A method for directed induction of iPSCs to chordamesoderm cells

Abstract

The present application relates to a method for the directional induction of iPSCs into chordamesoderm cells, which realizes the precise navigation of the differentiation path from the pluripotent state to chordamesoderm cells by precisely simulating the embryonic development signal pathway and combining innovative cell tracking tools, thereby significantly improving the differentiation yield and purity of iNCs.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a method for directionally inducing induced pluripotent stem cells (iPSCs) to differentiate into notochord cells. Background Technology

[0002] Intervertebral disc degeneration (IDD) is the leading cause of low back pain (LBP). Currently, treatments for IDD primarily include conservative and surgical approaches, but these methods cannot reverse or repair the degenerated disc tissue, resulting in limited clinical efficacy.

[0003] Studies have shown that the development and progression of intervertebral disc degeneration are closely related to the reduction and loss of function of nucleus pulposus (NP) cells. Notochordal cells (NCs), as the developmental progenitors of NP cells, gradually disappear after birth, and this disappearance is considered a key initiating factor in intervertebral disc degeneration. Notochordal cells not only protect NP cells through paracrine functions and inhibit abnormal ingrowth of blood vessels and nerves within the intervertebral disc to maintain homeostasis, but they can also induce mesenchymal stem cells (MSCs) to differentiate into NP-like cells. Therefore, obtaining functional notochordal cells is considered one of the core strategies for achieving intervertebral disc regeneration and a key technology for promoting the translation of this field from basic research to clinical applications.

[0004] Human pluripotent stem cells (hPSCs), including human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs), are considered the ideal starting cell source (seed cells) for preparing notochord cells due to their unlimited self-renewal capacity and multi-lineage differentiation potential. Currently, the academic community has conducted extensive research in this area, mainly following the principle of "mimicking embryonic development," attempting to guide hPSCs to differentiate along the pathway of "pluripotent state → protostome / mesoderm → axial mesoderm (notochord)" through the regulation of exogenous signaling molecules. In recent years, this field has made several important advances, particularly in the more precise understanding of the molecular mechanisms of notochord development. In terms of applied research, in 2019 Sheyn et al. reported the therapeutic potential of notochordal cells (iNCs) differentiated from hiPSCs in a large animal (pig) model of intervertebral disc degeneration (Sheyn, D. et al., Human iPSCs can be differentiated into notochordal cells that reduce intervertebral disc degeneration in a porcine model). Theranostics 2019, 9 (25), 7506-7524). This study confirmed that implanted iNCs can survive in a degenerative environment and express notochord markers (such as Noto, Brachyury, and Keratin18 / 19), while preventing further intervertebral disc degeneration, demonstrating their feasibility as a cell therapy. These works collectively establish the overall feasibility of obtaining functional notochord cells in vitro via hPSCs.

[0005] At the molecular level, research has clearly established that the Noto gene is a core transcription factor specific to notochord cells. Its expression is activated by FOXA2 and Brachyury, and once established, it in turn inhibits paraaxial mesoderm fate, thereby maintaining the cellular characteristics of the axial mesoderm (notochord). Therefore, Noto expression is widely regarded as one of the most critical markers for the successful orientation of hiPSCs to the notochord lineage.

[0006] Despite its promising prospects, existing technologies still face a series of fundamental shortcomings when translating into clinical applications, posing a significant challenge to the efficient, stable, and reproducible preparation of high-purity functional notochord cells. These fundamental shortcomings include at least the following aspects.

[0007] (1) Low differentiation efficiency and prominent product heterogeneity: The purity and efficiency of cell populations produced by existing differentiation protocols are far from meeting the threshold for clinical application. The differentiation efficiency of hiPSCs into NCs usually fluctuates between 0.1% and 18.4%, and this low efficiency and high variability is a common bottleneck in the current field. The fundamental reason is that embryonic development is a precise process that proceeds simultaneously across multiple lineages, while traditional differentiation protocols often use relatively crude and fixed-time combinations of factors, which are difficult to accurately replicate the in vivo microenvironment. For example, even if the latest timing findings are referenced (such as WNT / FGF activating first and BMP inhibiting later), simply applying this "formula" in two-dimensional planar culture still cannot prevent cells from spontaneously differentiating into non-target lineages such as paraaxial mesoderm, lateral mesoderm, and even endoderm, resulting in a highly heterogeneous mixture of cells as the final product.

