Recombinant lactic acid bacteria expressing truncated hexon protein of avian adenovirus, construction method and application thereof

Abstract

The application discloses a recombinant lactic acid bacteria expressing a truncated Hexon protein of avian adenovirus and a construction method and application thereof, and belongs to the technical field of biological medicines.The application first constructs the recombinant lactic acid bacteria strains pNZ8149-FAdV4DeltaHexon / NZ3900 and pNZ8149-FAdV8bDeltaHexon / NZ3900 expressing the truncated Hexon protein of avian adenovirus, and through SDS-PAGE and Western blotting analysis, it is shown that the exogenous genes FAdV4-DeltaHexon and FAdV-8bDeltaHexon are successfully expressed in the lactic acid lactobacillus, and have reactivity.The 1-day-old chicks are orally immunized, and the result shows that the oral recombinant lactic acid bacteria can not only cause humoral immunity and cellular immunity, but also can locally produce mucosal immunity.The result shows that the recombinant constitutive lactic acid bacteria prepared in the application can enhance the immunity of the chicks.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to recombinant lactic acid bacteria expressing truncated avian adenovirus Hexon protein, their construction methods, and applications. Background Technology

[0002] Avian adenovirus (FAdV) belongs to the family Adenoviridae and the genus Avianadenovirus. It is a non-enveloped, double-stranded DNA virus. Based on serotype differences, avian adenoviruses can be divided into several serotypes, among which group I avian adenovirus type 4 (FAdV-4) and type 8b (FAdV-8b) are important pathogens affecting the poultry industry in recent years. FAdV-4 mainly causes hepatitis-pericardial effusion syndrome in chickens, with symptoms such as depression, decreased feed intake, enlarged and hemorrhagic liver, and pericardial effusion, which can lead to high mortality in severe cases. FAdV-8b is often associated with inclusion body hepatitis, causing liver damage, decreased production performance, and secondary infections in chicks. Because the cross-protective effect between different serotypes of avian adenovirus is limited, single-serotype vaccines often cannot simultaneously meet the comprehensive prevention and control needs of FAdV-4 and FAdV-8b. Therefore, developing safe and effective vaccines that cover multiple major circulating serotypes is of great significance.

[0003] Currently, the prevention and control of avian adenovirus diseases mainly relies on inactivated vaccines, live attenuated vaccines, subunit vaccines, or genetically engineered vaccines. While inactivated vaccines generally have good safety profiles, they typically require high antigen doses and adjuvants, resulting in high production costs. Furthermore, they primarily induce humoral immunity, providing insufficient local immune stimulation to mucosal sites such as the intestines and respiratory tract. Live attenuated vaccines exhibit strong immunogenicity but pose potential risks regarding virulence reversion, genetic stability, and biosafety. Subunit vaccines generally have high safety profiles, but their purification processes are complex, and the antigen's residence time in the body is short, often requiring adjuvants or multiple immunizations to achieve optimal protective efficacy. Therefore, existing avian adenovirus vaccines still have certain shortcomings in terms of safety, production costs, mucosal immune induction capabilities, and comprehensive multi-serotype control.

[0004] Lactic acid bacteria are a class of probiotics widely recognized for their good safety profile. They can survive or colonize briefly in the animal's gastrointestinal tract and interact with the intestinal mucosal immune system. Using lactic acid bacteria as a carrier for exogenous antigen delivery allows antigen proteins to enter the digestive tract orally, stimulating gut-associated lymphoid tissue and inducing local mucosal and systemic immune responses. Compared to traditional injectable vaccines, recombinant lactic acid bacteria oral vaccines offer advantages such as convenient administration, minimal stress, suitability for herd immunity, low antigen purification requirements, and the ability to induce secretory IgA, thus showing promising application prospects in the field of animal viral disease control.

[0005] Hexon proteins are one of the major capsid proteins of avian adenoviruses, containing important antigenic epitopes related to viral serotype, host immune recognition, and neutralizing antibody production, making them important targets in avian adenovirus vaccine antigen design. However, the large molecular weight of intact hexon proteins may increase the metabolic burden on lactic acid bacteria and affect expression stability and antigen presentation efficiency when expressed directly. Expressing truncated hexon proteins (ΔHexons) that retain major immunological epitopes helps reduce the expression burden while preserving some immunoreactivity and immunogenicity. However, the hexon protein sequences and antigenic epitopes differ among different serotypes of avian adenoviruses. Inappropriate truncation may lead to the loss of key neutralizing epitopes or serotype-specific epitopes, resulting in antigen fragments that, while recognizable by antibodies, may fail to induce effective protective immunity. Therefore, the selection of ΔHexon antigen fragments requires striking a balance between preserving major immunological epitopes, maintaining antigen conformation, reducing expression burden, and improving immune recognition efficiency after oral delivery. Summary of the Invention

[0006] In view of the above-mentioned prior art, the purpose of this invention is to provide a recombinant lactic acid bacteria expressing a truncated Hexon protein of avian adenovirus, its construction method and application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a recombinant lactic acid bacteria expressing a truncated Hexon protein of avian adenovirus, wherein the recombinant lactic acid bacteria is based on Lactococcus lactis as the starting strain, and the gene encoding the truncated Hexon protein is exogenously transferred into the starting strain. The truncated Hexon protein is any one of the proteins shown below (A1)-(A3): (A1) FAdV-4ΔHexon protein, the amino acid sequence of which is shown in SEQ ID NO.1; (A2) FAdV-8bΔHexon protein, the amino acid sequence of which is shown in SEQ ID NO.2; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1) or (A2).

