in diameter), bright yellow in color, and has not yet released spores.

[0099] Stop watering the day before harvesting. When harvesting, hold the base of the mushroom layer with your hand and gently turn the knob. The mushroom stems harvested in this way often have culture medium attached. Generally, you need to use a tool to cut off the roots with culture medium attached.

[0100] 4. Solid culture characteristics After preparing and mixing the PDA medium, sterilize it at 121℃ and 0.103 MPa for 30 min, and pour it into 90 mm petri dishes to make plates. Activate the preserved *Pleurotus ostreatus* spawn L6926 and transfer it to the PDA medium. Once the mycelium has fully colonized the petri dishes, it is ready for use.

[0101] PDA medium formula: 200 g potato, 20 g glucose, 16 g agar, add water to a final volume of 1 L. Mycelial blocks of *Pleurotus ostreatus* strain were inoculated into the center of each culture medium under different conditions using a 0.5 cm diameter punch. Except for the temperature gradient experiment, all other single-factor conditions were incubated in a 26℃ constant temperature incubator, with five replicates for each treatment. Colony diameter was measured every three days using the streak method. Mycelial morphology and growth potential were observed and recorded. The final data were statistically analyzed using Excel 2021 and SPSS 20.0.

[0102] Culture medium I (OXOID brand PDA synthetic culture medium): Take 39g of PDA culture medium powder, add distilled water to make up to 1L, pH at natural.

[0103] Culture medium II (basal culture medium): 20g glucose, 4g tryptone, 16g agar powder, add distilled water to a final volume of 1L, pH at natural.

[0104] Culture medium I is used to cultivate the mother culture of *Pleurotus ostreatus*. The mother culture will be inoculated into culture medium II to observe its growth. Culture medium II is the basal culture medium. During the experiment, a certain component in it will be replaced with a relevant substance to observe the mycelial growth.

[0105] Growth rate s = colony radius (cm) / number of days (d) 4.1 Single-factor screening experiment for carbon sources Using culture medium II without added glucose as a blank control, five carbon sources were set up as treatment groups: glucose, sucrose, fructose, maltose, and lactose, all at a concentration of 20 g / L.

[0106] The effects of different carbon sources on mycelial growth rate are shown in the following results. Figure 5 .

[0107] Depend on Figure 5 It can be seen that the mycelial growth rate is fastest when sucrose is used as the carbon source, which is (5.25±0.15) mm·d. -1 Sucrose and maltose, when used as carbon sources, resulted in faster and denser mycelial growth compared to other carbon source conditions, showing significant differences. Lactose, as a carbon source, resulted in the slowest mycelial growth rate, at (2.11 ± 0.10) mm·d. -1 .

[0108] 4.2 Single-factor screening experiment for nitrogen sources Using culture medium II without tryptone as a blank control, five nitrogen sources were set up as treatment groups: tryptone, urea, yeast powder, soybean meal powder, and ammonium sulfate, all with a concentration of 4 g / L.

[0109] The effects of different nitrogen sources on mycelial growth rate are shown in the following results. Figure 6 .

[0110] Depend on Figure 6 It can be seen that the mycelial growth rate is fastest when tryptone is used as a nitrogen source, with the fastest growth rate being (5.29±0.39) mm·d. -1 When tryptone and soybean meal were used as nitrogen sources, the mycelial growth was the whitest and densest, showing significant differences compared to other nitrogen source conditions; there were no significant differences between the ammonium sulfate and the control group. Urea was used as the nitrogen source with the slowest mycelial growth rate, at (0.01±0.00) mm·d. -1 .

[0111] 4.3 Inorganic Salt Single-Factor Screening Experiment Using culture medium II as a blank control, five inorganic salts were added to the basal culture medium: potassium dihydrogen phosphate, magnesium sulfate, calcium chloride, sodium carbonate, and zinc sulfate as treatment groups, with a concentration of 0.4 g / L for each group.

[0112] The effects of different inorganic salts on mycelial growth rate are shown in the results. Figure 7 .