[0008] (2) Lack of dynamic and precise intervention in signaling pathway regulation: Most current protocols still rely on the "presence" or "fixed concentration" of small molecule inhibitors / activators, with insufficient "quantitative" regulation and "dynamic change" mimicry of signaling pathway intensity. For example, BMP signaling plays a role in early mesoderm induction and late lateral plate mesoderm differentiation, and the timing, intensity, and duration of its inhibition require extremely precise control. Existing technologies often fail to achieve this dynamic and adjustable microenvironment manipulation, resulting in uncontrollable differentiation processes and poor batch-to-batch reproducibility.

[0009] (3) Lack of an effective real-time monitoring and closed-loop feedback system: This is another key bottleneck restricting the optimization of differentiation processes. Currently, the evaluation of differentiation effects mainly relies on endpoint destructive detection (such as qPCR, flow cytometry, and immunofluorescence), which cannot monitor cell fate transitions in a "real-time, in situ, and visualized" manner during differentiation. Although Noto is known to be a core biomarker, conventional techniques cannot show "when Noto begins to be expressed," "which cells express it first," or "how the expression level changes dynamically." This makes process development like a "black box" operation, where initial parameters can only be adjusted in reverse based on the final result, resulting in long optimization cycles, high costs, and difficulty in capturing the time window of key differentiation events. A Japanese research team introduced AI combined with time-lapse photography for single-cell tracking in motor neuron differentiation, improving efficiency to 80%, which highlights the potential of real-time monitoring technology to improve differentiation efficiency. However, in the field of notochord cell differentiation, such intelligent real-time monitoring and feedback systems have not yet been reported.

[0010] In summary, the core shortcomings of existing technologies are: due to insufficient spatiotemporal precision in regulating developmental signal networks and the lack of real-time monitoring methods for the differentiation process, differentiation paths are deviated, resulting in low output efficiency, high heterogeneity, and poor reproducibility.

[0011] Therefore, developing an efficient, stable, controllable, and real-time monitorable method for the directional induction of iPSCs into notochord cells is a technical problem that urgently needs to be solved in this field. Summary of the Invention

[0012] In a first aspect of the present invention, a method for directional induction of iPSCs into notochord cells is provided, characterized by comprising the following steps: Step 1: iPSCs were cultured in basal differentiation medium. The Nodal signaling pathway was activated sequentially in the first time period, and the FGF and Wnt signaling pathways were activated in the second time period, while the PI3K signaling pathway was inhibited, thereby inducing the iPSCs to differentiate into protosthenic cells. Step 2: The original cells are re-seeded in the basal differentiation medium and cultured. By activating the Wnt signaling pathway and the FGF signaling pathway and inhibiting the BMP signaling pathway in the third time period, the fate of the original cells is guided to the axial mesoderm to obtain axial mesoderm progenitor cells. Step 3: The axial mesodermal progenitor cells are cultured in a maturation medium to further express mature notochord cell markers, thereby obtaining the notochord cells.

[0013] Preferably, the activation of the Nodal signaling pathway in step 1 is achieved by adding Activin A to the basal differentiation medium; the activation of the FGF and Wnt signaling pathways in steps 1 and 2 is achieved by adding FGF2 and CHIR99021 to the basal differentiation medium; the inhibition of the PI3K signaling pathway is achieved by adding PIK90 to the basal differentiation medium; and the inhibition of the BMP signaling pathway is achieved by adding LDN-193189 to the basal differentiation medium.

[0014] More preferably, the concentration of Activin A is 35-45 ng / mL; the concentration of FGF2 is 15-25 ng / mL; the concentration of CHIR99021 is 3-7 μM; the concentration of PIK90 is 80-120 nM; and the concentration of LDN-193189 is 0.1-0.3 μM.

[0015] More preferably, the concentration of Activin A is 40 ng / mL; the concentration of FGF2 is 20 ng / mL; the concentration of CHIR99021 is 5 μM; the concentration of PIK90 is 100 nM; and the concentration of LDN-193189 is 0.2 μM.

[0016] Preferably, the first time period is 20-28 hours, the second time period is 20-28 hours, and the third time period is 64-80 hours; More preferably, the first time period is 24 hours, the second time period is 24 hours, and the third time period is 72 hours; Preferably, the basal differentiation medium comprises: DMEM / F12 medium: Neurobasal medium = 1:1, N2 supplement = 1×, B27 supplement = 1×, GlutaMAX = 1×, NEAA = 1×, β-ME = 0.1mM.

[0017] Preferably, the maturation culture medium comprises: N2, B27, DMEM / F12 + ITS culture medium.

[0018] Preferably, the iPSCs are human iPSCs.

[0019] In a second aspect of the invention, there is provided the use of notochord cells for preparing a medicament for treating intervertebral disc degeneration, wherein the notochord cells are notochord cells obtained by a directional induction method according to the first aspect of the invention.