[0008] Because full-length Hexon proteins have a large molecular weight and complex spatial structure, direct heterologous expression in *Lactococcus lactis* often leads to problems such as low expression efficiency, abnormal protein folding, and increased metabolic burden on the host bacteria. Therefore, this invention, while retaining the main immunogenic regions and key antigenic epitopes of the Hexon protein, specifically truncates it to obtain a ΔHexon protein that is more suitable for the *Lactococcus lactis* expression system.

[0009] The ΔHexon protein of this invention is not randomly truncated, but designed to balance protein expression efficiency and immunogenicity. Both FAdV-4ΔHexon and FAdV-8bΔHexon proteins were stably expressed in *Lactococcus lactis* and specifically recognized by their respective antibodies, indicating that they retain good antigenic reactivity. Furthermore, the growth curves of the recombinant *Lactococcus lactis* showed that the growth patterns of the recombinant strain and the empty vector strain were essentially consistent, suggesting that the truncated ΔHexon protein reduced the adverse effects of exogenous protein expression on host bacterial growth and improved expression stability.

[0010] Among the aforementioned proteins, protein tags can be fused to their N-terminus and / or C-terminus as needed for expression, detection, tracing, or purification. The protein tag refers to a polypeptide or protein fragment co-expressed with the target protein through in vitro DNA recombination technology, which can assist in the expression identification, localization analysis, immunoassay, affinity purification, or stability improvement of the target protein. The protein tags include, but are not limited to, one or more of the following: Flag tag, His tag, MBP tag, HA tag, Myc tag, GST tag, and SUMO tag.

[0011] Based on the correspondence of the genetic code, those skilled in the art can deduce the nucleotide sequence encoding the ΔHexon protein from its amino acid sequence. Furthermore, the nucleotide sequence can be codon-optimized by considering the codon bias of the host cell to improve its expression efficiency in the host cell. The encoding gene can be linked to an expression vector in an expressible manner, or it can be integrated into the host bacterial genome through homologous recombination, gene editing, or other molecular biology methods, thereby achieving the expression of the ΔHexon protein or its fusion protein.

[0012] Preferably, the lactococcus lactis is Lactococcus lactis NZ3900; Lactococcus lactis NZ3900, as a lactic acid bacteria expression host, has good food safety and biocompatibility, does not produce endotoxins, and is suitable as an oral antigen delivery vector; this strain can be used in conjunction with food-grade expression vectors such as pNZ8149, and transformants can be screened through the lacF food-grade selection marker, avoiding or reducing the risk of using antibiotic resistance markers in live bacterial vaccines.

[0013] A second aspect of the present invention provides a method for constructing recombinant lactic acid bacteria expressing the above-mentioned truncated avian adenovirus Hexon protein, comprising the following steps: (1) Homologous recombination of the truncated Hexon protein coding gene and the linearized pNZ8149 vector gene fragment was performed using seamless cloning technology to obtain a recombinant plasmid; (2) The recombinant plasmid was transferred into Lactococcus lactis to construct a recombinant lactic acid bacteria expressing truncated Hexon protein of avian adenovirus.

[0014] Preferably, in step (1), the gene encoding the truncated Hexon protein is selected from... FAdV-4ΔHexon Gene or FAdV-8bΔHexon Genes; the stated FAdV-4ΔHexon The nucleotide sequence of the gene is shown in SEQ ID NO.3. FAdV-8bΔHexon The nucleotide sequence of the gene is shown in SEQ ID NO.4.

[0015] In some preferred embodiments of the present invention, specific amplification FAdV-4ΔHexon The nucleotide sequences of the primer pairs for the gene are shown in SEQ ID NO. 5 and SEQ ID NO. 6; specific amplification. FAdV-8bΔHexon The nucleotide sequences of the primer pairs for the gene are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0016] Preferably, in step (1), the nucleotide sequences of the primer pairs for specifically amplifying the pNZ8149 vector gene fragment are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0017] In some preferred embodiments of the present invention, the constructed recombinant lactic acid bacteria include: recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 expressing FAdV-4ΔHexon protein and recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 expressing FAdV-8bΔHexon protein.

[0018] A third aspect of the present invention provides the use of the above-described recombinant lactic acid bacteria in the preparation of a vaccine against group I avian adenovirus infection.

[0019] In the above applications, the vaccine belongs to a recombinant microbial vector vaccine that uses lactic acid bacteria as an antigen delivery carrier, and more particularly to a recombinant lactic acid bacteria mucosal vaccine that can be administered via the mucosal route. This type of vaccine induces specific humoral, cellular, and / or mucosal immune responses in the body by expressing protective antigens derived from the target pathogen in lactic acid bacteria, enabling the lactic acid bacteria to deliver or display these exogenous antigens after entering the mucosal sites of the body.