[0113] Depend on Figure 7 It can be seen that the mycelial growth rate is fastest when calcium chloride is used as an inorganic salt, at (4.40±0.10) mm·d. -1 The growth rate was highest when sodium carbonate was used as the inorganic salt, followed by sodium sulfate. When zinc sulfate was used as an inorganic salt, the mycelium hardly grew, showing a significant difference from other inorganic salts. When potassium dihydrogen phosphate and magnesium sulfate were used as inorganic salts, the growth rate was slightly faster than the blank control.

[0114] 4.4 Temperature Single-Factor Screening Experiment After inoculation with culture medium I, the culture dishes were placed in constant temperature incubators at 20℃, 22℃, 24℃, 26℃, 28℃, and 30℃ for incubation.

[0115] The effects of different temperatures on mycelial growth rate are shown in the following results. Figure 8 .

[0116] Depend on Figure 8 It can be seen that the mycelium is whitest and densest at a temperature of 28℃, and its growth rate is the fastest at (5.46±0.10) mm·d. -1 The growth rate at these temperatures differed significantly from that at other temperatures. The slowest mycelial growth rate was observed at 20℃, at (3.56±0.07) mm·d. -1 The mycelial growth rate did not differ significantly when the culture temperature was 22℃, 24℃, 26℃ and 30℃.

[0117] 4.5 pH Single-Factor Screening Test The initial pH of the culture medium I was adjusted with 1.0 mol / L hydrochloric acid and 1.0 mol / L sodium hydroxide solution, and six initial pH gradients were set: 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0.

[0118] The effects of different pH conditions on mycelial growth rate are shown in the figure. Figure 9 .

[0119] Depend on Figure 9 It can be seen that the mycelium is relatively dense at all pH levels, and the mycelial growth rate is fastest at pH 8.0, which is (5.17±0.08) mm·d. -1 The mycelial growth rate was significantly different from other pH conditions; the slowest growth rate was observed at pH 5.0, which was (4.73 ± 0.13) mm·d. -1 The differences were not significant at pH values ​​of 6.0, 7.0, 9.0, and 10.0.

[0120] Ultimately, the inventors determined the optimal formula and conditions as follows: sucrose as the carbon source, tryptone as the nitrogen source, calcium chloride as the inorganic salt, 28°C as the temperature, and pH 8 as the pH value.

[0121] VI. Preliminary Screening (Small-scale Test) 1. Number of strains tested The *Pleurotus ostreatus* was cultivated using bag substrate. Following the requirements of GB / T 21125-2007 (Technical Specifications for the Breeding of Edible Fungi), the small-scale preliminary screening experiment was designed with 12 bags per group and 3 replicates. Each bag contained 1.5 kg of dry substrate. Solid spawn was inoculated at both ends of the substrate log, with 30 g inoculated per bag. The mushrooms were grown using a simple stacking cultivation method.

[0122] Each group consists of 12 bags, with 360g of solid spawn per group and 18.0kg of dry substrate per bag. The experiment is repeated 3 times, requiring a total of 1080g of solid spawn (L6926) and 54.0kg of dry substrate per bag.

[0123] 2. Results and Analysis Preliminary screening of mushroom morphology and yield of *Pleurotus ostreatus* strain L6926 in a small-scale trial is shown in the figure. Figure 10 And Table 4.

[0124] Table 4. Statistics on fruiting yield and traits of *Pleurotus ostreatus* strain L6926 in small-scale preliminary screening (M±SD)

[0125] Note: "M±SD" represents the mean ± standard deviation. Five bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured. The average value of 30 fruiting bodies was calculated by randomly selecting fruiting bodies.

[0126] From Table 4 and Figure 10 It can be seen that the fruiting condition of the small-scale preliminary screening test group of *Tricholoma matsutake* strain L6926 was good. The yield results showed that: Group 1 yielded 1568.33 g / bag, Group 2 yielded 1533.00 g / bag, and Group 3 yielded 1512.67 g / bag, with an average yield of 1538.00 g / bag. The experimental results showed that the fruiting bodies were uniform, with round or fan-shaped caps, a deep yellow surface, and wavy edges. The average cap diameter was 42.62 mm, and the flesh was relatively thick. The stipes were cylindrical and lateral, with an average length of 54.43 mm and a diameter of 7.55 mm. The average number of fruiting bodies per cluster was 36.17. The average fresh weight of the total fruiting bodies per stump was 1538.00 g, and the biological efficiency was 102.53%.