[0020] This invention addresses the shortcomings of existing technologies by precisely simulating embryonic developmental signaling pathways and combining them with innovative cell tracking tools to achieve precise navigation of the differentiation path from pluripotent state to notochord cells, thereby significantly improving the differentiation yield and purity of iNCs. This study achieves real-time monitoring by constructing an endogenous Noto reporter system and optimizes a dynamic and precise signal regulation scheme based on this system, thus overcoming existing bottlenecks. Compared with existing technologies, the technical solution provided by this invention achieves significantly better results than expected.

[0021] (1) The technical solution provided by this invention has extremely high differentiation efficiency and purity: This invention achieves real-time and precise monitoring of the differentiation process by constructing a NOTO-eGFP reporter cell line, and optimizes a staged precise signal regulation strategy accordingly. Using the optimized scheme of this invention, by day 7 of differentiation, a cell population with up to 80.7% co-expression of CD24 and GFP (Noto-driven) can be stably obtained, i.e., high-purity induced notochord cells (iNCs). This yield is significantly higher than the general level reported in the literature (0.1%-18.4%), representing a breakthrough.

[0022] (2) The technical solution provided by the present invention is controllable and highly reproducible: Based on the Noto reporting system, the differentiation process is visualized and quantifiable, which facilitates real-time evaluation and adjustment of differentiation conditions, significantly improving the controllability and reproducibility of the differentiation scheme, and laying the foundation for standardized production and clinical application.

[0023] (3) The cells obtained according to the technical solution provided by the present invention have clear functions: the iNCs obtained at the end not only highly express early markers Noto, Brachyury and FOXA2, but also express mature notochord cell / nucleus pulposus cell related markers such as keratin (Keratin 8 / 18 / 19) and SOX family transcription factors (SOX5 / 6 / 9), indicating that they have good functional characteristics.

[0024] (4) Providing high-quality cell source for the treatment of intervertebral disc degeneration: This invention solves the core problems of the scarcity and uneven quality of notochord cells, and provides an efficient and reliable cell preparation method for intervertebral disc regeneration therapy, disease model construction and drug screening based on notochord cells, which has great clinical application potential and industrial value. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This invention demonstrates the method (a) for guiding stem cell differentiation towards a single notochord developmental pathway, as provided by the present invention, and constructs... NOTO The protocol for the -eGFP reporter gene cell line (b), and the results of screening and identification of positive clones (c, d).

[0027] Figure 2 The results of qPCR detection of Nodal gene expression level (a) and KEGG analysis results (b, c) are shown.

[0028] Figure 3 The optimized experimental scheme (a) for the original induction conditions and the differentiation effect (b) are shown.

[0029] Figure 4 The PCR results (pluripotency, PS) of the optimal group after optimization of axial mesodermal induction conditions are shown.

[0030] Figure 5 The PCR results of the optimal group (axial mesoderm, paraaxial mesoderm, and lateral mesoderm) after optimization of axial mesoderm induction conditions are shown.

[0031] Figure 6 The results of the temporal representation analysis of key biomarkers are shown.

[0032] Figure 7 The results of validation of markers for mature notochord cells are shown. Detailed Implementation

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in books like the Molecular Cloning Laboratory Manual published by Cold Spring Harbor, or according to the manufacturer's recommendations. Unless otherwise specified, all reagents used can be purchased commercially.

[0034] The following specific embodiments embody the differentiation logic of this invention, which integrates "activation pathways + inhibition pathways." This means it not only focuses on how to activate the target lineage but also emphasizes how to actively block undesirable cell fates through signal inhibition, thereby guiding stem cell differentiation towards a single notochord developmental pathway. For example... Figure 1 As shown in a, the desired activation pathway involves the gradual differentiation of iPSCs into primitive streaks (PS), axial mesoderm, and finally iNCs, while blocking undesirable cell fates, including endoderm, ectoderm, paraxial mesoderm, and lateral mesoderm.

[0035] Example 1: Construction of NOTO-eGFP reporter gene hiPSCs cell line This embodiment utilizes a CRISPR / Cas9-mediated gene knock-in strategy to construct a gene knock-in gene in a human iPSC cell line. NOTO -eGFP reporter gene cell lines were used to monitor the differentiation process of notochord cells. The hiPSCs described in this invention were derived from peripheral blood cells of healthy volunteers. A non-integrative reprogramming method was employed, using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, USA), to induce and reprogram peripheral blood cells into hiPSCs. Verification of pluripotency marker expression, in vitro differentiation capacity, and karyotype stability showed that the obtained cell lines possessed typical pluripotent stem cell characteristics. Cells at passages 23 to 25 were selected as seed cells for subsequent notochord cell differentiation. The gene knock-in strategy in this experiment involved directionally inserting a transgenic fragment fused with a 2A self-cleaving peptide and an EGFP sequence upstream of the NOTO gene stop codon, maintaining the same reading frame as the NOTO coding sequence. For specific implementation details, please refer to [reference needed]. Figure 1 b in the text and the following content.