[0020] In the above applications, the anti-group I avian adenovirus infection refers to infection with anti-group I adenovirus serotype 4 and / or 8b.

[0021] Preferably, the vaccine against Group I avian adenovirus infection is composed of recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 expressing FAdV-4ΔHexon protein and recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 expressing FAdV-8bΔHexon protein; the live bacteria ratio of recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 to recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 is 1:1. Using these two recombinant lactic acid bacteria in combination, compared to using them alone, can synergistically improve the prevention and control effect against avian adenovirus infection.

[0022] The beneficial effects of this invention are: (1) The present invention truncates the Hexon proteins of FADV-4 and FADV-8b to obtain FADV4-ΔHexon and FADV8b-ΔHexon antigen fragments. While retaining the main immunogenic epitopes, it is beneficial to reduce the difficulty of full-length protein expression and the adverse effects of exogenous protein expression on host bacterial growth, thereby improving the feasibility and stability of exogenous antigen expression in Lactococcus lactis.

[0023] (2) This invention uses *Lactococcus lactis* as an exogenous antigen delivery vector to construct recombinant lactic acid bacteria strains pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900. SDS-PAGE and Western blotting verified that FAdV4-ΔHexon and FAdV8b-ΔHexon could be successfully expressed in *Lactococcus lactis*, and the expression products exhibited good reactivity, indicating that they can be recognized by specific antibodies and have the basis for application as immunogenic antigens. Immunizing 1-day-old chicks orally avoids the stress response and cumbersome operation problems associated with traditional injection immunization, offering advantages such as simple immunization method, high safety, and suitability for large-scale application.

[0024] (3) Combining recombinant lactic acid bacteria strains pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 can synergistically improve the prevention and control effect against FADV-4 and FADV-8b co-infection. Attached Figure Description

[0025] Figure 1 : FAdV4-ΔHexon Gene, FAdV-8bΔHexon Gel electrophoresis image of gene amplification products; in the image, A represents... FAdV4-ΔHexonGel electrophoresis image of gene amplification products; Lane M: DL 2000 DNA molecular weight standard; Lane 1: negative control; Lane 2: ... FAdV4-ΔHexon Gene; B is FAdV-8bΔHexon Gel electrophoresis image of gene amplification products; Lane M: DL 2000 DNA molecular weight standard; Lane 1: negative control; Lane 3: FAdV-8bΔHexon Gene.

[0026] Figure 2 Gel electrophoresis image of PCR amplification products of pNZ8149 plasmid; in the image, lane M: DL 2000 DNA molecular weight standard; lane 1: negative control; lane 2: pNZ8149 plasmid.

[0027] Figure 3 Western blotting was used to detect protein expression in recombinant lactic acid bacteria. In the figure, A represents the protein expression of pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria, and M represents the protein molecular weight standard. Lane 1: pNZ8149 / NZ3900, Lane 2: FADV-4ΔHexon whole protein, Lane 3: supernatant of pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria. B represents the protein expression of pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria, and M represents the protein molecular weight standard. Lane 4: FADV-8bΔHexon whole protein, Lane 5: supernatant of pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria, and Lane 6: pNZ8149 / NZ3900.

[0028] Figure 4 : Growth curves of recombinant lactic acid bacteria; In the figure, A: Growth curve of pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria; B: Growth curve of pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria.

[0029] Figure 5 : Specific antibody IgG level after oral immunization with recombinant lactic acid bacteria; In the figure, A: Detection result of specific antibody IgG level after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Detection result of specific antibody IgG level after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900.

[0030] Figure 6: Specific antibody sIgA level after oral immunization with recombinant lactic acid bacteria; In the figure, A: Detection result of intestinal mucosal antibody sIgA level after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Detection result of intestinal mucosal antibody sIgA level after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900.

[0031] Figure 7 : Specific antibody IgG level after oral immunization with recombinant lactic acid bacteria challenge; In the figure, A: Detection result of specific antibody IgG level after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900 challenge; B: Detection result of specific antibody IgG level after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900 challenge.

[0032] Figure 8 : Specific antibody sIgA level after oral immunization with recombinant lactic acid bacteria; In the figure, A: Detection result of intestinal mucosal antibody sIgA level after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Detection result of intestinal mucosal antibody sIgA level after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900.

[0033] Figure 9 : Changes in body weight after oral immunization with recombinant lactic acid bacteria; In the figure, A: Changes in body weight after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Changes in body weight after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900.

[0034] Figure 10 Survival rate after oral immunization with recombinant lactic acid bacteria; In the figure, A: Survival rate after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Survival rate after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900.

[0035] Figure 11 : Detection results of diseased organs after oral immunization with recombinant lactic acid bacteria; In the figure, A: Detection results of diseased organs such as pericardial effusion, heart, liver, and spleen after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Detection results of diseased organs such as pericardial effusion, heart, liver, and spleen after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900.