[0127] VII. Small-scale secondary screening 1. Number of trials The *Pleurotus ostreatus* was cultivated using bag substrate. Following the requirements of GB / T 21125-2007 Technical Specifications for the Breeding of Edible Fungi, the small-scale re-screening experiment was designed with 30 bags per group and three replicates. Each bag contained 1.5 kg of dry substrate. Solid spawn was inoculated at both ends of the substrate log, with 30 g inoculated per bag. The mushrooms were grown using a simple stacking cultivation method.

[0128] Each group consists of 30 bags, with 900g of solid spawn per group and 45.0kg of dry substrate per bag. There are 3 replicates, requiring a total of 2.7kg of solid spawn (L6926) and 135.0kg of dry substrate per bag.

[0129] 2. Results and Analysis The characteristics and yield of mushroom spawn L6926 obtained from small-scale secondary screening are shown in the figure. Figure 11 See Table 5.

[0130] Table 5. Statistics on fruiting yield and traits of *Pleurotus ostreatus* strain L6926 in small-scale re-screening (M±SD)

[0131] Note: "M±SD" represents the mean ± standard deviation. Five bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured. The average value of 30 fruiting bodies was calculated by randomly selecting fruiting bodies.

[0132] From Table 5 and Figure 11 It can be seen that the fruiting condition of the initial screening test group of *Pleurotus ostreatus* strain L6926 was good. The yield results showed that: Group 1 yielded 1529.90 g / bag, Group 2 yielded 1545.20 g / bag, and Group 3 yielded 1549.40 g / bag, with an average yield of 1541.50 g / bag. The experimental results showed that the fruiting bodies were uniform, with round or fan-shaped caps, a deep yellow surface, wavy edges, an average cap diameter of 40.51 mm, and relatively thick flesh; the stipes were cylindrical and lateral, with an average length of 49.24 mm and a diameter of 6.57 mm; the average number of fruiting bodies per cluster was 36.50; the average fresh weight of the total fruiting bodies per stump was 1541.50 g, and the biological efficiency was 102.76%.

[0133] VIII. Intermediate Trial 1. Number of trials The *Pleurotus ostreatus* was cultivated using bag substrate, following the requirements of GB / T 21125-2007 Technical Specifications for the Breeding of Edible Fungi. The intermediate trial design involved 1200 bags per group, with 3 replicates. Each bag contained 1.5 kg of dry substrate, and solid spawn was inoculated at both ends of the substrate log, with 30 g inoculated per bag. The mushrooms were grown using a simple stacking cultivation method.

[0134] Each group consists of 1200 bags, with 36 kg of solid spawn per group and 1800 kg of dry substrate per group. The experiment is repeated three times, requiring a total of 108 kg of solid spawn (L6926) and 5400 kg of dry substrate per bag.

[0135] 2. Results and Analysis Intermediate test results for the fruiting characteristics and yield of *Pleurotus ostreatus* strain L6926 are shown below. Figure 12 See Table 6.

[0136] Table 6. Statistics on fruiting yield and traits of *Pleurotus ostreatus* strain L6926 in intermediate trials (M±SD)

[0137] Note: "M±SD" represents the mean ± standard deviation. Yield was measured using random sampling (three points), with 50 bags at each sampling point. Yield was determined by the average weight of the fruiting body per bag. For fruiting body characteristics, 50 fruiting bodies were randomly selected from each group to calculate the average value.

[0138] From Table 6 and Figure 12 It can be seen that the fruiting bodies of the *Pleurotus ostreatus* spawn L6926 exhibited good fruiting characteristics in the intermediate test, with uniform fruiting and high yield, reaching a fresh weight of 1673.30 g / bag. The caps are round or fan-shaped, with a deep yellow surface and wavy edges. The average cap diameter is 40.85 mm, and the flesh is relatively thick. The stipes are cylindrical and lateral, with an average length of 48.74 mm and a diameter of 6.28 mm. The average number of fruiting bodies per cluster is 36.78. The average fresh weight of the total fruiting bodies per stipe is 1673.30 g, with a biological efficiency of 111.55%. From initial screening and secondary screening to the intermediate test, due to increasingly mature artificial domestication and cultivation management techniques, the first flush of mushrooms can be harvested approximately 23 days after inoculation, and the yield steadily increases. This indicates that the *Pleurotus ostreatus* spawn L6926 has good stability, a short fruiting cycle, high fruiting rate, and high yield.