[0036] 1. gRNA and donor vector design and construction: Two guide RNAs targeting the upstream sequence of the NOTO gene stop codon were designed and synthesized. The sequence of gRNA1 is TCAGCCGTCCACTCCTGACT (SEQ ID NO. 1), and the sequence of gRNA2 is ACGGCTGAAGACTGGGACAG (SEQ ID NO. 2). They were cloned into their respective expression vectors (VB230420-1051yqd and VB230420-1720urq, VectorBuilder, USA). Simultaneously, the donor vector VB230420-1051 (VB230421-1135sbx, VectorBuilder, USA) was constructed, containing: a 5' homologous arm, a 3' homologous arm, and the sequence encoding the 2A self-cleaving peptide and eGFP located between the homologous arms, as well as a LoxP-Puro-LoxP selection cassette.

[0037] 2. Cell Transfection and Selection: Human iPSCs were seeded in Matrigel-coated 6-well plates and cultured in mTesR plus medium (stemcell, USA). When cell confluence reached 60-70%, the above-mentioned gRNA expression vector and donor vector were co-transfected into the cells using Lipofectamine 3000 (Thermo Fisher). Selection was performed using 0.6 μg / mL puromycin (Thermo Fisher) until resistant clones appeared.

[0038] 3. Screening and Identification of Positive Clones: After puromycin screening, single clones were picked and amplified in 96-well plates. Genomic DNA was extracted from each single clone, and PCR amplification was performed using primers spanning homologous arms (forward: TCTGATCTCTGCCCACTCTCCA (SEQ ID NO. 3); reverse: GTCCTCGATGTTGTGGCGGATC (SEQ ID NO. 4). The PCR products were subjected to agarose gel electrophoresis, and positive clones with correct eGFP integration were preliminarily screened based on the size of the amplified fragments. Figure 1 (c) The PCR products of the selected positive clones were subjected to Sanger sequencing to verify the accuracy of the sequences. The results showed that all 12 selected single clones correctly inserted the target sequence (c). Figure 1 (d in the text)

[0039] 4. Removal of the selection marker cassette: To obtain a pure reporter cell line, correctly identified positive clones were transiently transfected with AAV-mediated Cre recombinase (Clontech) to remove the puromycin selection marker cassette between the LoxP sites. Single clones were obtained by limiting dilution and identified by PCR, ultimately yielding a NOTO-eGFP reporter gene hiPSCs cell line without the selection marker.

[0040] Example 2: Optimization of Nodal signaling pathway activation conditions and duration of action This embodiment aims to simulate cell migration events during the primitive streak formation stage of embryonic development, using ActivinA to activate the Nodal signaling pathway and systematically optimizing its concentration and duration of action to determine the optimal conditions for guiding iPSCs toward mesoderm fate.

[0041] First, the NOTO-eGFP hiPSCs constructed in Example 1 were seeded in Matrigel-coated 6-well plates and cultured in mTesR plus medium until 70% confluence. Then, the culture was replaced with basal differentiation medium (DMEM / F12 medium:Neurobasal medium = 1:1, N2 supplement = 1×, B27 supplement = 1×, GlutaMAX = 1×, NEAA = 1×, β-ME = 0.1 mM, where "1×" indicates the working concentration recommended by the manufacturer; all components were purchased from Thermo Fisher Scientific) containing different concentrations of Activin A (0 ng / mL, 2 ng / mL, 10 ng / mL, 40 ng / mL, 100 ng / mL). After treatment, total RNA was extracted from the cells, and the expression level of the Nodal gene was detected by real-time quantitative PCR (qPCR). The results are as follows: Figure 2 As shown in a, the 40 ng / mL Activin A treatment group exhibited the highest Nodal gene expression level, which was significantly different from the control group and other concentration groups. p<0.01, (p<0.0001). This result indicates that 40 ng / mL is the optimal concentration for activating the Nodal signaling pathway.