[0036] Figure 12: Histopathological examination results after oral immunization with recombinant lactic acid bacteria; In the figure, A: Histopathological examination results of the heart, liver, spleen, and kidney after oral immunization with pNZ8149-FAdV4ΔHexon / NZ3900; B: Histopathological examination results of the heart, liver, spleen, and kidney after oral immunization with pNZ8149-FAdV8bΔHexon / NZ3900. Detailed Implementation

[0037] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0038] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0039] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: The FAdV-4 strain is described in the journal article “Sun J, Zhang Y, Gao S, Yang J, Tang Y, DiaoY. Pathogenicity of fowl adenovirus serotype 4 (FAdV-4) in chickens. InfectGenet Evol. 2019 Nov;75:104017. doi: 10.1016 / j.meegid.2019.104017. Epub 2019Aug 26. PMID: 31465858.”. The FAdV-8b strain is described in the journal article “Wu B, He D, Wei F, Zhao S, Tang W, Zhu Y, Yu S, Zhou Q, Wei L, Tang Y, Diao Y. Isolation and pathogenicity of a fowl adenovirus 8b (FAdV-8b) strain in Cherry Valleyducks. Avian Pathol. 2025 Apr;54(2):223-233. doi: 10.1080 / 03079457.2024.2409461. Epub 2024 Oct 10. PMID: 39319407.”. The public can obtain the above strain from the applicant for replication of this experiment.

[0040] DH5α competent cells and pMD18-T cloning vector were purchased from Beijing Angyu Biotechnology Co., Ltd.; NZ3900 Lactococcus lactis and pNZ8149 inducible plasmid were purchased from Hangzhou Baosai Plasmid and Strains Resource Co., Ltd.; homologous recombination kit was purchased from Jiangsu Bestway Biotechnology Co., Ltd.; SDS-PAGE and Western blot reagents were purchased from Xinsaimei Biotechnology Co., Ltd.; goat anti-mouse IgG-HRP was purchased from Solarbio Science & Technology Co., Ltd.; PCR primers were synthesized by BGI Genomics Co., Ltd.

[0041] The RNA extraction kit was TransGen, cat. no. EC301-11; the RNA reverse transcription kit was HiFiScript cDNA Synthesis Kit (KANGWEI, cat. no. CW2569M); the DNA gel extraction kit was Omega Bio-tek, cat. no. D2500-02; the plasmid extraction kit was TIANprep Mini Plasmid Kit (TIANGEN, cat. no. DP105); the seamless cloning kit was purchased from Beijing TransGen Biotech Co., Ltd.; and the chicken secretory immunoglobulin A (sIgA) enzyme-linked immunosorbent assay kit was purchased from Shanghai Enzyme Linked Biotechnology Co., Ltd.

[0042] GM17 liquid culture medium: M17 broth with 0.5% glucose added.

[0043] GM17 solid medium: M17 agar with 0.5% glucose added.

[0044] Example 1: Preparation of recombinant plasmids pNZ8149-FAdV4ΔHexon and pNZ8149-FAdV8bΔHexon (1) Primer design and synthesis Using CE Design software FAdV-4ΔHexon Gene, FAdV-8bΔHexon Homologous arm primers were designed from the pNZ8149 plasmid gene and after it was confirmed to be correct. The primer sequences were synthesized by BGI Genomics, and the primer pair sequences are shown below: FAdV-4(ΔHexon)-F: 5'- gaggcactcaccatgAATGTCTACCAACACGAGCAC-3'; (SEQ ID NO.5) FAdV-4(ΔHexon)-R: 5'-atgatgatgatgatgTCGCAGGAAGTCGTAGTGGAA-3'. (SEQ ID NO.6) FAdV-8b(ΔHexon-F): 5'- gaggcactcaccatgGCCTTCTTTAACAACTGGATCGA -3'; (SEQ ID NO.7) FAdV-8b(ΔHexon)-R: 5'- atgatgatgatgatgGTTGGTGGCCATCTGAATCAAATA -3'. (SEQ ID NO.8) pNZ8149-F 5'- CATCATCATCATCATCAT TAAGAGCTCAAGCTTTCTTGAACC -3'; (SEQ ID NO.9) pNZ8149-R 5'-CATGGGTGAGTGCCTCCTTATAAT-3'. (SEQ ID NO.10) Note: Lowercase bases are homologous arm sequences, uppercase italic bases are His tags, and uppercase bases are specific primers.

[0045] (2) Cloning of gene fragments from the FAdV-4ΔHexon, FAdV-8bΔHexon, and pNZ8149 vectors Using the extracted total DNA of viral FAdV-4 and FAdV-8b and pNZ8149 plasmid as templates, the following methods were employed: FAdV-4Δ Hexon Gene, FAdV-8bΔHexon PCR amplification was performed using gene-specific primers for the pNZ8149 plasmid gene, followed by 1% agarose gel electrophoresis imaging analysis. The results are as follows: Figure 1 and Figure 2 As shown.

[0046] The PCR products were identified by 1% agarose gel electrophoresis and then purified by gel recovery. The recovered products were stored at -20°C for later use.

[0047] (3) Synthesis and identification of recombinant expression vectors pNZ8149-FAdV4ΔHexon and pNZ8149-FAdV8bΔHexon The two groups of ΔHexon clones were homologously recombined with linearized plasmids using the pEASY®-Uni SeamLess Cloning and Assembly Kit. The reaction was carried out in a metal bath at 50°C for 10 min. After the reaction, all enzyme digestion products were added to a 1% agarose gel for nucleic acid electrophoresis. The target bands were excised, purified, and sequenced to obtain the recombinant expression vectors pNZ8149-FAdV4ΔHexon and pNZ8149-FAdV8bΔHexon. The products were recovered and stored at -20°C for later use.