[0139] IX. Demonstration Cultivation (Investigation and Analysis of Uniformity and Stability) 1. Demonstration Experiment Design The *Pleurotus ostreatus* spawn L6926 was cultivated using bag substrate. Following the requirements of GB / T 21125-2007 (Technical Specifications for the Breeding of Edible Fungi), the demonstration cultivation experiment was designed with 10,000 bags of substrate (three replicates per site, approximately 3,600 bags per replicate). Each bag contained 1.5 kg of dry substrate. Solid spawn was inoculated at both ends of the substrate log, with 30 g inoculated per bag, resulting in an inoculation amount of 108 kg per group and 5,400 kg of dry substrate per group. The market-isolated *Pleurotus ostreatus* spawn 6925 served as a control. The same batch of spawn and substrate bags were used at each site to ensure consistent spawn quantity and demonstration cultivation management techniques.

[0140] 2. Selection of demonstration sites Songming County, Kunming City, Yunnan Province; Yimen County, Yuxi City, Yunnan Province; Luliang County, Qujing City, Yunnan Province.

[0141] 3. Selection of cultivation site The cultivation site should be a solar greenhouse, a sunny, sheltered, dry, hygienic location that is close to a water source.

[0142] 4. Observation and Measurement Items Different groups at the demonstration site conducted separate surveys and data collection. The main observations focused on the key characteristics of the tested strains, and yield was recorded. Yields were also tallied after harvest. Simultaneously, a qualified testing company was commissioned to determine the content of major nutrients. 5. Results and Analysis The fruiting results of the demonstration cultivation are shown in the figure. Figure 13 , Figure 14 Tables 7, 8, 9, and 10.

[0143] Table 7. Yield and cultivation cycle of *Pleurotus ostreatus* strain L6926 in demonstration cultivation.

[0144] Table 8. Main agronomic traits of *Pleurotus ostreatus* strain L6926 in demonstration cultivation.

[0145] Table 9. Yield and cultivation cycle of *Pleurotus ostreatus* strain 6925 in demonstration cultivation.

[0146] Table 10. Main agronomic traits of *Tricholoma elm* strain 6925 in demonstration cultivation.

[0147] The results of demonstration cultivation in three locations over two years (2023-2024) showed that compared to the control 'Elm Yellow Mushroom' strain 6925, 'Elm Yellow Mushroom' strain L6926 has larger fruiting bodies with longer stipes, stronger aroma, and higher biological conversion rate; a shorter incubation period, averaging 23.83 days; and a more concentrated fruiting period, from late March to early October each year, one month shorter than the control. The cap is deep yellow to dark yellow with a wavy edge, white flesh, and an average cap diameter of 40.70 mm; the stipe is white, with an average length of 48.60 mm and an average diameter of 6.26 mm. The cap is concave to 13.70 mm. The average fresh weight per bag is 1722.0 g, and the biological conversion rate is 114.80%. Compared to the control 6925 elm oyster mushroom spawn, the fruiting bodies of elm oyster mushroom spawn L6926 exhibited better overall fruiting performance, brighter color, shorter cultivation period, and higher biological conversion rate, making it a suitable new variety of elm oyster mushroom. The fruiting bodies showed pale yellow to whitish-yellow caps with smooth edges, pure white flesh, and an average cap diameter of 40.29 mm. The stipes were shorter, thicker, and white, with an average length of 44.24 mm and an average diameter of 6.46 mm. The cap depression was 5.12 mm. The average fresh weight per stick was 1514.63 g / bag, with a biological conversion rate of 101.10%. Therefore, compared to the control 6925 elm oyster mushroom spawn, spawn L6926 showed better overall fruiting performance, more vibrant color, shorter cultivation period, and higher biological conversion rate.