[0042] Subsequently, the duration of stimulation guiding cells toward their intended mesodermal fate (notochord cells originate from the mesoderm) was determined. Cells were collected after treatment with basal differentiation medium containing 40 ng / mL Activin A for 24 hours (day 1) and 48 hours (day 2), respectively, for KEGG pathway enrichment analysis. The results are as follows: Figure 2 As shown in b and c, KEGG pathway enrichment analysis revealed that, in the 24-hour group, differentially expressed genes were enriched in mesoderm-related pathways (such as the TGF-β signaling pathway and the Wnt signaling pathway) and endoderm-related pathways, indicating that 24-hour Nodal activation placed cells in a biphasic potential state, retaining the ability to differentiate into both mesoderm and endoderm. In contrast, in the 48-hour group, cell fate was significantly biased towards the endoderm lineage, with significant enrichment in endoderm-related pathways (such as pancreatic secretion and intestinal network formation), while mesoderm pathway activity decreased.

[0043] In summary, notochord cells originate from the mesoderm, therefore, excessive cell bias towards the endoderm must be avoided during induction. Based on this, this invention determines 24 hours of Nodal signaling pathway activation as the optimal duration of action. This condition effectively initiates the mesodermal process while preventing endoderm fate locking due to excessive signaling, laying a crucial fate foundation for the subsequent efficient differentiation of cells into primitive streak mesoderm (PSM). Subsequent embodiments will be based on the "40 ng / mL Activin A treatment for 24 hours" protocol determined in this embodiment.

[0044] Example 3: Optimization of Primitive Streak (PS) Induction Conditions This embodiment aims to systematically evaluate the effects of different signaling pathway combinations on the induction efficiency of protostome mesoderm (PSM) using the NOTO-eGFP reporter gene hiPSCs cell line constructed in Example 1 and the Nodal activation conditions optimized in Example 2, in order to determine the optimal combination of small molecule compounds.

[0045] The formation of the primitive streak from pluripotent cells is the first step in mesodermal development. Multiple signaling pathways and molecular regulators, such as Nodal, BMP (bone morphogenetic protein), and Wnt signaling, play crucial roles in the formation and regulation of the primitive streak. The primitive streak plays a key role in gastrulation, a fundamental stage of embryogenesis where the three primitive germ layers (ectoderm, mesoderm, and endoderm) are established. The primitive streak is a critical developmental structure formed during early embryonic development in vertebrates, including humans. It forms on the surface of the epiblast, in the uppermost cells of the early embryo. Cells at the primitive streak move in different directions. Some cells move toward the streak and roll inward through it, while others move laterally to form the mesoderm. The remaining cells above the primitive streak become the ectoderm.

[0046] 1. Experimental Design and Grouping The NOTO-eGFP reporter gene hiPSCs cell line was treated with basal differentiation medium containing 40 ng / mL Activin A for 24 hours (day 1) according to the optimized protocol in Example 2 to initiate differentiation. The cells were then cultured for another 24 hours (day 2, i.e., a total differentiation time of 48 hours) in basal differentiation medium containing different combinations of signaling molecules (see groups 1-6 below for specific combination information).

[0047] This embodiment focuses on examining the synergistic effects of the Nodal pathway (hereinafter abbreviated as N when activated, activated by Activin A; abbreviated as N(-) when inhibited, inhibited by A-83-01), the Wnt pathway (hereinafter abbreviated as W when activated, which can also be abbreviated as C when activated by CHIR99021), the FGF pathway (hereinafter abbreviated as F when activated, activated by FGF2), the PI3K pathway (hereinafter abbreviated as P(-) when inhibited, inhibited by PIK90), and the BMP pathway (hereinafter abbreviated as B when activated, activated by BMP4).

[0048] according to Figure 3 Scheme 'a' in the diagram is used to set up the following experimental groups: (1) Simulation of front PS (Anterior PS, APS) conditions Group 1 (co-treatment): On day 1, 40 ng / mL Activin A, 20 ng / mL FGF2, 100 nM PIK90, and 5 μM CHIR99021 were added; also known as the NFWP(-) group.

[0049] Group 2 (Sequential Treatment A): On day 1, add 40 ng / mL Activin A; on day 2, add 20 ng / mL FGF2, 100 nM PIK90, and 5 μM CHIR99021; also known as the N-FWP(-) group.

[0050] Group 3 (Sequential Treatment B): 40 ng / mL Activin A was added on day 1; 20 ng / mL FGF2, 100 nM PIK90, 5 μM CHIR99021 and 1 μM A-83-01 were added on day 2; also known as the N-FWP(-)N(-) group.

[0051] (2) Simulation of mid / posterior PS (M / PPS) conditions Group 4 (co-treatment): On day 1, 40 ng / mL Activin A, 40 ng / mL BMP4, 5 μM CHIR99021, 20 ng / mL FGF2, and 100 nM PIK90 were added; also known as NFWP(-)B group.