[0048] Example 2: Preparation of recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 The recombinant expression plasmids pNZ8149-FAdV4ΔHexon and pNZ8149-FAdV8bΔHexon prepared in Example 1 were electroporated into Lactococcus lactis NZ3900. After electroporation, 1 mL of pre-cooled GM17 liquid medium was immediately added after removing the electroporation cup, mixed by pipetting, and then transferred to a clean 1.5 mL centrifuge tube and incubated at 30°C for 120 min.

[0049] After incubation, centrifuge at room temperature at 4000 r / min for 5 min. Discard 1.0 mL of supernatant, resuspend the bacteria in approximately 100 μL of the remaining medium, and transfer the resuspended culture to GM17 solid medium containing 2.0 μg / mL erythromycin. Spread evenly using a sterile spreader and incubate upright at 37°C for 1 h, then inverted at 30°C for 72–96 h. Pick single colonies and incubate in 5 mL of GM17 liquid medium at 30°C for 12 h. Extract total DNA from the recombinant lactic acid bacteria using the above-described method for extracting Gram-positive bacterial DNA, and perform PCR identification using pNZ8149-F / R universal primers.

[0050] pNZ8149-F: 5'- AGAAAGGGGAAACGACG-3'; (SEQ ID NO. 11) pNZ8149-R: 5'-CCTCCAACCGAAATAG-3'. (SEQ ID NO.12) After amplifying the vector gene using pNZ8149-F / R universal primers, sequencing was performed and compared with the target gene fragment to check whether the target gene fragment was present, thus avoiding the transformation into an empty vector.

[0051] After evaluation, the transfer was successfully completed. FAdV-4ΔHexon Gene, FAdV-8bΔHexon The gene-positive recombinant lactic acid bacteria strains were named pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900, respectively.

[0052] Example 3: Investigation of protein expression in recombinant lactic acid bacteria 1. Protein expression: The recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 constructed in Example 2 were added to 10 mL of GM17 liquid culture medium at a ratio of 1:100 and incubated statically at 30°C for 12 h. The inducing agent Nisin was diluted to 20 ng / mL with sterile physiological saline and added to the cultured recombinant lactic acid bacteria solution at a ratio of 10 μL of Nisin (20 ng / mL) per 10 mL of bacterial solution. The culture was then induced at 30°C for 5 h.

[0053] Lactococcus lactis pNZ8149 / NZ3900 transformed with the empty pNZ8149 vector was treated under the same conditions as described above as a control.

[0054] 2. Western blotting analysis of the expression product; The induced samples were centrifuged at 12000 r / min for 15 min at 4°C, the supernatant was discarded, and the bacterial cells were washed with PBS buffer, followed by centrifugation. This washing process was repeated twice. The cells were then sonicated at 200 W for 2 s followed by a 3 s interval, for a total of 15 min. SDS gel loading buffer was added in the correct proportion, and the mixture was boiled for 10 min. Protein electrophoresis was performed on a 12% SDS-PAGE gel. After SDS-PAGE, the proteins on the gel were transferred to an NC membrane and blocked overnight at 4°C in 5% skim milk. The membrane was washed three times with TBST for 5 min each time. Mouse anti-His monoclonal antibody was used as the primary antibody, and the membrane was incubated overnight at 4°C. TBST was added again for 5 min each time. HRP-labeled goat anti-mouse IgG was added as the secondary antibody, and the membrane was incubated at room temperature for 1 h. TPST was added for 5 min each time. Using a highly sensitive ECL chemiluminescent reagent for light-shielded color development, specific protein expression was found in recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 at approximately 69 kDa and 70 kDa, respectively. Figure 3 ).

[0055] Example 4: Growth performance study of recombinant lactic acid bacteria The recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900, pNZ8149-FAdV8bΔHexon / NZ3900, and NZ3900 lactococci were cultured under the same conditions, and the OD of the bacterial culture was measured every 1 hour. 600 .

[0056] The results showed that both recombinant Lactococcus lactis strains and wild-type Lactococcus lactis strain NZ3900 reached a plateau phase after 8 hours. Figure 4 Furthermore, their growth patterns were almost identical, indicating that recombinant lactic acid bacteria can grow normally.

[0057] Example 5: Evaluation of the immunomodulatory effect of recombinant lactic acid bacteria after oral administration to SPF chickens 1. Test method: One-day-old SPF chickens were randomly divided into three groups of 30 birds each: a PBS blank control group, a pNZ8149 / NZ3900 empty vector control group, and a pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria experimental group. Immunization was performed at one day of age according to the following schedule: First, administer oral administration of empty vector bacteria or recombinant lactic acid bacteria for 3 consecutive days, with a daily oral dose of 1×10⁻⁶. 11 CFU / animal; the blank control group was replaced with PBS, 100 µL / animal orally; Second vaccination: Five days after the first vaccination, a second vaccination is administered, consisting of oral empty vector bacteria or recombinant lactic acid bacteria, for three consecutive days at a daily dose of 1×10⁻⁶. 11 CFU / animal; the blank control group was replaced with PBS, 100 µL / animal orally; Three-stage vaccination: Five days after the second-stage vaccination, administer the third-stage vaccination, orally administering either empty vector bacteria or recombinant lactic acid bacteria for three consecutive days, with a daily oral dose of 1×10⁻⁶. 11 CFU / animal; the blank control group was replaced with PBS, 100 µL / animal orally.