[0148] The spawn produced from the L6926 elm yellow mushroom spawn has robust mycelium, rapid mycelial growth, low contamination, strong resistance to contamination, short cultivation cycle, and stable characteristics. The cap is deep yellow to dark yellow, nearly round; the stipe is relatively thin, pure white, and solid to soft inside; it has a rich aroma and delicious taste, high content of amino acids, calcium, and polysaccharides, and is rich in nutrients. Compared with the control, it has higher yield and more active ingredients, and has high application value.

[0149] Specificity: Compared to the control strain 6925, *Pleurotus ostreatus* strain L6926 exhibits larger caps, longer stipes, stronger aroma, and higher biological conversion rate. It also has a shorter incubation period, averaging 23.83 days, and a more concentrated fruiting period, from late March to early October each year, one month shorter than the control. The caps are deep yellow to dark yellow with wavy edges and a medium degree of indentation. The flesh is pure white, with an average cap diameter of 40.70 mm. The stipes are white, with an average length of 48.60 mm and an average diameter of 6.26 mm. The average fresh weight per bag is 1722.07 g, and the biological conversion rate is 114.80%. The fruiting bodies of the control *Agaricus elm* spawn 6925, grown in bags, are light yellow to yellowish-white with smooth edges and minimal indentation. The flesh is pure white, and the average cap diameter is 40.29 mm. The stipes are shorter, thicker, and white, with an average length of 44.24 mm and an average diameter of 6.46 mm. The average fresh weight per stipe is 1514.63 g / bag, and the biological conversion rate is 101.10%. Therefore, compared to the control spawn 6925, *Agaricus elm* spawn L6926 exhibits better overall fruiting performance, more vibrant color, a shorter cultivation cycle, and a higher biological conversion rate, making it a suitable new variety of *Agaricus elm*. Using four pairs of SSR primers (L6926SSR-01, L6926SSR-02, L6926SSR-03, and L6926SSR-04), *Agaricus elm* spawn L6926 can be distinguished from the control spawn 6925.

[0150] Consistency: Through multiple cultivation demonstrations and observations over one year, the L6926 strain of *Pleurotus ostreatus* exhibits consistency.

[0151] Stability: The L6926 strain of *Pleurotus ostreatus* exhibits consistency and, in principle, is stable.

[0152] 10. High-temperature and low-temperature resistance identification and Cladosporium anthropophilum resistance identification Determination of mycelial growth rate at high and low temperatures: *Pleurotus ostreatus* spawn L6926 and control CK (*Pleurotus ostreatus* spawn 6925) grown on PDA medium were perforated using a 0.5 cm punch and placed on new PDA culture dishes for a temperature gradient growth experiment. Eight culture temperatures were set: 5℃, 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, and 40℃, with three replicates for each temperature. The growth rate was measured after a certain incubation period.

[0153] Method for detecting Cladosporium resistance: First, the *Pleurotus ostreatus* strain L6926, the control strain 6925, and the Cladosporium strain, grown on PDA medium, were perforated using a 0.5 cm diameter punch. Then, they were placed on new PDA culture dishes, with one side containing the *Pleurotus ostreatus* strain and the other side inoculated with the mold. Each resistance experiment was performed in triplicate, and growth was observed after a set time.

[0154] Table 11. Mycelial growth rate of *Tricholoma matsutake* strains L6926 and 6925 (unit: cm / d)

[0155] Results of the low-temperature resistance test: As shown in Table 11, after culturing for 7 days at temperatures of 5℃, 10℃, 15℃, and 20℃, the mycelial growth rate of *Agaricus elm* strain L6926 was generally slightly faster than that of the control strain 6925, and the mycelium was generally denser. After culturing for 7 days at low temperatures of 10℃, 15℃, and 20℃, it can be seen that the mycelial germination and growth of *Agaricus elm* strain L6926 were stronger than those of strain 6925. The results indicate that the growth patterns of *Agaricus elm* strains L6926 and 6925 are consistent under low-temperature conditions, with little difference in growth rate, and *Agaricus elm* strain L6926 germinates more easily at low temperatures.