[0052] Group 5 (Sequential Treatment A): On day 1, add 40 ng / mL Activin A; on day 2, add 40 ng / mL BMP4, 5 μM CHIR99021, 20 ng / mL FGF2, and 100 nM PIK90; also known as N-FWP(-) Group B.

[0053] Group 6 (Sequential Treatment B): On day 1, 40 ng / mL Activin A was added; on day 2, 40 ng / mL BMP4, 5 μM CHIR99021, 20 ng / mL FGF2, 100 nM PIK90 and 1 μM A-83-01 were added; also known as N-FWP(-)N(-)B group.

[0054] After treatment (48 hours of total differentiation), total RNA was extracted from cells in each group. The expression levels of the following key genes were detected by real-time quantitative PCR (qPCR) to comprehensively assess the differentiation status and lineage bias of cells: pluripotency marker OCT4 (to assess whether iPSCs have exited the pluripotent state), ectoderm marker PAX6 (to monitor whether non-target ectoderm differentiation has occurred), endoderm marker SOX17 (to monitor whether non-target endoderm differentiation has occurred), and the following multiple PSM markers Nodal, FoxA2, ​​MIXL1, Brachyury, and GSC (these markers are used to comprehensively assess the induction efficiency of the target primitive band mesoderm).

[0055] The results are as follows Figure 3 As shown in b, it can be seen that the N-FWP(-) group exhibits the best differentiation effect: in this group, the expression level of PSM markers is significantly higher than that of other groups, while the expression of pluripotency marker OCT4 is effectively upregulated, and the expression of non-target lineage markers PAX6 (ectoderm) and SOX17 (endoderm) is also maintained at a very low level.

[0056] The results indicate that a combined strategy of simultaneously activating the Nodal, Wnt, and FGF signaling pathways and inhibiting the PI3K pathway through specific sequential treatments can synergistically and efficiently guide iPSCs toward PSM fate, while actively inhibiting the maintenance of pluripotency and the differentiation of non-target lineages (ectoderm and endoderm).

[0057] Based on this, the N-FWP(-) combination (i.e., the treatment method in group 2) was determined as the optimal PSM induction protocol for subsequent induction of axial mesoderm (notochord). This protocol embodies the core differentiation logic of "inhibiting non-target fates," laying a crucial cellular foundation for efficient specialization in subsequent steps.

[0058] Example 4: Optimization of Axis Mesoderm (AM) Induction Conditions This embodiment aims to optimize the selective differentiation from protostomes to axial, paraaxial, and lateral mesoderm. During IVD (Intervertebral Disc) development, notochord cells derived from the parachordal mesoderm (axial mesoderm, notochord) serve as progenitor cells and gradually differentiate into iNCs. The Nodal pathway plays a crucial role in maintaining the pluripotency of hiPSCs and promoting parachordal-derived notochord cells. To activate or inhibit the Nodal pathway, ActivinA (for activation) or A-83-01 (for inhibition) was introduced during differentiation. The BMP4 pathway (hereinafter abbreviated as B(-)) was inhibited using LDN (LDN-193189), which acts on the development of axial, paraaxial, and lateral mesoderms. Furthermore, FGF2 was used to promote the differentiation of parachordal mesoderm cells.

[0059] This embodiment is based on the optimized PSM induction scheme (N-FWP(-) combination) of Example 3. It further systematically evaluates the effects of different signaling pathway combinations on the induction efficiency of axial mesoderm (notochord) and reveals the dynamic characteristics of the differentiation process and potential lineage shift problems through time-series gene expression analysis.

[0060] PSM cells obtained after 48 hours of induction according to the optimized scheme of Example 3 (N-FWP(-) combination) (day 2) were digested and re-seeded in Matrigel-coated culture plates. From day 3 onwards, the medium was replaced with basal differentiation medium containing different combinations of signaling molecules (see groups 7-16 below for specific combination information) to induce axial mesoderm, and culture continued until day 5. The following experimental groups were set up.

[0061] (1) Evaluate the role of Nodal signal: Evaluate whether Activin / Nodal signal allows for axial mesoblast formation.

[0062] Group 7 (Nodal activation): 5 μM CHIR99021 + 0.2 μM LDN-193189 were added to the basal differentiation medium, while 40 ng / mL Activin A was continuously present throughout the first step (PS induction).

[0063] Group 8 (Nodal inhibition): 5 μM CHIR99021 + 0.2 μM LDN-193189 were added to the basal differentiation medium, and 1 μM A-83-01 was added throughout the first step (PS induction).