[0058] Samples were collected on the 5th day after the end of each immunization cycle to detect IgG antibody levels and sIgA antibody levels; after the third immunization, the intestinal flora of the flock was tested on the 25th day of age.

[0059] The recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 were treated using the same method described above.

[0060] 2. Test Results: Serum was separated, and the level of specific IgG antibodies in the serum was detected using a laboratory-established indirect protein ELISA method. The results showed that after the first immunization, the serum antibody level in the recombinant bacterial experimental group immunized with pNZ8149-FAdV4ΔHexon / NZ3900 was significantly higher than that in the empty vector control group immunized with pNZ8149 / NZ3900 and the blank control group using PBS as a substitute (P<0.01). After three immunizations, the serum antibody level in the recombinant bacterial experimental group continued to increase, showing extremely significant differences compared to the two control groups (P<0.001). Meanwhile, no significant change was observed in the serum antibody level between the pNZ8149 / NZ3900 empty vector group and the PBS blank control group (P>0.05). Figure 5 (A) Serum antibody levels in the pNZ8149-FAdV8bΔHexon / NZ3900 recombinant bacterial group showed the same and continuous increase after three immunizations, with extremely significant differences compared to the two control groups (P<0.001). Figure 5 (B) In summary, both recombinant lactic acid bacteria strains constructed in this invention can induce humoral immunity and high levels of specific antibodies in the body.

[0061] The results of ELISA detection of intestinal mucosa-specific sIgA antibodies are as follows: 5 days after the third immunization, the intestinal mucosa sIgA antibody levels in the pNZ8149-FAdV4ΔHexon / NZ3900 recombinant bacterial group showed a highly significant difference (P<0.001). Figure 6 (A); The levels of intestinal mucosal sIgA antibodies in the recombinant bacterial group immunized with pNZ8149-FAdV8bΔHexon / NZ3900 recombinant bacteria were also significantly different compared with the pNZ8149 / NZ3900 empty vector control group and the PBS blank control group (P<0.01). Figure 6 (B) In contrast, there was no significant difference in intestinal mucosal sIgA expression levels between the pNZ8149 / NZ3900 empty vector group control group and the PBS blank control group (P>0.05). Furthermore, after three immunization cycles, the intestinal mucosal sIgA antibody levels in both recombinant bacterial groups were significantly higher than those in the control group, especially after the second immunization, when the intestinal mucosal sIgA expression level reached its highest value, demonstrating that the two recombinant bacteria can induce high levels of mucosal immunity in the body.

[0062] The results of the study on the effects of immunization with recombinant lactic acid bacteria on the intestinal flora of healthy chicken flocks (Table 1) showed that the number of Escherichia coli in the intestinal flora of chickens in the pNZ8149-FAdV4ΔHexon / NZ3900 recombinant bacteria group was significantly reduced compared with the pNZ8149 / NZ3900 empty vector control group and the PBS blank control group (P < 0.01); there was also a significant difference in the number of Escherichia coli in the intestinal flora of the pNZ8149-FAdV8bΔHexon / NZ3900 recombinant bacteria group compared with the empty vector control group and the blank control group (P < 0.05), with a decrease in the number; the number of Bifidobacteria in the intestines of chickens in both recombinant bacteria groups was significantly increased compared with the PBS blank control group (P < 0.01); regardless of whether empty vector bacteria or two recombinant bacteria were used for immunization, a certain level of lactic acid bacteria could be detected in the intestines of chicken flocks.

[0063] Table 1: Results of intestinal flora analysis in chicken flocks According to the experimental results, the recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 can indeed increase the number of beneficial bacteria in the intestines of chicks and play a certain inhibitory role against pathogenic bacteria in the intestines to maintain the balance of intestinal flora.

[0064] Example 6: Evaluation of Immunoprotective Effect of Oral Recombinant Lactic Acid Bacteria in SPF Chickens 1. Test method: One-day-old SPF chickens were randomly divided into three groups of 30 birds each: a PBS blank control group, a pNZ8149 / NZ3900 empty vector control group, and a pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria experimental group. Immunization was performed at one day of age, following the same immunization procedure as in Example 5.

[0065] On day 26, SPF chickens in all groups were injected intramuscularly with FADV-4 at a dose of 10. 6 ELD50 per animal. Ten days after infection, the incidence and mortality of each group were observed and weight changes were recorded. Samples were collected at 3, 5 and 10 dpi after challenge to detect antibody levels, observe pathological changes in each tissue, and preserve relevant organs to make pathological sections.

[0066] The immunoprotective evaluation of pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria is the same as the above protocol, with FADV-8b as the inoculated virus.