[0156] Table 12. Mycelial growth rate of *Pleurotus ostreatus* spawn L6926 and spawn 6925 (unit: cm / d)

[0157] Results of the high-temperature resistance test: As shown in Table 12, after 7 days of cultivation at temperatures of 25℃, 30℃, 35℃, and 40℃, the mycelial growth rate of *Agaricus elm* strain L6926 was generally faster than that of the control strain 6925. However, with increasing temperature, the mycelial growth slowed significantly, and some mycelia exhibited yellowing or even stopped growing altogether. At 25℃, 30℃, and 35℃, *Agaricus elm* strain L6926 showed faster mycelial growth than strain 6925. With increasing temperature, the growth rate of both strains slowed significantly, and the growth trends were consistent. At 35℃, both strains began to show abnormal growth, with mycelial growth becoming slow. When the temperature reached 40℃, neither mycelium germinated.

[0158] Based on the results of the low-temperature resistance test, it can be found that the optimal temperature for mycelial culture of both *Pleurotus ostreatus* strain L6926 and the control strain 6925 is between 25℃ and 30℃. Therefore, both *Pleurotus ostreatus* strains L6926 and 6925 are medium- to high-temperature fungi, and the results of the high-temperature resistance test are consistent. *Pleurotus ostreatus* strain L6926 has a wider temperature adaptability than *Pleurotus ostreatus* strain 6925, and is suitable for widespread cultivation under more temperature conditions.

[0159] Table 13. Inhibition rates of *Pleurotus ostreatus* strains L6926 and 6925 against *Cladosporium*.

[0160] Among them, R CK R1: Radius of normally growing contaminating bacteria; R2: Radius of contaminating bacteria in a two-point confrontation experiment.

[0161] Result: From Figure 15 As shown in Table 13, in the antibacterial test of *Pleurotus ostreatus* against *Cladosporium*, the inhibition rate of *Pleurotus ostreatus* strain L6926 was higher than that of the control strain 6925, indicating that strain L6926 has stronger resistance to contamination. In seed production, it exhibits low contamination rate, rapid substrate consumption, and is less susceptible to contamination by other fungi, demonstrating strong resistance to contamination. Furthermore, in multiple batches of cultivation trials, it showed low rates of contamination and pest / disease occurrence. Therefore, the experiment concludes that *Pleurotus ostreatus* strain L6926 has strong disease resistance.

[0162] The *Pleurotus ostreatus* spawn L6926 exhibits strong mycelial growth, rapid germination, and a fast growth rate. It shows a higher inhibition rate against *Cladosporium* than the control and demonstrates strong resistance to adverse conditions. The mycelium can grow normally between 10-30℃. After 7 days of cultivation at 10-20℃ and 25-35℃, the mycelial growth rate of *Pleurotus ostreatus* spawn L6926 was faster and the mycelium was denser than that of the control spawn 6925. The optimal fruiting temperature was 22-28℃, compared to 20-26℃ for the control; the optimal fruiting temperature was 24-26℃, compared to 22-24℃ for the control.

[0163] XI. Morphological Observation of Fruiting Entities Morphological observation of the fruiting body, such as Figure 16 As shown.

[0164] XII. Quality Analysis Report of Pleurotus ostreatus strain L6926 Statistical analysis of nutrients and functional components of *Pleurotus ostreatus* strain L6926 and control strain 6925: Table 14. Statistical analysis of the components of *Pleurotus ostreatus* strain L6926 and control strain 6925.

[0165] Note: *Essential amino acids In 2024, the fruiting bodies of *Pleurotus ostreatus* spawn L6926 and 6925, after being dried during their cultivation and maturation period, were sent to the Guangdong Provincial Center for Microbiology Analysis and Testing for analysis. Table 14 shows that the content of various amino acids in spawn L6926 was higher than that in spawn 6925; the calcium content of spawn L6926 was 2.21 × 10⁻⁶. 2 mg / kg, higher than the 1.08×10 mg / kg of *Pleurotus ostreatus* strain 6925. 2 The protein, iron, zinc, and fat content of the *Pleurotus ostreatus* strain 6925 was lower than that of *Pleurotus ostreatus* strain 6925; the differences in ash, crude fiber, and crude polysaccharide content were not significant.