[0064] (2) Evaluate the role of FGF signal: Evaluate whether FGF2 signal allows for the formation of axial mesoblast.

[0065] Group 9 (FGF activation): Add 5 μM CHIR99021 + 0.2 μM LDN-193189 + 10 ng / mLFGF2.

[0066] Group 10 (FGF inhibition): Add 5 μM CHIR99021 + 0.2 μM LDN-193189 + 100 nMPD173074 (FGF2R inhibitor).

[0067] (3) Evaluate the synergistic effect of Nodal and FGF signaling: Evaluate whether Activin / Nodal signaling alters FGF2-induced axial mesodermal specialization.

[0068] Group 11: Based on Group 7 (Nodal activation), add 10 ng / mL FGF2.

[0069] Group 12: Based on Group 8 (Nodal inhibition), add 10 ng / mL FGF2.

[0070] Group 13: Based on Group 7 (Nodal activation), add 100 nM PD173074.

[0071] Group 14: Based on Group 8 (Nodal inhibition), add 100 nM PD173074.

[0072] (4) Evaluate the role of BMP signal: Evaluate whether BMP4 signal allows for the formation of axial mesodermis.

[0073] Using the optimized scheme of Example 3, hiPSCs were differentiated into original strips, and then the following experiments were performed.

[0074] Group 15 (BMP activated, no BMP inhibited): 5 μM CHIR99021 + 40 ng / mL BMP4 added.

[0075] Group 16: Replace LDN-193189, the best group in groups 7-14, with 40 ng / mL BMP4.

[0076] To determine the optimal conditions for axial mesodermal differentiation, the screening criteria were to observe that the expression of pluripotency genes peaked on day 1 and then gradually decreased, indicating loss of pluripotency; PSM genes peaked on day 2 and then decreased; and axial mesodermal and notochord (NCs) genes peaked on day 4, achieving stable expression to promote NCs development.

[0077] Based on PCR results ( Figure 4 , Figure 5 In the N-FWP(-)-WB(-)F group (group 9, results from other groups not presented), pluripotency and PS genes were gradually lost, while axial mesoderm genes increased between days 3 and 5. However, on day 5, increased expression levels of paraxial and lateral mesoderm markers were observed, although they decreased after day 3.

[0078] To prevent paraxial mesoderm differentiation and to better understand its non-targeted differentiation into nonaxial mesoderm lineages, further analysis is needed to optimize pathway regulation.

[0079] Example 5: Maturation and Identification of Notochord Cells This embodiment aims to further mature and culture the obtained axial mesodermal progenitor cells based on the optimized axial mesodermal induction protocol (N-FWP(-)-WB(-)F combination) from Example 4, and evaluate the purity and efficiency of the final induced notochord cells (iNCs) using a multi-parameter detection system. Specifically, this embodiment utilizes the NOTO-eGFP reporter system and co-expression analysis of the notochord cell surface marker CD24 to achieve precise quantification of induction efficiency.

[0080] (1) Temporal expression analysis of key markers Axial mesodermal progenitor cells induced to day 5 according to the optimized protocol in Example 4 were digested and reseeded in Matrigel-coated culture plates. They were cultured in maturation medium (N2, B27, DMEM / F12 + ITS medium) containing N2 and B27 additives until day 7. To comprehensively assess cell fate transitions during differentiation, cells were collected on day 0 (iPSC initiation), day 2 (PSM stage), day 3, day 4, and day 5 (axial mesodermal stage). The expression dynamics of notochord cell-related genes were detected by qPCR. Results are shown below. Figure 6 .

[0081] First, the expression of extracellular matrix-related genes type I collagen (Collagen-1) and type II collagen (Collagen-2) showed a gradual upward trend from day 2 to day 5, indicating that the induced cells began to synthesize extracellular matrix components specific to notochord cells. Notably, although the expression level of type I collagen on day 5 was lower than that on day 0 (iPSCs), the continuous upward trend is consistent with the characteristics of gene expression reprogramming during differentiation.

[0082] Secondly, the expression of surface marker genes Tie2 and CD24 showed a gradual decreasing trend from day 0 to day 5. This phenomenon is consistent with the laws of developmental biology: the expression regulation of CD24 during notochord cell maturation is relatively complex, and its expression alone is insufficient as a precise indicator of differentiation stage, requiring combination with other markers for judgment.