[0067] 2. Test Results: After the oral immunization program was completed, the corresponding groups were artificially infected, and the serum levels of specific antibodies in chickens from each group were measured at 3, 5, and 10 days post-infection. The results showed ( Figure 7 After challenge, serum antibody levels increased in all groups, including the recombinant bacteria experimental group, the empty vector bacteria control group, and the blank control group. The antibody response in the pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant bacteria group was more rapid and the antibody level remained at a higher level. At 10 dpi, the antibody level in the pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant lactic acid bacteria group was > that in the pNZ8149 / NZ3900 empty vector bacteria control group > that in the PBS blank control group. The test results after challenge showed that the antibody levels of the two control groups were very similar, with no significant difference (P>0.05). The serum antibody level of the pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant bacteria group was significantly different from that of the two control groups (P<0.01). Comparative analysis of the groups infected with serotype 8b showed that the serum antibody levels of each group also showed a continuous increase. The pNZ8149-FAdV-8bΔHexon / NZ3900 recombinant bacteria group could also produce higher levels of specific antibodies in a shorter time, and there was a relatively significant difference in antibody level between it and the two control groups (P<0.05).

[0068] After artificial infection with FAdV-4, the results of intestinal mucosa-specific sIgA antibody level detection in each group showed ( Figure 8 There was no significant difference in antibody levels between the two control groups (P>0.05), but the pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant bacterial group showed a highly significant difference compared to the two control groups (P<0.01). After challenge, the recombinant bacterial group exhibited higher levels of specific sIgA antibodies in the intestinal mucosa, which remained above 4000 ng / mL even at 10 dpi. In contrast, the corresponding specific sIgA antibody levels in the two control groups were lower and showed a decreasing trend. Upon intramuscular injection of a lethal dose of FADV-8b strain, the pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant bacterial group responded rapidly, with a sustained increase in sIgA antibody levels throughout the infection cycle. The sIgA antibody levels in the jejunal lavage fluid were significantly higher than those in the two control groups (P<0.01).

[0069] Daily weight records after artificial infection show ( Figure 9The PBS blank control group and the pNZ8149 / NZ3900 empty vector control group showed slow weight gain, which was greatly affected. The pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant lactic acid bacteria group showed better weight gain, and the weight gain trend was basically the same as that of the unchallenged group, with the smallest difference in daily weight gain compared to the unchallenged group. The pNZ8149-FAdV-8bΔHexon / NZ3900 recombinant lactic acid bacteria group showed similar performance to the pNZ8149-FAdV-4ΔHexon / NZ3900 recombinant lactic acid bacteria group, and weight gain could be quickly restored after the peak of mortality.

[0070] In the three groups infected with the FAdV-4 strain, chickens in the blank control group and the empty vector control group showed depression, significantly reduced feed intake, loose and watery feces mixed with yellow-green liquid, and began to die at 2-3 dpi after artificial infection. At 5 dpi, the symptoms of chickens in both control groups worsened, with severe depression, lying still, ruffled feathers, reduced or no appetite, yellow-green unformed watery feces, and a large amount of dirt on the feathers around the vent. The mortality rate also reached its peak. In contrast, chickens immunized with pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria showed better condition, with only a few deaths in the early stage of infection, a significantly higher survival rate in the early stage, and a faster recovery from the disease in the later stage of infection, with a significant improvement in survival rate. Figure 10 (A); In the three groups infected with the FAdV-8b strain, the same changes were observed: the unimmunized blank control group and the empty vector control group had more severe disease, with ruffled feathers, pale and rough combs, and higher mortality rates. The groups immunized with pNZ8149-FAdV-8ΔHexon / NZ3900 recombinant lactic acid bacteria experienced later mortality, and the final survival rate reached 70%. Figure 10 (B)

[0071] Five days after artificial infection of experimental animals with the FAdV-4 strain, similar lesions were observed in both the unimmunized blank control group and the control group immunized with pNZ8149 / NZ3900. Typical pathological changes of hepatitis-pericardial effusion syndrome (HHS) were observed, specifically: upon opening the pleural cavity, a certain amount of pale yellow effusion was observed in the pericardial cavity; the pericardium was also thickened; the liver showed varying degrees of enlargement, blunt and rounded edges, a fragile texture, and petechiae of varying sizes; the spleen was hemorrhagic and enlarged with a highly tense capsule; the kidneys showed severe hemorrhage, with the capsule being difficult to detach from the underlying tissue due to swelling and tension; and the kidneys were soft and fragile. The group immunized with pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria also showed milder lesions, specifically: reduced hepatomegaly and hemorrhage, no obvious necrotic foci, milder splenomegaly and hemorrhage, no pericardial effusion, and minimal cardiac enlargement. Figure 11 (A); Anatomical studies of chickens infected with the FAdV-8b strain showed that the lesions in the blank control group and the empty vector control group were more severe and similar, mainly manifested as liver swelling leading to tense capsular tissue, blunt and rounded edges, fragile and brittle texture, and visually observed jaundice, with an overall yellowish-brown color or severe hemorrhage, and subcapsular hemorrhages and petechiae. The lesions in the group immunized with pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria were milder, specifically manifested as less severe liver hemorrhage and jaundice, and less pronounced swelling. Figure 11 (B)