[0166] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A strain of *Pleurotus ostreatus* (elm yellow mushroom) Pleurotus citrinopileatus L6926, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on May 27, 2025, with accession number GDMCC No: 66424.

2. The *Pleurotus ostreatus* strain according to claim 1 ( Pleurotus citrinopileatus The artificial cultivation method of L6926 is characterized by, Includes the following steps: Step (1), strain preparation: Take the mother strain obtained from the tissue isolation of *Pleurotus ostreatus* L6926, rejuvenate it with mother strain culture medium, and then inoculate it into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, transfer the original strain to the cultivation container for culture. After the mycelium has filled the cultivation container, finally transfer the cultivation strain into the cultivation bag and culture until the mycelium has filled the bag. Step (2), cultivation management: Place the cultivation bags obtained in step (1) in the greenhouse for stacking cultivation or soil covering cultivation; Step (3), harvesting of fruiting bodies: harvest when the fruiting bodies are seven or eight parts mature, dark yellow in color, and before they release spores; The mother culture medium comprises the following components by weight: 198-202 parts potato, 18-20 parts sucrose, 2-3 parts tryptone, 0.39-0.41 parts calcium chloride, 16-17 parts agar, and 998-1002 parts water; The original culture medium in the original culture bottle includes the following components by weight: 59-61 parts buckwheat, 19-21 parts broadleaf tree sawdust, 16-18 parts wheat bran, 1-2 parts sugar, 1-2 parts gypsum, and 1-2 parts lime, with a water content of 55-60%. The culture medium in the cultivar container comprises the following components by weight: 10-15 parts buckwheat, 38-42 parts broadleaf tree sawdust, 24-29 parts cottonseed hulls, 10-16 parts wheat bran, 1-2 parts sugar, 1-2 parts gypsum, and 1-2 parts lime, with a moisture content of 55-60%. The culture medium in the cultivation bag includes the following components by weight: 56-58 parts broadleaf tree sawdust, 18-22 parts cottonseed hulls, 19-21 parts wheat bran, 0.98-1.02 parts lime, and 0.98-1.02 parts gypsum.

3. The artificial cultivation method according to claim 2, characterized in that: When using the mother culture medium for rejuvenation, it is incubated in the dark at a temperature of 22-24℃; When using the original culture medium, it is cultured in the dark at a temperature of 20-25℃; When culturing in containers, the seed culture is carried out in the dark at a temperature of 20-25℃; When culturing in cultivation bags, it is carried out in the dark at a temperature of 22-26℃.

4. The artificial cultivation method according to claim 2, characterized in that, In step (1), cultivation can begin when nodular mycelial protrusions appear inside the cultivation bag and are grayish-white.

5. The artificial cultivation method according to claim 2, characterized in that, In step (2), when stacking the mushroom logs for cultivation, replace the cotton-free cover with an open wide-mouth ring as the mushroom outlet, or directly remove the cotton-free cover and open the bag. After opening, the mushroom buds will appear 2-3 days later. Do not spray water when the mushroom buds first appear. Wait until more than 70% of the mushroom buds turn golden yellow before spraying to increase humidity and keep the relative humidity of the air at 85%-90%.

6. The artificial cultivation method according to claim 2, characterized in that, In step (2), when covering the soil for cultivation, first spread quicklime on the surface of the greenhouse soil, 100-150 kg per mu, and till the soil 2-3 times. Then break the surface soil into clods until the soil particle diameter is less than 3 cm. Remove the mushroom bags from the mushroom sticks and place them horizontally on the ground, with a spacing of 29-31 cm between rows. Cover with 2-3 cm of soil and sprinkle 0.9-1.1 cm thick pine needles on the soil surface. After planting, water and keep the soil moisture at 20%-30%.

7. The artificial cultivation method according to claim 2, characterized in that, In step (2), after cultivation, during the growth of the fruiting body, the temperature is controlled at 18-26℃; direct sunlight is avoided, and the light intensity is controlled at 1500-2500 lux, while the carbon dioxide concentration is controlled below 0.2%; and the relative humidity of the air is maintained at 85%-95%.

Images