[0083] (2) Quantitative detection of induction efficiency by flow cytometry CD24 is a glycosylated phosphatidylinositol (GPI)-anchored cell surface protein that plays a crucial role in notochord cell development. Studies have shown that CD24 primarily participates in the functional regulation of notochord cells through the following mechanisms: regulating the interaction between notochord cells and the surrounding extracellular matrix, and maintaining the integrity of the notochord structure. In developmental biology, CD24 is mainly considered a marker of mature notochord cells (rather than axidem mesodermal progenitor cells). Therefore, the expression pattern of CD24 dynamically changes during the transition from the axidem mesodermal stage to mature notochord cells, requiring comprehensive judgment in conjunction with other lineage-specific markers. Based on this, this embodiment further employs a strategy of co-expressing CD24 and NOTO-eGFP to quantitatively analyze the final induction efficiency. Specifically: NOTO-eGFP positive indicator cells have been successfully directed to the notochord lineage (axidem mesodermal stage); CD24 positive indicator cells further mature and enter the induced notochord cell (iNCs) stage; the co-expression of CD24 and GFP signifies that the cells have successfully completed the transition from axidem mesodermal progenitor cells to mature iNCs, which is the core identification indicator of the final product of this invention.

[0084] Specifically, this embodiment further quantifies the induction efficiency using flow cytometry: on day 7 of differentiation, cells were collected, CD24 surface staining was performed, and the proportion of CD24 / NOTO-eGFP double-positive cells was detected by flow cytometry. The results showed that the proportion of CD24 / GFP double-positive cells was as high as 80.7%. This result means that, under the optimized scheme of this invention, more than 80% of the final cell population consists of successfully oriented and matured induced notochord cells (iNCs). This induction efficiency is significantly higher than the general level reported in the literature (0.1%-18.4%, see Zhang, Y. et al., Directed Differentiation of Notochord-like and Nucleus Pulposus-like Cells Using Human Pluripotent StemCells. Cell Rep 2020, 30 (8), 2791-2806 e2795, and Diaz-Hernandez, ME et al., Derivation of notochordal cells from human embryonic stem cells reveals unique regulatory networks by single cell-transcriptomics. J Cell Physiol 2020, 235 (6), 5241-5255), representing a breakthrough.

[0085] (4) Validation of markers of mature notochord cells To further verify the functional characteristics of the obtained cells, immunofluorescence staining was performed on the cells on day 7 to detect the expression of mature notochord cell markers (such as...). Figure 7 (As shown). The results showed that the cells were NOTO-eGFP positive and highly expressed mature notochord cell markers, including keratin family (Keratin 8 / 18 / 19) and SOX family transcription factors (SOX5 / 6 / 9).

[0086] The results indicate that the iNCs obtained in this invention not only have the correct lineage identity, but also possess the molecular characteristics and functional properties of mature notochord cells.

[0087] In summary, this embodiment successfully demonstrates that the NOTO-eGFP reporter system, the staged precise signal modulation strategy, and the multi-parameter identification system established in this invention can efficiently and stably obtain high-purity (80.7%) functionally induced notochord cells (iNCs) from hiPSCs. This achievement lays a solid foundation for the large-scale preparation and clinical application of notochord cells.

[0088] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for the directed induction of iPSCs into notochord cells, comprising the following steps: Step 1: iPSCs were cultured in basal differentiation medium. The Nodal signaling pathway was activated by adding 40 ng / mL Activin A in the first time period, and the FGF and Wnt signaling pathways were activated by adding 20 ng / mL FGF2 and 5 μM CHIR99021 in the second time period. At the same time, 100 nM PIK90 was added to inhibit the PI3K signaling pathway, thereby inducing the iPSCs to differentiate into protosthenes. Step 2: The protosthenic cells were re-seeded in the basal differentiation medium and cultured. The Wnt signaling pathway and FGF signaling pathway were activated by adding 10 ng / mL FGF2 and 5 μM CHIR99021 in the third time period, while the BMP signaling pathway was inhibited by adding 0.2 μM LDN-193189. The fate of the protosthenic cells was guided to the axial mesoderm to obtain axial mesoderm progenitor cells. Step 3: The axial mesodermal progenitor cells are cultured in a maturation medium to further express mature notochord cell markers, thereby obtaining the notochord cells; wherein the first time period is 24 hours, the second time period is 24 hours, and the third time period is 72 hours; The basal differentiation medium comprises: DMEM / F12 medium: Neurobasal medium = 1:1, N2 supplement = 1×, B27 supplement = 1×, GlutaMAX = 1×, NEAA = 1×, β-ME = 0.1mM; and The mature culture medium includes: N2, B27, DMEM / F12 + ITS culture medium.

2. The directional induction method according to claim 1, wherein, The iPSCs are human iPSCs.

Images