[0072] Observation and comparison of HE-stained pathological tissue sections (400×) showed that in the unimmunized group, multiple organs showed histopathological damage after infection with the strain: myocardial fiber gaps were obvious, interstitial multifocal inflammatory cell infiltration was observed, some striated muscle structures were unclear and broken, and myocardial tissue was separated and disordered by proliferative growths; hepatocytes were vacuolated and underwent severe fatty degeneration, hepatic cord-sinusoidal arrangement was blurred, and homogeneous red-stained inclusion bodies appeared in hepatocyte nuclei; the intrinsic white and red pulp compartmentalization of the spleen was completely destroyed, and lymphocytes were diffusely infiltrated; renal tubular epithelial cells were edematous and degenerated, and renal tubules were dilated. The lesion severity of the pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 recombinant bacterial immunized sections were reduced to varying degrees, with a small amount of interstitial edema and hepatocyte edema. Overall, the structures observed under the organ microscope tended to be normal, clearly arranged, and well-defined. Figure 12 ).

[0073] Example 7: Immunoprotective effect of recombinant lactic acid bacteria combination against FAdV-4 / FAdV-8b co-infection 1. Test method: One-day-old SPF chickens were randomly divided into four groups of 30 birds each: a control group containing pNZ8149 / NZ3900 empty vector bacteria, an experimental group containing pNZ8149-FAdV4ΔHexon / NZ3900 recombinant lactic acid bacteria, an experimental group containing pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria, and a combination group containing pNZ8149-FAdV4ΔHexon / NZ3900 + pNZ8149-FAdV8bΔHexon / NZ3900 recombinant lactic acid bacteria. Immunization was performed at one day of age, following the same immunization schedule as in Example 5. The oral dose of lactic acid bacteria was 1×10⁻⁶. 11 CFU / each; In the recombinant lactic acid bacteria combination pNZ8149-FAdV4ΔHexon / NZ3900 + pNZ8149-FAdV8bΔHexon / NZ3900, the live count of pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 is 1:1.

[0074] On day 26, SPF chickens in each group were injected intramuscularly with a combination of FADV-4 and FADV-8b. The dosage of FADV-4 and FADV-8b was 1×10⁻⁶. 6 ELD50 / animal. The incidence and mortality of each group were observed 10 days after infection, and the survival rate was calculated.

[0075] 2. Test Results: The survival rates of each treatment group 10 days after infection are shown in Table 2.

[0076] Table 2: Survival rates of each treatment group The results showed that the combined use of recombinant lactic acid bacteria strains pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 could synergistically improve the prevention and control of FADV-4 and FADV-8b co-infection.

[0077] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of recombinant lactic acid bacteria combinations in the preparation of vaccines against Group I avian adenovirus infection, characterized in that, The anti-group I avian adenovirus infection was a combined infection of anti-group I adenovirus serotypes 4 and 8b. The recombinant lactic acid bacteria combination consists of recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 expressing FAdV-4ΔHexon protein and recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 expressing FAdV-8bΔHexon protein; the live bacteria ratio of recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 to recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 is 1:

1. The recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 is based on Lactococcus lactis NZ3900 as the starting strain, into which the gene encoding the FADV-4ΔHexon protein is exogenously transferred. The amino acid sequence of the FADV-4ΔHexon protein is shown in SEQ ID NO.

1. The recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 is based on Lactococcus lactis NZ3900 as the starting strain, into which the gene encoding the FADV-8bΔHexon protein is exogenously transferred. The amino acid sequence of the FADV-8bΔHexon protein is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The construction methods of the recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 and pNZ8149-FAdV8bΔHexon / NZ3900 include the following steps: (1) The coding genes of FAdV-4ΔHexon protein and FAdV-8bΔHexon protein were homologously recombinated with the linearized pNZ8149 vector gene fragment by seamless cloning technology to obtain recombinant plasmids; (2) The recombinant plasmid was transferred into Lactococcus lactis to construct recombinant lactic acid bacteria pNZ8149-FAdV4ΔHexon / NZ3900 expressing FADV-4ΔHexon protein and recombinant lactic acid bacteria pNZ8149-FAdV8bΔHexon / NZ3900 expressing FADV-8bΔHexon protein, respectively.

3. The application according to claim 2, characterized in that, In step (1), the nucleotide sequence of the gene encoding the FAdV-4ΔHexon protein is shown in SEQ ID NO.3, and the nucleotide sequence of the gene encoding the FAdV-8bΔHexon protein is shown in SEQ ID NO.

4.

4. The application according to claim 2, characterized in that, In step (1), the nucleotide sequences of the primer pairs that specifically amplify the gene encoding the FAdV-4ΔHexon protein are shown in SEQ ID NO.5 and SEQ ID NO.6; The nucleotide sequences of the primer pairs for specifically amplifying the gene encoding the FAdV-8bΔHexon protein are shown in SEQ ID NO.7 and SEQ ID NO.

8. The nucleotide sequences of the primer pairs for specifically amplifying the pNZ8149 vector gene fragment are shown in SEQ ID NO.9 and SEQ ID NO.10.

Images